The isolates were similar to those that cause disease in humans.
Keywords: Avian, enteritis, Escherichia, pathology, bacterial toxins, veterinary, intimin, cytolethal distending toxin, bacteria, research
Abstract
Escherichia albertii has been associated with diarrhea in humans but not with disease or infection in animals. However, in December 2004, E. albertii was found, by biochemical and genetic methods, to be the probable cause of death for redpoll finches (Carduelis flammea) in Alaska. Subsequent investigation found this organism in dead and subclinically infected birds of other species from North America and Australia. Isolates from dead finches in Scotland, previously identified as Escherichia coli O86:K61, also were shown to be E. albertii. Similar to the isolates from humans, E. albertii isolates from birds possessed intimin (eae) and cytolethal distending toxin (cdtB) genes but lacked Shiga toxin (stx) genes. Genetic analysis of eae and cdtB sequences, multilocus sequence typing, and pulsed-field gel electrophoresis patterns showed that the E. albertii strains from birds are heterogeneous but similar to isolates that cause disease in humans.
In late December 2004, deaths of common redpoll finches (Carduelis flammea) were reported around the city of Fairbanks, Alaska, USA, coincident with a prolonged period of extreme cold (below –40°F). The final reported death occurred on February 24. At the beginning of the outbreak, the local at-risk population was estimated to be ≈8,000 redpoll finches, a historic high for the area. Although ≈100 deaths were documented, the actual number is assumed to be considerably higher.
Outbreaks of disease in wild finches (family Fringillidae) have been associated with Salmonella enterica subsp. enterica serotype Typhimurium, Mycoplasma gallisepticum, poxvirus, and Escherichia coli (1–6). Diagnostic investigation into the Alaska outbreak identified Escherichia albertii as the probable cause of death and as a new pathogen for birds. E. albertii had been identified as an enteric pathogen of humans in Asia (7) and, more recently, in Africa and North America (T.S. Whittam and H. Steinsland, unpub. data), but to our knowledge, until this outbreak its presence in animals had not been observed.
We describe the identification and characterization of E. albertii from birds in North America, Europe, and Australia. We show that bacterial isolates from dead finches in Scotland, previously identified as E. coli O86:K61, were actually E. albertii. The genetic diversity of 2 virulence loci (intimin and cytolethal distending toxin) for the bird isolates was compared with characterized human pathotypes. We also determined genetic relatedness among isolates from birds and humans by multilocus sequence typing (MLST) and clonality of multiple isolates from dead or clinically healthy birds by pulsed-field gel electrophoresis (PFGE).
Methods
Bird Isolate Collection
In the United States during 2004–2005, dead redpoll finches from Alaska were submitted to the Alaska Department of Fish and Game. Three clinically healthy redpoll finches were trapped near the outbreak site. Standard necropsies included gross examination and collection of tissues into 10% neutral buffered formalin for histopathologic examination. Fresh tissues were frozen for microbiologic assays. Two other dead birds, a captive adult gyrfalcon (Falco rusticulos) from Idaho and a chicken (Gallus gallus) from Washington, were submitted for diagnosis to the Washington Animal Disease Diagnostic Laboratory in Pullman, Washington, USA.
In Canada in 2005, isolates were obtained from feces of clinically healthy redpolls and pine siskins (Carduelis pinus) trapped on Prince Edward Island. A total of 158 finches were sampled and included redpolls, pine siskins, and purple finches (Carpodacus purpureus).
In Australia in 2001–2002, isolates from birds were obtained from feces of clinically healthy domestic and trapped wild birds (8). Domestic birds included 9 chickens (G. gallus), 4 geese (Anser anser domesticus), 3 ducks (Anas platyrhynchos domesticus), and 1 guinea fowl (family Numididae). Wild birds totaled 634 birds representing 112 species.
In Scotland, isolates obtained during 1998–2000 from dead birds—Eurasian siskins (Carduelis spinus), greenfinches (Carduelis chloris), and chaffinches (Fringilla coelebs)—previously identified as E. coli O86:K61 (4), were obtained from M.J. Woodward (Veterinary Laboratories Agency Weybridge, Inverness, UK). Information about all isolates is summarized in Table 1.
Table 1. Escherichia albertii isolates and hosts information.
| Isolate | Origin (state)* | Host species of origin | Clinical status | Year of isolation | Reference |
|---|---|---|---|---|---|
| 1568-05-27C† | USA (AK) | Redpoll finch (Carduelis flammea) | Dead | 2005 | This study |
| 1568-05-27D† | USA (AK) | Redpoll finch (C. flammea) | Dead | 2005 | This study |
| 1615-05-A† | USA (AK) | Redpoll finch (C. flammea) | Dead | 2005 | This study |
| 1615-05-B† | USA (AK) | Redpoll finch (C. flammea) | Dead | 2005 | This study |
| 1297-05-19†‡§¶ | USA (AK) | Redpoll finch (C. flammea) | Dead | 2005 | This study |
| 7991-07†‡§¶ | USA (WA) | Chicken (Gallus gallus) | Dead | 2007 | This study |
| 12055-07†‡§¶ | USA (ID) | Gyrfalcon (Falco rusticulos) | Dead | 2007 | This study |
| 5419-05-R†‡§¶ | Canada | Redpoll finch (C. flammea) | Healthy | 2005 | This study |
| 5419-05-S†‡ | Canada | Pine siskin (Carduelis pinus) | Healthy | 2005 | This study |
| EC370-98†‡§¶ | Scotland | Finch spp. (Carduelis spp.) | Dead | 1998 | (9) |
| EC558-00† | Scotland | Eurasian siskin (Carduelis spinus) | Dead | 2000 | (9) |
| EC744-99† | Scotland | Greenfinch (Carduelis chloris) | Dead | 1999 | (9) |
| EC746-99‡ | Scotland | Eurasian siskin (C. spinus) | Dead | 1999 | (9) |
| EC748-99† | Scotland | Greenfinch (C. chloris) | Dead | 1999 | (9) |
| B090†‡¶ | Australia | Magpie (Gymnorhina tibicen) | Healthy | 2001 | This study |
| B101†‡§¶ | Australia | Magpie(G. tibicen) | Healthy | 2001 | This study |
| B156†‡§¶ | Australia | Magpie (G. tibicen) | Healthy | 2001 | This study |
| B249†‡¶ | Australia | Magpie (G. tibicen) | Healthy | 2001 | This study |
| B198†‡§¶ | Australia | Honeyeater (Melithreptus brevirostris) | Healthy | 2002 | This study |
| B992†‡§¶ | Australia | Wren (Malurus cyaneus) | Healthy | 2001 | This study |
| B1086†‡§¶ | Australia | Fantail (Rhipidura fulginosa) | Healthy | 2002 | This study |
| B1068†‡§¶ | Australia | Chicken (G. gallus) | Healthy | 2002 | This study |
| B1074†‡§¶ | Australia | Chicken (G. gallus) | Healthy | 2002 | This study |
| 616‡ | No data | Human | Diarrhea | No data | (10) |
| 3103-99‡ | USA (IL) | Human | Diarrhea | No data | (10) |
| C-425‡§ | No data | Human | Diarrhea | No data | (10) |
| 106A5‡§ | Guinea-Bissau | Human | Healthy | 1997 | (11) |
| 9194†‡ | Bangladesh | Human | Diarrhea | 1990 | (10) |
| 19982द | Bangladesh | Human | Diarrhea | 1990 | (10) |
| 79D4†‡ | Guinea-Bissau | Human | Healthy | 1997 | (11) |
| 97F8‡ | Guinea-Bissau | Human | Healthy | 1997 | (11) |
| M2005000616 #8‡ | USA (MN) | Human | Diarrhea | No data | T.S. Whittam, unpub data |
| I2005002880 #36‡ | USA (MN) | Human | Diarrhea | No data | T.S. Whittam, unpub data |
| K-694¶ | Bangladesh | Human | Diarrhea | No data | (10) |
| K-1द | Bangladesh | Human | Diarrhea | No data | (10) |
*AK, Alaska; WA, Washington; ID, Idaho; IL, Illinois; MN, Minnesota. †Included in pulsed-field gel electrophoresis analysis. ‡Included in multilocus sequence typing analysis. §Included in eae allele analysis. ¶Included in cdtB allele analysis.
Isolation and Identification of Bacteria
To detect Enterobacteriaceae, we inoculated tissues, intestinal contents, or feces onto MacConkey agar and incubated the plates at 35°C. Isolated colonies were characterized by fermentation of lactose and glucose, production of oxidase, and production of indole from tryptophan. Additional biochemical characterization was performed by using a commercial kit (API 20E; bioMérieux, Hazelwood, MO, USA). E. coli serotyping was performed by the Gastroenteric Disease Center (Wiley Laboratory, Pennsylvania State University, University Park, PA, USA).
Genetic identification was based on 16S rRNA gene sequencing and/or PCR to detect housekeeping gene polymorphisms unique for the E. albertii/Shigella boydii lineage. 16S rRNA analysis was performed on 1 isolate from Alaska by sequencing >1,400 nt of the 16S rRNA gene (12). The amplicon was cloned into the pCR2.1 sequencing vector (TOPO TA Cloning Kit; Invitrogen, Carlsbad, CA, USA) and sequenced bidirectionally by automated dideoxy DNA methods. Partial 16S rRNA sequences of ≈500 bp of the 5′ end, including the V1, V2, and V3 variable regions (13), were determined for other isolates with the same primers, after which direct dideoxy sequencing was performed. A sequence similarity search was performed by searching the GenBank database with BLASTN.2.2.3 (14), and sequences were aligned with ClustalW2 (www.ebi.ac.uk/Tools/clustalw2/index.html). PCR was used to detect E. albertii lineage–specific genetic polymorphisms in the housekeeping genes lysP and mdh (10). As a positive control, PCR for the gene clpX, which is conserved in E. coli, Shigella, and the E. albertii/S. boydii lineage, was performed as described (10), except a corrected primer sequence for clpX_28 (5′-TGG CGT CGA GTT GGG CA-3′) (T.S. Whittam, unpub. data) was used. The negative control for the lysP and mdh PCR was E. coli strain DH10b.
Virulence Gene PCR and Sequence Analysis
PCR was used to test isolates for virulence genes found in Enterobacteriaceae—the central conserved region of intimin (eae, the attaching-and-effacing ligand), heat-stable enterotoxin (sta), and Shiga toxins (stx1 and stx2)—as described (15). Positive controls were E. coli strains S2 (for sta) and S14 (for stx1, stx2, and eae) from the Pennsylvania State University E. coli Reference Center. A multiplex PCR protocol that amplified the consensus portion of the B subunit of the cytolethal distending toxin gene (cdtB) as described by Toth (16) was modified by using each of the primer pairs (s1/as1 and s2/as2) individually to screen for cdtB in all isolates.
For sequencing eae, PCR primers that amplified ≈800 nt of the variable 3′ end of the eae gene were used as described (9). Because these primers did not work for all bird isolates, additional primer sequences were either taken from other studies or designed for this study (Tables 2 and 3). Sequence analysis was based on ≈726 nt in the 3′ variable region of eae, which corresponded to amino acids 33–275 within the C-terminal 280 aa of intimin (Int280). Nucleotide sequences were determined for each of the cdtB products obtained by using the s1/as1 (403 bp) and s2/as2 (411 bp) primer pairs (16). Predicted amino acid sequences for eae and cdtB were aligned with reference alleles by using the ClustalW method and MegAlign software (DNASTAR, Madison, WI, USA). Neighbor-joining dendrograms were constructed by using MEGA version 4 (18) with the p-distance metric and pairwise gap deletion.
Table 2. Primers used for amplification and sequencing of eae gene of Escherichia albertii.
| Primer | Sequence, 5′ → 3′ | Position (GenBank accession no.) | Reference |
|---|---|---|---|
| Intimin γ F | CGTTGAAGTCGAGTACGCCA | 1867–1887 (AF081185) | (9) |
| Intimin γ R | TTCTACACAAACCGCATAGA | 2782–2803 (AF081185) | (9) |
| EaeA-F | CAAACCAAGGCCAGCATTAC | 1963–1982 (AF081185) | This study |
| EaeA-R outer | CCCCAAGAGAGAGGGTTCTT | 2743–2763 (AF081185) | This study |
| EaeA-R inner | ACTTGATACCCCAGACCTTCA | 2703–2725 (AF081185) | This study |
| EscD-R1 | GTATCAACATCTCCCGCCA | 27918–27937 (AF022236) | (17) |
| Intimin-R2 | CAGAATATTAAACAAGCGCAGTTG | 3103–3126 (FJ609833) | This study |
| EaeA F06s | GTAACGGACTTTACGGCTGATA | 1803–1824 (FJ609833) | (10) |
| Intimin B101 int R | TGACCATATTGCAACCA | 2460–2476 (FJ609833) | This study |
| Intimin B156 int R | TGACCATATCGCAACCA | 2459–2475 (FJ609822) | This study |
Table 3. Primer sets used for amplification and sequencing of eae gene of Escherichia albertii in specific isolates.
| Isolate | PCR amplification | Sequencing |
|---|---|---|
| 1297–05–19 | Intimin γ F, intimin γ R | Intimin γ F, intimin γ R |
| 7991–07 | EaeA-F, EaeA-R outer | EaeA-F, EaeA-R inner |
| 12055–07 | Intimin γ F, intimin γ R | Intimin γ F, intimin γ R |
| 5419–05-R | Intimin γ F, intimin γ R | Intimin γ F, intimin γ R |
| EC370–98 | Intimin γ F, intimin γ R | Intimin γ F, intimin γ R |
| EC746–99 | Intimin γ F, intimin γ R | Intimin γ F, intimin γ R |
| B101 | Intimin γ F, intimin γ R | Intimin γ F, intimin γ R |
| B156 | EaeA-F, Intimin-R2 | EaeA-F, intimin-R2, intimin B156 int R |
| B198 | EaeA-F, intimin-R2 | EaeA-F, intimin-R2, intimin B156 int R |
| B992 | EaeA F06s, EscD-R1 | EaeA F06s, EscD-R1, EaeA-F, intimin B101 int R |
| B1086 | EaeA-F, intimin γ R | EaeA-F, intimin γ R, EaeA-R outer |
| B1068 | EaeA F06s, EscD-R1 | EaeA F06s, EscD-R1, EaeA-F |
| B1074 | EaeA F06s, EscD-R1 | EaeA F06s, EscD-R1, EaeA-F |
MLST
MLST was performed on 26 isolates of E. albertii (Table 1) as described (10), with slight modification. Briefly, partial gene sequences for 6 conserved housekeeping loci (aspC, clpX, fadD, icdA, lysP, and mdh) were obtained by PCR and direct sequenced by automated dideoxy sequencing. Raw sequences were aligned by using Seqman Pro software (DNASTAR). Sequences for 11 E. albertii isolates from humans and 6 common E. coli pathotypes were obtained from www.shigatox.net. E. coli was used as an outgroup; strains used were enterohemorrhagic E. coli strain EDL933, Shigella flexneri strain 2747-71, enteroaggregative E. coli strain 042, enteropathogenic E. coli strain e2348/69, uropathogenic E. coli strain CFT073, and E. coli K-12. A neighbor-joining dendrogram was based on the concatenated nucleotide sequence and the maximum composite likelihood model by using MEGA version 4 (18). Details of the MLST procedure, including allelic typing and sequence type assignment methods, can be found at www.shigatox.net.
An overall phylogenetic representation of the genus Escherichia was generated by combining nucleotide sequence data from GenBank for Escherichia fergusonii with outgroup strains Salmonella bongori, S. enterica subsp. enterica serotype Typhi, and S. enterica subsp. enterica serotype Typhimurium. A neighbor-net network analysis was generated by using SplitsTree 4 software (19) (Figure 1, inset).
Figure 1.
Neighbor-joining dendrogram of bird and human isolates, based on nucleotide variation at 6 conserved housekeeping loci in the Escherichia albertii genome (multilocus sequence typing), supporting identification of all isolates as E. albertii. Three distinct clades are designated EA 1–EA 3. No clustering of isolates is apparent on the basis of their host type, geographic origin, or association with disease. Inset is a SplitsTree phylogenetic network of the genus Escherichia, showing the E. albertii/Shigella boydii serotype 7/13 lineage with respect to the other named species. S. bongori, Salmonella bongori; S. enterica, Salmonella enterica. Scale bars indicate genetic distance.
PFGE
E. albertii isolates were compared by using a standard PFGE method (20) with minor modifications. Briefly, fragments of XbaI-digested bacterial DNA were separated in 1% agarose gel by using a CHEF-DR III PFGE apparatus (Bio-Rad, Hercules, CA, USA); pulse times were ramped from 2.2 to 54.2 seconds over 19 hours. Digital gel images were analyzed with Bionumerics software (Applied Maths, Sint-Martens-Latem, Belgium) by using the unweighted pair group method with arithmetic mean algorithm for cluster analysis of Dice similarity coefficients with a position tolerance of 2%.
Nucleotide Sequence Accession Numbers
Nucleotide sequences from this study were deposited in GenBank. Their accession numbers are EU926632–EU926649 and GQ140242–GQ140261.
Results
Pathologic Findings
Redpoll finches from the Alaska outbreak were typically found dead without obvious signs of disease. All those evaluated had adequate pectoral muscle mass, suggestive of acute death. Some had green fecal material pasted around their cloacae, suggestive of diarrhea. Gross lesions were inconsistent, but a few birds had darkened intestines distended with excessive yellow to green digesta. Histologic lesions were also inconsistent, but when present they were consistent with acute, severe, fibrinous, and necrotizing proventriculitis; multifocal heterophilic enteritis; and small-crypt abscessation. For some, gram-negative bacilli in large numbers were observed within the intestinal lumens. Attachment of bacteria to intestinal epithelial cells was not observed, although autolysis precluded assessment of the epithelium and ultrastructural studies to detect attaching-and-effacing lesions. No lesions consistent with septicemia were observed in any affected redpolls.
The affected gyrfalcon had appeared clinically healthy until found dead. Histologic examination failed to demonstrate enteric lesions, although evidence of septicemia was found. The chicken from Washington died after ≈1 week of illness, during which it appeared depressed and anorexic. Histopathologic examination showed severe, diffuse, necrotizing typhlitis; mild to moderate enterocolitis; and septicemia.
Bacteria Isolated
Bacterial cultures were performed for 8 dead redpolls from Alaska and 3 healthy redpolls trapped in the same area. Large numbers of non–lactose-fermenting gram-negative rods were isolated from the intestines and tissues of 5 of the dead redpolls but from none of the 3 healthy redpolls. Similar organisms were also isolated in large numbers from the tissues of the gyrfalcon and intestines of the chicken. In the healthy birds trapped on Prince Edward Island, non–lactose-fermenting bacteria were isolated from the feces of 11 (12%) of 95 siskins and 4 (12%) of 33 redpolls but from none of 30 samples from purple finches. From the healthy birds trapped in Australia, non–lactose-fermenting bacteria were isolated from 4 (18%) of 22 magpies (Gymnorhina tibicen), 1 (10%) of 10 honeyeaters (Melithreptus brevirostris), 1 (3%) of 38 wrens (Malurus cyaneus), 1 (7%) of 15 fantails (Rhipidura fulginosa), and 2 (22%) of 9 chickens.
The isolates were oxidase negative; fermented glucose but not lactose, sucrose, or xylose; produced indole from tryptophan; and were nonmotile at 35°C. Further biochemical characterization with the API 20E panel indicated that the isolates produced lysine decarboxylase and ornithine decarboxylase and fermented d-glucose, d-mannitol, and l-arabinose. The isolates did not utilize citrate; did not produce arginine decarboxylase, hydrogen sulfide, urease, tryptophan deaminase, acetoin, or gelatinase; and did not ferment inositol, l-rhamnose, d-sucrose, d-melibiose, or amygdalin. All isolates except that from the fantail from Australia (B1086) used β-galactosidase. Fermentation of d-sorbitol varied; it was not fermented by the isolates from finches from Alaska, Canada, and Scotland or the gyrfalcon or by 3 of the 9 isolates from birds in Australia (B1068, B1074, and B1086). API 20E testing identified the isolates that used β-galactosidase and fermented d-sorbitol as code 5144102 and weakly (43%) identified them as E. coli. Identical API 20E profiles were reported for the isolates identified as E. coli from the dead finches from Scotland (4). Although the isolates from Scotland were serotyped as O86:K61, an isolate from Alaska (1297-05-019) did not react with any of the 175 O E. coli antiserum samples, including O86. Variable use of β-galactosidase and fermentation of d-sorbitol resulted in API 20E codes of 5144502 or 4144102 and more robust identifications as E. coli (84% and 90%, respectively).
The nearly full-length 16S rRNA sequence of isolate 1297-05-19 from the redpoll in Alaska was most similar (1,470 [99.7%] of 1,475 nt) to sequences of E. albertii (AY696669) and S. boydii (1,467 [99.5%] of 1,475 nt, AY696670) isolated from humans. The 495-nt sequence of the 5′ end of 16S rRNA was determined for redpoll 5419-05-R from Canada, finch EC37098 from Scotland, and gyrfalcon 12055-07 and chicken 7991-07 from the United States. In all, 9 nucleotide polymorphisms were observed among these 5 isolates, including 5 clustered in the V1 region (98.2% overall identity). These sequences were 99.2%–99.6% identical to the sequence of an eae-positive strain of Hafnia alvei (Z83203), E. albertii from humans (AJ508775, AY696662–AY696664, AY696669), and S. boydii serotypes 7 and 13 (AY696670–AY696680). PCRs were positive for the E. albertii–specific alleles of lysP and mdh (10) in all isolates from birds. Collectively, these data tentatively identified these isolates as E. albertii.
Virulence Genes
All isolates from birds were positive for eae and cdtB but negative for stx1, stx2, and sta, the same repertoire of virulence genes reported for E. albertii isolates from humans (10). Alignment of the 3′ portion of the eae gene showed that the bird isolates possessed a variety of eae alleles, some novel and some similar to previously reported alleles (Figure 2, panel A). There was no clustering of bird eae alleles related to geographic origin, bird versus human origin, or isolation from diseased versus clinically healthy birds or humans. The largest cluster of bird alleles was found in representative isolates (Figure 2, panel A) from the redpolls from Alaska and Canada, the gyrfalcon and chicken from the United States, and the fantail from Australia, which were all nearly identical (1 nonsynonymous nt change each in the isolate from the redpoll and fantail from Alaska). This allele was distinct from other reference eae alleles and thus novel, but it was most similar to γ intimin. Alleles from the isolates from finch E37098 and siskin EC74699 from Scotland and magpie B101 from Australia were identical to each other but were also novel alleles most closely related to the μ allele in E. coli (17). The alleles from isolates from other wild birds and chickens from Australia were similar to previously reported allelic subtypes, including ε, α, and ν (17). Only the isolates from chickens B1068 and B1074 in Australia had an allelic subtype, ν 1.1, previously reported for an E. albertii isolate from a human (10,17).
Figure 2.
Neighbor-joining dendrogram based on the predicted amino acid sequences of the intimin (eae) and cytolethal distending toxin (cdtB) loci of Escherichia spp. Isolates analyzed in this study are designated by their isolate identification number; reference alleles are designated by their GenBank accession numbers. All Escherichia albertii isolates are indicated by circles or squares; all other isolates are E. coli. Scale bars indicate genetic distance. A) eae alleles carried by E. albertii isolates from birds (filled circles) represent diverse allelic subtypes and do not form separate clusters from allelic subtypes carried by isolates from humans (open circles). The eae alleles from North America and 1 from Australia (B1086) are novel but most similar to γ intimins. The eae alleles from Scotland and 1 from Australia (B101) are also novel but most similar to μ intimins. B) The E. albertii cdtB alleles from bird isolates, amplified by the s1/as1 primers, are most similar to cdtB types II, III, and V. E. albertii alleles from human isolates are marked with open circles. The bird E. albertii cdtB alleles amplified by the s2/as2 primers are distantly related to the other bird and human E. albertii alleles and are most similar to cdtB type I in E. coli. Because all the avian alleles amplified by the s2/as2 primers in each group are identical, only 1 sequence for each is shown.
All isolates tested (Figure 2, panel B) were PCR positive for cdtB with the s1/as1 primer pair. With the exception of the chicken from the United States and 5 isolates from birds in Australia (2 chickens [B1068 and B1074], 1 fantail, 1 honeyeater, and 1 wren), all were also positive for cdtB with the s2/as2 primer pair. Because these 2 primer pairs are specific for different types of cytolethal distending toxin (16), at least some isolates from birds appeared to carry multiple cdtB genes. Sequencing and alignment of the s1/as1 PCR products showed these to have ≈91% nt and 92% aa identity. On the basis of amino acid polymorphisms (Figure 2, panel B), avian cdtB alleles amplified by the s1/as1 primers were most similar to type II (birds from North America and Australia) and types III and V (the gyrfalcon, finches from Scotland, other birds from Australia) reference alleles (21–23). Sequencing and alignment of the s2/as2 PCR product showed that the sequences from the isolates from Australia were identical to each other, that the sequences from the isolates from North America and Scotland were identical to each other, and that these 2 groups of sequences were similar to each other with ≈99% identity at both the nucleotide and amino acid levels. These sequences were similar (1- or 2-aa differences) to the type I cdtB reference allele (24). The presence of a type I cdtB is consistent with the previous finding of a type I cdtB in the isolates from the finches from Scotland, identified by type-specific PCRs (16).
MLST Findings
MLST of nucleotide variation at 6 loci (a total of 3,165 bp) in the genomes of isolates (Table 1) showed 3 main clades of E. albertii (EA 1, EA 2, and EA 3 in Figure 1). Isolates did not appear to cluster on the basis of host disease status (healthy, with diarrhea, or dead) or host type. All isolates from birds from North America were closely related and clustered in clade EA 2, along with 3 isolates from birds from Australia (honeyeater, wren, and fantail) and an isolate from a human with diarrhea (I2005002880 #36). The isolate from chicken 7991-07 was slightly divergent from the rest of the isolates from North America (5 synonymous and 1 nonsynonymous nt changes) and was indistinguishable from isolate I2005002880 #36 from the human. Isolates from the dead redpolls from Alaska, healthy finches from Canada, and the gyrfalcon were identical. The isolate from finch EC370-98 from Scotland was distantly related to other bird isolates and clustered with an isolate from a human with diarrhea (M2005000616 #8) in clade EA 1.
MLST strongly supported the biochemical and other molecular data indicating that the bird isolates in this study were E. albertii. Collectively, these isolates represent a distant relative of E. coli, a divergent lineage in the genus Escherichia, and novel diversity within the E. albertii species (Figure 1, inset).
PFGE Findings
PFGE showed that isolates from the 2 bird death epornithics (in Alaska and Scotland) each formed a clonal group (Figure 3), which suggests that these events were associated with expansion of a single clone from either a common source or bird-to-bird transmission. Overall, the PFGE banding patterns and dendrogram indicate that the isolates from birds and humans constitute a heterogeneous group, consistent with the heterogeneity identified in eae and cdtB and by MLST.
Figure 3.
Dendrogram (unweighted pair group method with arithmetic mean) of Escherichia albertii isolates from birds, based on pulsed-field gel electrophoresis band profiles. Isolates from disease outbreaks in Alaska and Scotland form clonal groups, indicating that these outbreaks are associated with expansion of a single clone. The profiles for the other isolates indicate that the bird and human E. albertii isolates are heterogeneous and do not segregate on the basis of host, geographic origin, or disease status. Scale bar indicates percent similarity.
Discussion
E. albertii is a recently described member of the Enterobacteriaceae and has been associated with diarrheal illness in humans (25–27). Until now, however, it has not been associated with disease or infection in animals. E. albertii was originally described as an unusual strain of H. alvei with virulence genes that included eae and the cdtABC operon (26,28). Subsequent characterization of these H. alvei strains demonstrated that they were members of the genus Escherichia (7,10,27) and constituted a new taxon for which the name E. albertii was proposed (7). The E. albertii lineage diverged before the radiation of E. coli and Shigella spp. and includes the atypical S. boydii serotypes 7 and 13 (10). The prevalence, epidemiology, and clinical relevance of E. albertii are poorly defined, in part because E. albertii is likely to either remain unidentified or be misidentified by current commercial biochemical identification methods as E. coli, H. alvei, S. boydii, or Yersinia ruckeri (7,29,30).
Our phenotypic, biochemical, 16S rRNA sequence, and MLST analyses are in strong agreement that the bird isolates in this study, including the previously identified O86:K61 E. coli isolates from Scotland, are correctly classified as E. albertii. In addition, all bird isolates carried genes for 2 characteristic E. albertii virulence factors (intimin and cytolethal distending toxin). Our findings indicate that E. albertii is likely pathogenic to birds and can be associated with epornithics and sporadic disease. The primary pathologic lesion in birds was consistent with enteritis, but the classic attaching-and-effacing lesions typically associated with eae-positive pathogens were not detected. The postmortem condition of the dead finches may have prevented such detection, but experimental work with chicks and the isolates from Scotland suggests that other disease mechanisms need to be considered (9).
We also conclude that E. albertii is able to subclinically colonize various species of wild birds globally. The determinants of pathogenicity of E. albertii in birds remain to be clarified, but its isolation from diseased and healthy birds suggests that its epizoology in songbirds may resemble that of S. enterica subsp. enterica serotype Typhimurium, which is maintained by subclinical carriers and causes outbreaks of disease under conditions of increased stress or high bacterial doses (5,6,31).
The E. albertii isolates from birds in this study differed from those from humans in several notable ways, although the lack of phylogenetic clustering based on host of origin suggests that it would be premature to conclude that these differences are truly host related. First, all bird isolates produced indole from tryptophan, resulting in weak (43% level of confidence) identification as E. coli in contrast to indole-negative isolates from humans, which are identified as H. alvei (45% level of confidence) according to API 20E databases. However, when the positive indole result is combined with the positive reaction for d-sorbitol found for some bird isolates, the identification as E. coli is more robust (84%) and thus more likely to lead to misidentification. Second, we demonstrated the presence of 2 different cdtB genes. Whether the presence of multiple cdtB genes in the human or other bird E. albertii isolates was missed for technical reasons, or whether these other isolates contain a single gene, requires further investigation.
In conclusion, E. albertii appears to be a pathogen of animals and humans and may be carried subclinically by some birds. E. albertii is a member of a more heterogeneous group than was previously appreciated, and additional variation will likely become apparent as additional isolates from other animal hosts and geographic regions are characterized. Whether E. albertii can be transmitted from animals to humans is unknown, although the eae, cdtB, MLST, and PFGE data indicating that the bird isolates cluster among isolates from humans suggest that zoonoses or anthroponoses are possible. Regardless, identification of E. albertii in the clinical laboratory remains a challenge, and it is likely that this pathogen is often unidentified or misidentified in human and veterinary medicine.
Acknowledgments
This work is dedicated to the memory of Tom Whittam, who passed away before the study was completed.
We thank the following for providing case materials: Robert Gerlach, Susan Sharbaugh, Bernard Jilly, Tricia L. Franklin, the Alaska Department of Fish and Game staff in Fairbanks and Delta Junction, and the Alaskan Bird Observatory. Excellent technical assistance was provided by Katherine N.K. Baker, Lusha Evans, Heather Matthews, Charlene Teitzel, Joyce Wisinger, Yubei Zhang, and Julia Christenson.
Financial support was provided by the Washington Animal Disease Diagnostic Laboratory; by the National Institute of Allergy and Infectious Diseases, National Institutes of Health (NIH), Department of Health and Human Services contract no. N01-AI-30055; and by NIH research contract N01-AI30058.
Biography
Dr Oaks is a veterinarian and microbiologist at Washington State University. His primary interests are diagnostic microbiology in domestic and wild animals, identification of new and emerging pathogens through conventional and molecular means, establishment of the role of these new agents in disease, and mechanisms of persistence and host–virus interactions with lentiviruses and herpesviruses.
Footnotes
Suggested citation for this article: Oaks JL, Besser TE, Walk ST, Gordon DM, Beckmen KB, Burek KA, et al. Escherichia albertii in wild and domestic birds. Emerg Infect Dis [serial on the Internet]. 2010 Apr [date cited]. http://dx.doi.org/10.3201/eid1604.090695
References
- 1.Daoust PY, Busby DG, Ferns L, Goltz J, McBurney S, Poppe C, et al. Salmonellosis in songbirds in the Canadian Atlantic provinces during winter–summer 1997–1998. Can Vet J. 2000;41:54–9. [PMC free article] [PubMed] [Google Scholar]
- 2.Dhondt AA, Tessaglia DL, Slothower RL. Epidemic mycoplasmal conjunctivitis in house finches from eastern North America. J Wildl Dis. 1998;34:265–80. [DOI] [PubMed] [Google Scholar]
- 3.Docherty DE, Long RI. Isolation of a poxvirus from a house finch, Carpodacus mexicanus (Muller). J Wildl Dis. 1986;22:420–2. [DOI] [PubMed] [Google Scholar]
- 4.Foster G, Ross HM, Pennycott TW, Hopkins GF, McLaren IM. Isolation of Escherichia coli O86:K61 producing cyto-lethal distending toxin from wild birds of the finch family. Lett Appl Microbiol. 1998;26:395–8. 10.1046/j.1472-765X.1998.00359.x [DOI] [PubMed] [Google Scholar]
- 5.Pennycott TW, Ross HM, McLaren IM, Park A, Hopkins GF, Foster G. Causes of death of wild birds of the family Fringillidae in Britain. Vet Rec. 1998;143:155–6. [DOI] [PubMed] [Google Scholar]
- 6.Refsum T, Vikoren T, Handeland K, Kapperud G, Holstad G. Epidemiologic and pathologic aspects of Salmonella Typhimurium infection in passerine birds in Norway. J Wildl Dis. 2003;39:64–72. [DOI] [PubMed] [Google Scholar]
- 7.Huys G, Cnockaert M, Janda JM, Swings J. Escherichia albertii sp. nov., a diarrhoeagenic species isolated from stool specimens of Bangladeshi children. Int J Syst Evol Microbiol. 2003;53:807–10. 10.1099/ijs.0.02475-0 [DOI] [PubMed] [Google Scholar]
- 8.Gordon DM, Cowling A. The distribution and genetic structure of Escherichia coli in Australian vertebrates: host and geographic effects. Microbiology. 2003;149:3575–86. 10.1099/mic.0.26486-0 [DOI] [PubMed] [Google Scholar]
- 9.La Ragione RM, McLaren IM, Foster G, Cooley WA, Woodward MJ. Phenotypic and genotypic characterization of avian Escherichia coli O86:K61 isolates possessing a gamma-like intimin. Appl Environ Microbiol. 2002;68:4932–42. 10.1128/AEM.68.10.4932-4942.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Hyma KE, Lacher DW, Nelson AM, Bumbaugh AC, Janda JM, Strockbine NA, et al. Evolutionary genetics of a new pathogenic Escherichia species: Escherichia albertii and related Shigella boydii strains. J Bacteriol. 2005;187:619–28. 10.1128/JB.187.2.619-628.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Valentiner-Branth P, Steinsland H, Fischer TK, Perch M, Scheutz F, Dias F, et al. Cohort study of Guinean children: incidence, pathogenecity, conferred protection, and attributable risk for enteropathogens during the first 2 years of life. J Clin Microbiol. 2003;41:4238–45. 10.1128/JCM.41.9.4238-4245.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Pettersson B, Leitner T, Ronaghi M, Bolske G, Uhlen M, Johansson K. Phylogeny of the Mycoplasma mycoides cluster as determined by sequence analysis of the 16S rRNA genes from the two rRNA operons. J Bacteriol. 1996;178:4131–42. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Baker GC, Smith JJ, Cowan DA. Review and re-analysis of domain-specific 16S primers. J Microbiol Methods. 2003;55:541–55. 10.1016/j.mimet.2003.08.009 [DOI] [PubMed] [Google Scholar]
- 14.Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 1997;25:3389–402. 10.1093/nar/25.17.3389 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Franck SM, Bosworth BT, Moon HW. Multiplex PCR for enterotoxigenic, attaching and effacing, and Shiga toxin–producing Escherichia coli strains from calves. J Clin Microbiol. 1998;36:1795–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Toth I, Herault F, Beutin L, Oswald E. Production of cytolethal distending toxins by pathogenic Escherichia coli strains isolated from human and animal sources: establishment of the existence of a new cdt variant (type IV). J Clin Microbiol. 2003;41:4285–91. 10.1128/JCM.41.9.4285-4291.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Lacher DW, Steinsland H, Whittam TS. Allelic subtyping of the intimin locus (eae) of pathogenic Escherichia coli by fluorescent RFLP. FEMS Microbiol Lett. 2006;261:80–7. 10.1111/j.1574-6968.2006.00328.x [DOI] [PubMed] [Google Scholar]
- 18.Tamura K, Dudley J, Nei M, Kumar S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol. 2007;24:1596–9. 10.1093/molbev/msm092 [DOI] [PubMed] [Google Scholar]
- 19.Huson DH, Bryant D. Application of phylogenetic networks in evolutionary studies. Mol Biol Evol. 2006;23:254–67. 10.1093/molbev/msj030 [DOI] [PubMed] [Google Scholar]
- 20.Ribot EM, Fair MA, Gautom R, Cameron DN, Hunter SB, Swaminathan B, et al. Standardization of pulsed-field gel electrophoresis protocols for the subtyping of Escherichia coli O157:H7, Salmonella, and Shigella for PulseNet. Foodborne Pathog Dis. 2006;3:59–67. 10.1089/fpd.2006.3.59 [DOI] [PubMed] [Google Scholar]
- 21.Janka A, Bielaszewska M, Dobrindt U, Greune L, Schmidt MA, Karch H. Cytolethal distending toxin gene cluster in enterohemorrhagic Escherichia coli O157:H- and O157:H7: characterization and evolutionary considerations. Infect Immun. 2003;71:3634–8. 10.1128/IAI.71.6.3634-3638.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Peres SY, Marches O, Daigle F, Nougayrede JP, Herault F, Tasca C, et al. A new cytolethal distending toxin (CDT) from Escherichia coli producing CNF2 blocks HeLa cell division in G2/M phase. Mol Microbiol. 1997;24:1095–107. 10.1046/j.1365-2958.1997.4181785.x [DOI] [PubMed] [Google Scholar]
- 23.Pickett CL, Cottle DL, Pesci EC, Bikah G. Cloning, sequencing, and expression of the Escherichia coli cytolethal distending toxin genes. Infect Immun. 1994;62:1046–51. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Scott DA, Kaper JB. Cloning and sequencing of the genes encoding Escherichia coli cytolethal distending toxin. Infect Immun. 1994;62:244–51. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Albert MJ, Alam K, Islam M, Montanaro J, Rahaman AS, Haider K, et al. Hafnia alvei, a probable cause of diarrhea in humans. Infect Immun. 1991;59:1507–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Albert MJ, Faruque SM, Ansaruzzman M, Islam MM, Haider K, Alam K, et al. Sharing of virulence-associated properties at the phenotypic and genetic levels between enteropathogenic Escherichia coli and Hafnia alvei. J Med Microbiol. 1992;37:310–4. 10.1099/00222615-37-5-310 [DOI] [PubMed] [Google Scholar]
- 27.Janda JM, Abbott SL, Albert MJ. Prototypical diarrheagenic strains of Hafnia alvei are actually members of the genus Escherichia. J Clin Microbiol. 1999;37:2399–401. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Pickett CL, Lee RB, Eyigor A, Elitzur B, Fox EM, Strockbine NA. Patterns of variations in Escherichia coli strains that produce cytolethal distending toxin. Infect Immun. 2004;72:684–90. 10.1128/IAI.72.2.684-690.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Abbott SL, O’Connor J, Robin T, Zimmer BL, Janda JM. Biochemical properties of a newly described Escherichia species, Escherichia albertii. J Clin Microbiol. 2003;41:4852–4. 10.1128/JCM.41.10.4852-4854.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Stock I, Rahman M, Sherwood KJ, Wiedemann B. Natural antimicrobial susceptibility patterns and biochemical identification of Escherichia albertii and Hafnia alvei strains. Diagn Microbiol Infect Dis. 2005;51:151–63. 10.1016/j.diagmicrobio.2004.10.008 [DOI] [PubMed] [Google Scholar]
- 31.Daoust PY, Prescott JF. Salmonellosis. In: Thomas NJ, Hunter DB, Atkinson CT, editors. Infectious diseases of wild birds. Hoboken (NJ): Blackwell Publishing Company; 2007. p. 270–88. [Google Scholar]



