Skip to main content
Emerging Infectious Diseases logoLink to Emerging Infectious Diseases
. 2010 Apr;16(4):656–663. doi: 10.3201/eid1604.090448

Contribution of Streptococcus anginosus to Infections Caused by Groups C and G Streptococci, Southern India

Silvana Reißmann 1,2,3, Claudia Friedrichs 1,2,3, Reena Rajkumari 1,2,3, Andreas Itzek 1,2,3, Marcus Fulde 1,2,3, Arne C Rodloff 1,2,3, Kootallur N Brahmadathan 1,2,3, Gursharan S Chhatwal 1,2,3, D Patric Nitsche-Schmitz 1,2,3,
PMCID: PMC3321935  PMID: 20350380

This neglected pathogen causes a large portion of these infections.

Keywords: Streptococcus anginosus, streptococci, groups C and G streptococci, suppurative infections, pharyngitis, bacteria, abscesses, research

Abstract

Vellore, a region in southern India, has a high incidence of severe human infections with β-hemolytic group C and G streptococci (GCGS). To determine the causative species in these infections, we conducted 16S rRNA gene sequencing: Streptococcus dysgalactiae subsp. equisimilis (81%) and S. anginosus (19%) were the causative organisms in the 2-year study period (2006–2007). We used PCR to detect the virulence-related emm gene; results showed that it was restricted to S. dysgalactieae subsp. equisimilis isolates of 99.2% tested positive. Due to a novel marker, S. anginosus and S. constellatus can be quickly and accurately distinguished from other members of the genus. The notable contribution of the anginosus group to human infections suggests that this group of obligate pathogens deserves more attention in healthcare and research.


Group C and group G streptococci (together GCGS) were first recognized as human pathogens in 1935 by Lancefield and Hare (1). Since then, awareness about their importance has greatly increased, especially within recent years (26). Similar to infections with Streptococcus pyogenes, the prime example of a pyogenic streptococcal pathogen, infections with GCGS can develop into life-threatening necrotizing fasciitis, sepsis, and streptococcal toxic shock–like syndrome. Lancefield groups C and G comprise a variety of species; one of those species, Streptococcus dysgalactiae subsp. equisimilis (SDSE), frequently causes human infections. This species can cause the whole spectrum of infections caused by S. pyogenes (4,5).

SDSE likely owes its virulence in humans to homologs of prominent S. pyogenes virulence genes (7,8). Most SDSE strains isolated from human infections possess emm genes (9,10), which code for the potent virulence factor called M protein (11). This surface localized protein contributes substantially toward the virulence of both S. pyogenes and SDSE in human hosts because it acts as an adhesin, invasin, and antiphagocytic factor (11). Strain-to-strain variability in the N terminus of M proteins, driven by the adaptive immune response of the host, has led to a vast emm type diversity. More than 100 genetically distinct M proteins exist within the GCGS group and form the basis for emm genotyping (12). However, SDSE is not the only species that causes severe diseases in humans. The variety of GCGS includes the typical animal pathogens S. equi subsp. zooepidemicus (group C) and S. canis (group G), which have the potential to cause zoonotic infections (13,14). Other streptococcal species that are pathogenic in humans and that occasionally expose groups C and G carbohydrates are gathered under the umbrella term anginosus group (15).

In the literature, the designation S. milleri (16) has often been used for streptococci of this group, although it has never been an officially approved name (15). Streptococci of the anginosus group can reside commensally in the human oral cavity but have a certain propensity to cause pharyngitis, bacteremia, and serious purulent infections in the deep neck and soft tissue and in internal organs such as the brain, lung, and liver (1725). The bacteria cause severe infections after surgical treatments and infect implanted material, thereby posing a problem of substantial clinical relevance (20,26,27). The species diversity within the GCGS highlights the limits of Lancefield grouping by agglutination assays, the typically applied method in the diagnosis of streptococcal infections. The genetically distinct GCGS species differ in pathogenesis, virulence mechanisms, and antimicrobial drug susceptibility. Thus, finding the optimal treatment regimen can be facilitated by species determination. Diagnosis of anginosus group infections is particularly difficult. The group comprises the species S. anginosus, S. intermedius, and S. constellatus of which the 2 subspecies, S. constellatus subsp. constellatus and S. constellatus subsp. pharyngis, are further distinguished. Identification of the anginosus group is complicated by wide phenotypic and antigenic diversity, even within 1 species. Although most anginosus group isolates belong to the non-β-hemolytic oral streptococci, β-hemolytic strains are found in all 3 species. Some anginosus group strains carry a typeable Lancefield group antigen, which belongs to group F, C, G, or A (28).

Routine microbiologic diagnosis of streptococcal infections is often restricted to determination of the type of hemolysis and of the Lancefield group. Identification of streptococci to the species level is rarely carried out. This leaves a considerable risk for misidentification of causative pathogens, which can lead to an inappropriate treatment of the infection (2931). As a further consequence of the complications associated with species determination, insight into the epidemiology of infections with certain streptococci remains imprecise, and the epidemiology of the anginosus group, in particular, remains widely elusive. Comprehensive insights are missing that could enable clinicians to reevaluate respective diagnostic and therapeutic routines. Moreover, such insights may stimulate research that aims at clarifying the pathogenesis of these streptococcal species and the development of specialized treatments and prevention strategies. These goals have motivated our cross-species study of human pathogenic GCGS from Vellore, India, a region with a high incidence of such infections. Examination of epidemiologic contributions of the different streptococcal species was combined with a cross-species screening for emm genes, which identified a novel gene in S. anginosus and S. constellatus. The use of this gene as a marker for fast detection of infections caused by these 2 streptococcal species was investigated.

Methods

Bacterial Strains, Lancefield Typing, and Genomic DNA

Clinical isolates of group G and group C streptococci were collected at the Department of Clinical Microbiology, Christian Medical College, Vellore, India, from 2006 through 2007. The collection comprised isolates from patients with pharyngitis (throat swabs), patients with respiratory (sputum) and urinary tract infections (urine), and from other suppurative foci (pus) and blood. Streptococci were collected from 2004 through 2006 at the University Hospital in Leipzig, Germany. The isolates were recovered from blood cultures, wound swabs, aspirates of peritonsillar abscesses, abscesses in the inner body, and catheter tips. The collection was typed as described previously (32). Bacterial strains were subcultured on Columbia agar with 5% sheep blood (Becton-Dickinson, Franklin Lakes, NJ, USA). Cultures from single colonies were grown overnight (37°C in 5% CO2) in Todd-Hewitt broth (Becton-Dickinson) supplemented with 0.5% yeast extract. The Lancefield group was determined by using the Slidex streptococcal grouping kit (Oxoid, Basingstoke, UK). Genomic DNA was isolated by using the DNeasy Blood and Tissue Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s protocol with a minor variation: the incubation with proteinase K was carried out at 70°C for 30 min.

Sequencing of emm and 16S rRNA Genes

Amplification of emm genes from streptococcal genomic DNA samples was performed by using the primers 1 and 2 recommended by the Centers for Disease Control and Prevention (12) (emm-PCR). To amplify the 16S rRNA gene, PCR was performed with a pair of generic primers: 16S rDNA fwd and 16S rDNA rev (Table 1), for gram-positive bacteria as described (33). PCR experiments were analyzed by agarose (1%) gel electrophoresis. PCR products were purified by using the QIAGEN PCR purification Kit (QIAGEN, Hilden, Germany) and sequenced by using primer 16S rDNA fwd (Table 1), the Big Dye Terminator reaction, and an ABI Prism 377 system (Applied Biosystems, Foster City, CA, USA).

Table 1. Sequences of primers used in study of groups C and G streptococci, Vellore, India, and Leipzig, Germany*.

Name Sequence (5′ → 3′) Application
16S rDNA fwd AGAGTTTGATCCTGGCTC 16S rDNA amplification
16S rDNA rev
GGTTACCTTGTTACGACTT
Primer 1 TATTCGCTTAGAAAATTAA emm amplification
Primer 2
GCAAGTTCTTCAGCTTGTTT
M13 rev CAATTTCACACAGGAAACAGCTATGAC Sequencing of 1.1-kb fragment of moac
M13 fwd
GTAAAACGACGGCCAGTGAATTG
moac1 CAAGGAATTGATTCAGCAACAGTGC Inverse PCR and sequencing of moac
moac3 CTTCTCAACAAGCATTGGCAGATGC
moac6 GTGTGTATACACGTCGGACATTTCC
moac7 GGTACAGTAATGGGAAGTTTGTTAGG
moac8 GCGGATTGACTTCATTTGGCGTCG
moac9 GGTTTGGGGATGTCTTCTTCCATGG
moac10 GCATCTCAAATCAGACGAGCAAGC
moac11 CTTGAACTTGTCTTCGCATGGAGC
moac12 GACTATTATCAAACGGTATTTGCTCG
moac2 CCAATTCACTTGAATTGACGAATCC
moac4 GCCCAACCTGAAGACAGTTGAGC
moac5 CTGACGAAAAGAGAGCCAGATATCC
moac13 CTGATACCATAATCTGACATCACTGC
moac14
GAAGTTGAACTATCTCCAATCACCG
moac-SP ATGAAAAAATCCATTCTAAATAAGGATATC Screening for 3,272-bp fragment of moac
moac-TMH7
AAGACTGGCACAAGATATAC
moac-BamH1 GCGGATCCGGTCATTTTCCAAGCAAGG Screening for 962-bp fragment of moac
moac-Sal1 GCTGTCGACTTATTAAATTCAGCCTGCTTTTTCTCC

*moac, marker of Streptococcus anginosus and S. constellatus.

Inverse PCR and Sequencing of a Marker of S. anginosus and S. constellatus

Application of emm-PCR on the genomic DNA of S. anginosus strain SV52 produced a 1.1-kb amplicon, subsequently identified as a fragment of a marker of S. anginosus and S. constellatus (moac). The fragment was cloned into the pCR2.1-TOPO vector by using the TOPO TA cloning kit (Invitrogen, Carlsbad, CA, USA) and then sequenced by using primers M13 rev and M13 fwd (Table 1). Inverse PCR was used to amplify the genomic DNA segments flanking the 1.1-kb fragment of moac. Genomic DNA (1 µg) was digested separately with 1–3 of the following enzymes: AseI, AvrII, BamHI, BglII, BsaI, BseYI, EcoRI, HindIII, NdeI, NsiI, PstI, SacI, SalI, SpeI, XbaI, XhoI (New England Biolabs, Ipswich, MA, USA). Digestion was carried out for 16 h under conditions recommended by the manufacturer. Digested genomic DNA was diluted both 100-fold and 10-fold before self-ligation with 160 U ligase (16 h, 16°C). Afterwards the ligations were used as a template in PCR experiments with different combinations of the primers moac1 to moac14 (Table 1). PCR was performed in a thermocycler (Biometra GmbH, Goettingen, Germany) with an initial denaturation step (4 min at 96°C), followed by 30 cycles of denaturation (40 s at 94°C), annealing (30 s at 56°C), and extension (1 min, 30 s, up to 3 min, 72°C). A final extension was carried out for 5 min at 72°C. PCR products were analyzed, purified, and sequenced as described above.

Screening for moac

Isolated genomic DNA was tested by PCR for the presence of the moac gene. For this purpose, 2 primer pairs (Table 1) were used to amplify a 3,272-bp fragment (primers: moac-SP, moac-TMH7) and a 962-bp internal fragment (primers: moac-BamHI, moac-SalI) of moac, respectively. For amplification of the 962-bp fragment, initial denaturation (4 min at 96°C) was followed by 25 cycles of denaturation (40 s at 94°C), annealing (30 s at 53°C), and extension (1 min 30 s at 72°C), and then by a final extension step for 5 min at 72°C. The 3,272-bp fragment was amplified with 30 cycles by using an annealing temperature of 50°C and an extension time of 3 min, 20 s. The PCR products were analyzed, purified, and sequenced as described above.

Sequence Analysis

Sequence data were processed and analyzed by using the software BioEdit version 7.0.1 (Isis Pharmaceuticals, Carlsbad, CA, USA). Coiled coil structures and transmembrane helixes were predicted with the Web-based programs Coils (34) and TMHMM Server v. 2.0 (35), respectively.

Results

Typing of GCGS Isolates and Screening for emm (-like) Genes

The Vellore region in India has a high incidence of group C and G streptococcal infections (36). For characterization of local pathogenic GCGS strains, 313 isolates were collected from patients with suppurative or invasive infections at the Christian Medical College. The study was designed to be cross-species; therefore, the only preselection criteria applied were type of hemolysis and Lancefield type. Sequencing showed that 254 of the strains showed highest homology with the 16S rRNA gene from SDSE and that the sequences of the remaining 59 strains were homologous to S. anginosus (Table 2). Notably, all S. anginosus strains belonged to Lancefield group G. M proteins have a fundamental role in streptococcal infections. Therefore, and because of a potential power to discriminate between SDSE and anginosus group strains, the collection was examined by emm-PCR (12) (Table 2). Specific PCR products were obtained for 252 of the 313 stains. Two of the SDSE strains and the 59 anginosus group strains were not emm-typeable. The SDSE strains comprised 44 different emm types, of which 2, stG120 and stG351, have not been previously described (Table 3).

Table 2. Typing of groups C and G streptococci collection, Vellore, India.

Species (N = 313) 16S rRNA gene emm-PCR
positive/negative moac-PCR*
positive/negative Lancefield group
G C
S. dysgalactiae subsp. equisimilis 254 252/2 0/254 208 46
S. anginosus 59 0/59 59/0 59 0

*Tested with 2 primer pairs (Figure). moac, marker of Streptococcus anginosus and S. constellatus.

Table 3. emm typing of pathogenic Streptococcus dysgalactiae subsp. equisimilis isolates from Vellore, India*.

emm type No. strains
stG245 32
stG6792 18
stG643 17
stG6 14
stG653 14
stC1400 12
stGL265 12
stG652 11
stG866 10
stC5345 9
stG485 9
stC74a 9
stC6979 8
stC839 7
stGLP1 7
stGrobn 5
stC922 4
stG211 4
stC2sk 3
stG2574 3
stG4222 3
stG480 3
stG4831 3
stG5420 3
stG7882 3
stG120* 3
emm31 2
stC36 2
stCK401 2
stG166b 2
stG2078 2
stG840 2
stG97 2
stG10 2
stG351* 1
emm23 1
stC1741 1
stC3852 1
stC46 1
stC5344 1
stC6746 1
stC-NSRT2 1
stGM220 1
stMD216 1

*The 5′ sequences of newly identified emm-genes are deposited in GenBank (accession nos. FJ036933, FJ036936, and FJ036937) and in the emm-gene database of the Centers for Disease Control and Prevention, Atlanta, GA, USA.

Characteristics of a Newly Discovered Open Reading Frame of S. anginosus

Our recent survey at the University Hospital in Leipzig, comprising 127 cases of severe infections with oral streptococci, found that a large number of infections were caused by strains that belonged to the anginosus group (26%). We included the anginosus group strains from the Leipzig collection in the emm-typing experiments described above to increase the number of isolates and the phenotypic diversity of the collection in terms of Lancefield antigen and type of hemolysis. Like the S. anginosus strains from Vellore, none of the 33 strains from Leipzig was emm-typeable. Under less stringent conditions, the PCR produced a low concentration amplicon of 1.1 kb (Figure).

Figure.

Figure

Amplification and characterization of a newly discovered open reading frame (ORF) of Streptococcus anginosus. A) Gel electrophoresis after emm-PCR on S. anginosus isolate SV52 (SV52) and S. pyogenes strain A60 (A60). The latter isolate was used as a control that possesses an emm3 gene. The S. anginosus strain generated a low concentration 1.1-kb amplicon, as compared with the 1.4-kb product of the S. pyogenes strain. Inverse PCR based on the 1.1-kb sequence of SV52 showed an ORF of 3,363 bp. Its sequence is predicted to code for the membrane protein that is schematically depicted in panel B. It comprises an N terminal signal peptide (S) followed by a large extracellular region of 60 kDa (ECR1), 7 transmembrane helixes (1–7), and another large extracellular region of 23 kDa situated between the fourth and the fifth transmembrane helix (ECR3). Positions of the 2 alternative marker of Streptococcus anginosus and S. constellatus PCR products (I and II) relative to the full-length sequence and their length are indicated in basepairs.

Sequencing of the of 1.1-kb PCR product did not show considerable similarities with emm-genes, however, the lack of stop codons in 1 frame of translation motivated further investigations on that PCR product. Inverted PCR experiments on S. anginosus strain SV52 identified an open reading frame (ORF) of 3,363-bp (GenBank accession no. GQ456155). Computational analysis predicts a 124-kDa membrane protein with 7 transmembrane sequences and a signal peptide for secretion (Figure). The predicted protein further consists of 2 larger extracellular regions, one of 23 kDa located between the fourth and fifth transmembrane sequence and one of 60 kDa at its N terminal end. The central part of the N terminal extracellular region contains a stretch of heptad-repeats (aa 204 to 520 of the mature protein), which may enable coiled-coil oligomerization. Other than this, the protein has no obvious or significant features of an M- or M-related protein. Prediction of 7 transmembrane sequences suggests a receptor function or a function in transport processes. The latter assumption is corroborated by a high similarity of the protein sequence to numerous bacterial permease components of ATP-binding cassette transporters.

Distinguishing of S. anginosus and S. constellatus from Other Oral Streptococci by a Newly Discovered ORF

The distribution of the newly discovered ORF in the Leipzig collection of oral streptococci was examined by PCR with 2 different primer pairs (Table 1). Both primer combinations gave identical results. The collection consists of 127 clinical isolates of which 33 belong to the anginosus group (17 S. anginosus, 8 S. constellatus subsp. constellatus, 4 S. constellatus subsp. pharyngis, 4 S. intermedius); 78 belong to species of the mitis group (S. mitis, S. oralis, S. sanguinis, S. parasanguinis). Fourteen strains have been typed as S. salivarius and 2 as S. gallolyticus. Specific PCR products were obtained exclusively within the anginosus group. All S. anginosus and S. constellatus isolates tested positive. Negative PCR distinguished S. intermedius from the other 2 species. The results were confirmed in experiments with reference strains from the Deutsche Sammlung für Mikroorganismen und Zellkulturen (Table 4). Taken together, the results demonstrate that the newly discovered gene is a marker that discriminates S. anginosus and S. constellatus from other oral streptococci. The gene was therefore designated moac.

Table 4. Distribution of moac within a collection of oral streptococci, Vellore, India, and Leipzig, Germany*.

Group/species No. strains moac-PCR
Anginosus group 33
Streptococcus anginosus 17 +
S. constellatus subsp. constellatus 8 +
S. constellatus subsp. pharyngis 4 +
S. intermedius
4

Bovis group 2
S. gallolyticus
2

Mitis group 78
S. gordonii 5
S. mitis/S. oralis 12
S. mitis 12
S. oralis 24
S. parasanguinis 18
S. sanguinis
7

Salivarius group 14
S. salivarius
14

Reference strains (DSMZ)
Anginosus group 4
S. anginosus 1 +
S. constellatus subsp. constellatus 1 +
S. constellatus subsp. pharyngis 1 +
S. intermedius 1
Mutans group 1
S. mutans 1

*moac, marker of Streptococcus anginosus and S. constellatus; DSMZ, Deutsche Sammlung für Mikroorganismen und Zellkulturen.

Moac as a Marker for S. anginosus within GCGS

The data that were obtained with the Leipzig collection of oral streptococci suggested that moac could also be exploited as a marker for β-hemolytic strains of the anginosus group. To further test the quality of moac as a marker, the Vellore GCGS collection was subjected to moac-specific PCR (moac-PCR). The results are summarized in Table 2. All 254 strains that were specified as SDSE on the basis of their 16S rRNA gene sequence were negative in moac-PCR. The 59 remaining strains, which could be assigned to the species S. anginosus by 16S rRNA gene sequencing, were positive for moac. Moreover, strains of the species S. canis (2), S. equi subsp. zooepidemicus (3), S. equi subsp. equi (2), and S. dysgalactiae subsp. dysgalactiae (2) were negative in the moac-PCR, proving that it is a reliable method for identifying anginosus group strains in collections of GCGS. The examination showed that S. anginosus isolates constitute 19% of the collection of β-hemolytic GCGS isolates from clinical suppurative infections in Vellore; thus, these pathogens play a considerable epidemiologic role in acute streptococcal infections that occur in this region.

Discussion

Lancefield groups C and G comprise a variety of distinct species; of these species, S. dysgalactiae subsp. equisimilis, S. equi subsp. zooepidemicus, S. canis, and streptococci of the anginosus group cause severe infections in humans (25, 1727). Examination of clinical isolates from patients with purulent infections of the upper respiratory tract, the urinary tract, and invasive infections showed that SDSE is dominant in GCGS infections in Vellore, accounting for 81% of the cases. SDSE was responsible for all 7 cases of invasive infections included in this study. S. anginosus that possess group G antigens accounted for the remaining 19% of the suppurative infections, which indicates a considerable epidemiologic role for this species in the Vellore region. In contrast, β-hemolytic group C streptococci of the pharyngitis-associated species S. constellatus subsp. pharyngis (37) were not detected. Infections with the typically zoonotic β-hemolytic GCGS S. equi subsp. zooepidemicus (group C) and S. canis (group G) were also not diagnosed, which suggests a comparatively low incidence of such infections in Vellore. Groups C and G antigens are rare in S. constellatus subsp. constellatus and in S. intermedius (28), if they are present at all in these species. Their absence in the Vellore GCGS collection, therefore, cannot be considered as indicative that these species have less clinical relevance.

The high phenotypic and antigenic diversity within the anginosus group, and the circumstance that non–β-hemolytic strains remain inconspicuous in samples that contain commensal flora, make anginosus group infections difficult to diagnose. Therefore, contribution of the anginosus group as a whole to the epidemiology of streptococcal infections is poorly understood and needs further investigation, not only in Vellore but also in other regions with suspected high incidence. The required surveys will become feasible with the identification of potent markers for detection of anginosus strains such as the moac marker. The isolates from Vellore and Leipzig together represent a highly diverse collection of anginosus strains that differ not only in their geographic origin, but greatly in Lancefield type. The collection comprises strains with groups A, C, G, and F, and without Lancefield antigen. Furthermore, the collection includes isolates with all types of hemolysis. The diagnostic power of moac is demonstrated by the herein described PCR test that identified all of the phenotypically diverse S. anginosus and S. constellatus strains, discriminating them from other streptococci with 100% accuracy. To the best of our knowledge, this PCR method is the only one described that distinguishes S. constellatus subsp. pharyngis and S. intermedius. In addition to the reliability, the use of the moac as a marker may have a further valuable advantage; the moac gene is predicted to code for a transmembrane protein, a property that could be exploited for the development of an antibody based test for species determination.

Further valuable diagnostic information may lie in the emm gene. Examination of the Vellore collection allowed assessment of emm typing for use in species determination. Most of the 254 SDSE strains included in this study were positive for the emm gene by PCR. However, 2 strains of this species were negative for it, indicating that a negative emm-PCR is not an accurate exclusion criterion in typing of SDSE. In contrast to SDSE strains, all anginosus group strains, from both the Vellore and the Leipzig collection, were negative in emm-PCR. This examination of phenotypically diverse strains strongly suggests that a negative result from emm-PCR is a common, if not a general, property of the anginosus group. Oligonucleotide hybridization experiments did not show any indications for the presence of emm-homologs in such isolates (data not shown). Moreover, and contrary to observations with S. equi subsp. zooepidemicus and S. equi subsp. equi, binding experiments with plasma proteins suggest that anginosus strains lack surface proteins that exert the typical functions of M proteins (data not shown).

Despite the absence of this key virulence factor, the anginosus group includes opportunistic pathogens that can cause bacteremia and a variety of severe purulent infections in the oral cavity, the urogenital tract, and internal organs. This circumstance raises the question, what are the factors that allow streptococci of the anginosus group to colonize at the site of infection and to survive under the hostile conditions of the suppurative focus of infection and the bloodstream? Little is known about the pathogenesis of anginosus group infections, but they seem to be governed by unique, unknown mechanisms. Unique mechanisms of pathogenesis and the decreased susceptibility of anginosus group strains to certain antimicrobial drugs (15) create a need for well-tailored treatments and thus for accurate diagnosis. In this context, indications that treatment with metronidazole facilitates infections with streptococci of the anginosus group deserve particular attention (26,3840). Accumulating indications of the considerable clinical relevance of the anginosus group and the propensity of these bacteria to develop antimicrobial drug resistance suggest that they may be a group of emerging pathogens that should be monitored.

Acknowledgments

The excellent technical assistance of Annett Hennig-Rolle, Nina Janze, and Katja Mummenbrauer is gratefully acknowledged. We also thank the curators of the CDC database for streptococcal emm genes for their help in identifying new emm types.

This work was supported by the Presidential Fund of the Helmholtz Foundation in the framework of the Virtual Institute: Oral Streptococci, by a grant of the European Community’s Sixth Framework Program under contract no. FP6-2004-INCO-DEV-3-032390, and by a DAAD-DST Bilateral Grant to K.N.B. and G.S.C.

Biography

Dr Reißmann is a biologist at the Helmholtz-Centre for Infection Research. She conducts research on streptococcal pathogens, developing new diagnostics approaches and investigating their mechanisms of pathogenesis.

Footnotes

Suggested citation for this article: Reißmann S, Friedrichs C, Rajkumari R, Itzek A, Fulde M, Rodloff AC, et al. Contribution of Streptococcus anginosus to infections caused by groups C and G streptococci, southern India. Emerg Infect Dis [serial on the Internet]. 2010 Apr [date cited]. http://dx.doi.org/10.3201/eid1604.090448

References

  • 1.Lancefield RC, Hare R. The serological differentiation of pathogenic and non-pathogenic streptococci from parturient woman. J Exp Med. 1935;61:335–49. 10.1084/jem.61.3.335 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Hill HR, Caldwell GG, Wilson E, Hager D, Zimmerman RA. Epidemic of pharyngitis due to streptococci of Lancefield group G. Lancet. 1969;2:371–4. 10.1016/S0140-6736(69)92713-5 [DOI] [PubMed] [Google Scholar]
  • 3.Efstratiou A. Outbreaks of human infection caused by pyogenic streptococci of Lancefield groups C and G. J Med Microbiol. 1989;29:207–19. 10.1099/00222615-29-3-207 [DOI] [PubMed] [Google Scholar]
  • 4.Nohlgard C, Björklind A, Hammar H. Group G streptococcal infections on a dermatological ward. Acta Derm Venereol. 1992;72:128–30. [PubMed] [Google Scholar]
  • 5.Baracco GJ, Bisno AL. Group C and group G streptococcal infections: epidemiologic and clinical aspects. In: Fischetti VA, editor. Gram-positive pathogens. 2nd ed. Washington: American Society for Microbiology Press; 2006. p. 223–9. [Google Scholar]
  • 6.Broyles LN, Van Beneden C, Beall B, Facklam R, Shewmaker PL, Malpiedi P, et al. Population-based study of invasive disease due to beta-hemolytic streptococci of groups other than A and B. Clin Infect Dis. 2009;48:706–12. 10.1086/597035 [DOI] [PubMed] [Google Scholar]
  • 7.Cleary PP, Peterson J, Chen C, Nelson C. Virulent human strains of group G streptococci express a C5a peptidase enzyme similar to that produced by group A streptococci. Infect Immun. 1991;59:2305–10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Davies MR, McMillan DJ, Beiko RG, Barroso V, Geffers R, Sriprakash KS, et al. Virulence profiling of Streptococcus dysgalactiae subspecies equisimilis isolated from infected humans reveals 2 distinct genetic lineages that do not segregate with their phenotypes or propensity to cause diseases. Clin Infect Dis. 2007;44:1442–54. 10.1086/516780 [DOI] [PubMed] [Google Scholar]
  • 9.Bisno AL, Craven DE, McCabe WR. M proteins of group G streptococci isolated from bacteremic human infections. Infect Immun. 1987;55:753–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Schnitzler N, Podbielski A, Baumgarten G, Mignon M, Kaufhold A. M or M-like protein gene polymorphisms in human group G streptococci. J Clin Microbiol. 1995;33:356–63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Fischetti VA. Streptococcal M protein: molecular design and biological behavior. Clin Microbiol Rev. 1989;2:285–314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Centers for Disease Control and Prevention. Protocol for emm-typing [cited 2009 Mar 12]. http://www.cdc.gov/ncidod/biotech/strep/protocol_emm-type.htm
  • 13.Beres SB, Sesso R, Pinto SW, Hoe NP, Porcella SF, Deleo FR, et al. Genome sequence of a Lancefield group C Streptococcus zooepidemicus strain causing epidemic nephritis: new information about an old disease. PLoS One. 2008;3:e3026. 10.1371/journal.pone.0003026 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Galperine T, Cazorla C, Blanchard E, Boineau F, Ragnaud JM, Neau D. Streptococcus canis infections in humans: retrospective study of 54 patients. J Infect. 2007;55:23–6. 10.1016/j.jinf.2006.12.013 [DOI] [PubMed] [Google Scholar]
  • 15.Ruoff KL. Streptococcus anginosus (“Streptococcus milleri”): the unrecognized pathogen. Clin Microbiol Rev. 1988;1:102–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Guthof O. Pathogenic strains of Streptococcus viridans; streptocci found in dental abscesses and infiltrates in the region of the oral cavity [in German]. Zentralbl Bakteriol. 1956;166:553–64. [PubMed] [Google Scholar]
  • 17.Moore-Gillon JC, Eykyn SJ, Phillips I. Microbiology of pyogenic liver abscess. Br Med J (Clin Res Ed). 1981;283:819–21. 10.1136/bmj.283.6295.819 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Parker MT, Ball LC. Streptococci and aerococci associated with systemic infection in man. J Med Microbiol. 1976;9:275–302. 10.1099/00222615-9-3-275 [DOI] [PubMed] [Google Scholar]
  • 19.Bateman NT, Eykyn SJ, Phillips I. Pyogenic liver abscess caused by Streptococcus milleri. Lancet. 1975;1:657–9. 10.1016/S0140-6736(75)91760-2 [DOI] [PubMed] [Google Scholar]
  • 20.Van der Auwera P. Clinical significance of Streptococcus milleri. Eur J Clin Microbiol. 1985;4:386–90. 10.1007/BF02148688 [DOI] [PubMed] [Google Scholar]
  • 21.Murray HW, Gross KC, Masur H, Roberts RB. Serious infections caused by Streptococcus milleri. Am J Med. 1978;64:759–64. 10.1016/0002-9343(78)90514-4 [DOI] [PubMed] [Google Scholar]
  • 22.Shlaes DM, Lerner PI, Wolinsky E, Gopalakrishna KV. Infections due to Lancefield group F and related Streptococci (S. milleri, S. anginosus). Medicine (Baltimore). 1981;60:197–207. 10.1097/00005792-198105000-00003 [DOI] [PubMed] [Google Scholar]
  • 23.Jacobs JA, Pietersen HG, Stobberingh EE, Soeters PB. Bacteremia involving the “Streptococcus milleri” group: analysis of 19 cases. Clin Infect Dis. 1994;19:704–13. [DOI] [PubMed] [Google Scholar]
  • 24.Jacobs JA, Pietersen HG, Walenkamp GH, Stobberingh EE, Soeters PB. Intervertebral infection caused by Streptococcus milleri. A case report. Clin Orthop Relat Res. 1994; (302):183–8. [PubMed] [Google Scholar]
  • 25.Whiley RA, Beighton D, Winstanley TG, Fraser HY, Hardie JM. Streptococcus intermedius, Streptococcus constellatus, and Streptococcus anginosus (the Streptococcus milleri group): association with different body sites and clinical infections. J Clin Microbiol. 1992;30:243–4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Tresadern JC, Farrand RJ, Irving MH. Streptococcus milleri and surgical sepsis. Ann R Coll Surg Engl. 1983;65:78–9. [PMC free article] [PubMed] [Google Scholar]
  • 27.Laine P, Salo A, Kontio R, Ylijoki S, Lindqvist C, Suuronen R. Failed dental implants - clinical, radiological and bacteriological findings in 17 patients. J Craniomaxillofac Surg. 2005;33:212–7. 10.1016/j.jcms.2004.12.004 [DOI] [PubMed] [Google Scholar]
  • 28.Facklam R. What happened to the streptococci: overview of taxonomic and nomenclature changes. Clin Microbiol Rev. 2002;15:613–30. 10.1128/CMR.15.4.613-630.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Hamrick HJ, Mangum ME. Beta-hemolytic Streptococcus milleri group misidentified as Streptococcus pyogenes on throat culture. Pediatr Infect Dis J. 1999;18:75–6. 10.1097/00006454-199901000-00022 [DOI] [PubMed] [Google Scholar]
  • 30.Dierksen KP, Tagg JR. Haemolysin-deficient variants of Streptococcus pyogenes and S. dysgalactiae subsp. equisimilis may be overlooked as aetiological agents of pharyngitis. J Med Microbiol. 2000;49:811–6. [DOI] [PubMed] [Google Scholar]
  • 31.Johnson DR, Kaplan EL. False-positive rapid antigen detection test results: reduced specificity in the absence of group A streptococci in the upper respiratory tract. J Infect Dis. 2001;183:1135–7. 10.1086/319286 [DOI] [PubMed] [Google Scholar]
  • 32.Friedrichs C, Rodloff AC, Chhatwal GS, Schellenberger W, Eschrich K. Rapid identification of viridans streptococci by mass spectrometric discrimination. J Clin Microbiol. 2007;45:2392–7. 10.1128/JCM.00556-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Takahashi T, Kaneko M, Mori Y, Tsuji M, Kikuchi N, Hiramune T. Phylogenetic analyses of Staphylococcus based on the 16S rDNA sequence and assignment of clinical isolates from animals. J Vet Med Sci. 1997;59:775–83. 10.1292/jvms.59.775 [DOI] [PubMed] [Google Scholar]
  • 34.Lupas A, Van Dyke M, Stock J. Predicting coiled coils from protein sequences. Science. 1991;252:1162–4. 10.1126/science.252.5009.1162 [DOI] [PubMed] [Google Scholar]
  • 35.Krogh A, Larsson B, von Heijne G, Sonnhammer EL. Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. J Mol Biol. 2001;305:567–80. 10.1006/jmbi.2000.4315 [DOI] [PubMed] [Google Scholar]
  • 36.Brahmadathan KN, Koshi G. Importance of group G streptococci in human pyogenic infections. J Trop Med Hyg. 1989;92:35–8. [PubMed] [Google Scholar]
  • 37.Whiley RA, Hall LM, Hardie JM, Beighton D. A study of small-colony, beta-haemolytic, Lancefield group C streptococci within the anginosus group: description of Streptococcus constellatus subsp. pharyngis subsp. nov., associated with the human throat and pharyngitis. Int J Syst Bacteriol. 1999;49:1443–9. 10.1099/00207713-49-4-1443 [DOI] [PubMed] [Google Scholar]
  • 38.Onderdonk AB, Cisneros RL. Comparison of clindamycin and metronidazole for the treatment of experimental intraabdominal sepsis produced by Bacteroides fragilis and Streptococcus intermedius. Curr Ther Res. 1985;38:893–8. [Google Scholar]
  • 39.Hatoff DE. Perineal Crohn's disease complicated by pyogenic liver abscess during metronidazole therapy. Gastroenterology. 1983;85:194–5. [PubMed] [Google Scholar]
  • 40.Allison HF, Immelman EJ, Forder AA. Pyogenic liver abscess caused by Streptococcus milleri. Case reports. S Afr Med J. 1984;65:432–5. [PubMed] [Google Scholar]

Articles from Emerging Infectious Diseases are provided here courtesy of Centers for Disease Control and Prevention

RESOURCES