Two Novel EGFP Insertion Alleles Reveal Unique Aspects of Pax2 Function in Embryonic and Adult Kidneys

Abstract

The Pax2 gene encodes a DNA binding protein with multiple functions in the developing intermediate mesoderm and urogenital tract. Loss of Pax2 in mice results in the complete absence of kidneys, ureters, and sex specific epithelial structures derived from the intermediate mesoderm in both males and females. In this report, we describe two new alleles of Pax2 created by inserting the Enhanced Green Fluorescent Protein coding region into the 5′ untranslated leader sequence. One allele is a hypomorph that generates less protein and exhibits structural defects in kidneys and ureters upon homozygosity. A second allele is a true null that can be used to image Pax2 expressing cells in a mutant background. Organ culture and embryo analyses point to a loss of epithelial cell polarity and increased mobility in cells that have deleted Pax2 function. These experiments provide new insight into the role of Pax2 protein levels in determining correct renal architecture and cell fate. These new Pax2 alleles are valuable genetic reagents for in vivo studies of urogenital development.

Introduction

Congenital abnormalities of the kidneys and urogenital tract (CAKUT) are among the most common developmental defects observed in infants, with a frequency of 1 in 500, and often result in end stage renal failure (Song and Yosypiv, 2011). Among the causes of CAKUT are heterozygous mutations in the Pax2 gene, which lead to Papillorenal Syndrome (OMIM #120330), also called Renal-Coloboma Syndrome (Sanyanusin et al., 1995a; Sanyanusin et al., 1995b; Schimmenti et al., 1995), and result in hypoplastic kidneys, vesicoureteral reflux, progressive renal failure and optic nerve coloboma. Many different mutations in Pax2 have been described, including frameshifts, missense mutations, and deletions, supporting the concept of a strict gene dosage requirement for renal and optic nerve development (Amiel et al., 2000; Fletcher et al., 2005; Martinovic-Bouriel et al., 2010; Weber et al., 2006). Even within families carrying the same mutation, not all aspects of the phenotype are observed and the degree of penetrance varies. However, it is not clear how such a partial loss of Pax2 activity begets structural and functional renal defects in development or impacts adult physiology.

In the mouse, homozygous Pax2 deletions result in complete renal agenesis because the nephric duct fails is abnormal and the metanephric mesenchyme cannot respond to inductive signals (Brophy et al. 2001; Torres et al., 1995). Pax2 is first expressed shortly after gastrulation in the region of intermediate mesoderm destined to form the nephric duct, the mesonephric tubules, and the metanephric mesenchyme (Dressler et al., 1990; Dressler and Douglass, 1992). The nephric duct is a single cell thick, columnar epithelial tube extending from about the 12th somite caudally towards the cloaca and expresses both Pax2 and the closely related gene Pax8. While Pax2 null mutants still form a nephric duct, Pax2/8 double homozygous null mice fail to make the nephric duct and have little evidence of intermediate mesoderm (Bouchard et al., 2002). Surrounding the nephric duct are Pax2 positive mesenchymal cells that form mesonephric tubules more anterior and the metanephric mesenchyme along the posterior aspect (Dressler, 2006, 2009). Adult kidney development begins when an outgrowth of the nephric duct, the ureteric bud, invades the metanephric mesenchyme, resulting in reciprocal inductive interactions that promote ureteric bud branching and mesenchyme-to-epithelial conversion (Costantini and Kopan, 2010). Pax2 continues to be expressed in the ureteric bud epithelia and in the nephrons progenitor cells that condense around the ureteric bud tips and become the epithelial cells of the nephrons. Pax2 is also expressed in the male specific derivatives of the mesonephric tubules, the vas deferens and epididymus, and in the female derivatives of the paramesonpehric duct, the oviducts and endometrium of the uterus. All of these sex-specific epithelia are deleted in Pax2 null embryos (Torres et al., 1995).

Despite the need for Pax2 activity in urogenital development, it is unclear how loss of Pax2 affects the ability to maintain epithelial cell types or how decreased Pax2 activity results in gross structural abnormalities. In order to assess the fate of Pax2 positive cells during embryonic development, we inserted the enhanced green fluorescent protein (EGFP) coding region into the 5′ UTR of the mouse Pax2 gene by homologous recombination. Two different alleles were created, one that carries a PGK-neo cassette and another that has PGK-neo deleted. Surprisingly, the presence of PGK-neo results in a hypomorphic allele that is homozygous viable, whereas the deletion of PGK-neo generates a null allele. We utilized both alleles to study Pax2 expression in normal and mutant embryos and to examine the phenotypes of embryos and adults with reduced Pax2 protein levels in the hypomorphs. The results indicate a critical role for Pax2 in maintaining the epithelial integrity of the nephric duct. Furthermore, reduced levels of Pax2 protein generate a spectrum of structural defects including multiple ureters, cystic kidneys, and fewer nephrons. Both of these novel Pax2 alleles are useful for cell imaging, whereas the new Pax2 hypomorphic allele is also good mouse model that mimics multiple aspects of CAKUT.

Materials and Methods

Animals

The Pax2-Eneo targeting vector was created by fusing a 5′ BamHI-NotI (4.1kb) fragment to EGFP (pEGFP-1, Clonetech) and inserting a PGK-neo cassette, flanked by FRT recombinase site, downstream of the EGFP SV40 poly A site. The 3′ Pax2 flank was a 3.6 KB NotI-NcoI fragment cloned downstream of PGK-neo. The vector had 2 HSV-TK genes bordering the 5′ and 3′ ends of the Pax2 flanking sequences. A total of 60 μg of the targeting vector was linearized with SstI and then electroporated into 2.4 × 10⁷ ES R1 cells grown in DMEM supplemented with 15% fetal calf serum, 0.1 mM β-mercaptoethanol, 4 mM glutamine, and 10³ U/ml rLIF (Chemicon). Cells were plated onto NeoR mouse embryonic fibroblast feeders and selected with the same media containing 0.3 mg/ml G418. The G418-resistant clones were identified by Southern blot and the chromosome analysis was performed to ensure the euploidy. Two targeted ES cell clones were microinjected into donor blastocysts from C57BL/6 X (C57BL/6 × DBA/2)F1 and the blastocysts were transferred into pseudopregnant female recipients. Male chimeras were mated with C57BL/6 females, and germline transmission was identified by Southern blot of tail DNA. Mice containing the entire targeting vector Pax2^Eneo/+ were mated with Flippase transgenic mice in order to excise PGK-neo cassette from the targeting vector resulting in mice carrying the Pax2^Egfp allele.

For genotyping, tail DNA was prepared by a standard method, and amplified by PCR using the following primer pairs: Eneo - AGACTGCCTTGGGAAAAG, CCTATTCCGAAGTTCCTATTCTC; Egfp – GGTTACAAATAAAGCAATAGCATC, TTGGAACCGAGACAGGAG; Pax2 – CCCACCGTCCCTTCCTTTTCTCCTCA, GAAAGGCCAGTGTGGCCTCTAGGGTG.

Western blotting

Cells were lysed in PK-lysis buffer (Cai et al., 2002) and protein levels were quantified by the Bio-Rad colorometric assay (Bio-Rad, Hercules, CA). SDS/PAGE sample buffer was added and samples were boiled for 5 min. Samples were run on a 8% polyacrylamide gel, transferred to PVDF membrane (Perkin Elmer, Boston, MA), and blocked with 5% non-fat milk in Tris-buffered saline. Membranes were immunoblotted with anti-Pax2 antibody (Dressler and Douglass, 1992) in 10mM Tris, pH 7.5, 100 mM NaCl, 0.1% Tween 20, 1% non-fat milk. Secondary antibodies conjugated to horseradish peroxidase were used at a 1:10,000 dilution, and the signal was visualized by chemiluminescence (Amersham, Buckinghamshire, England).

In situ hybridization

Whole mount in situ hybridization was preformed as described (Wilkinson, 1992). To allow better penetration of the probes the nephrogenic tubules, duct and mesonephric mesenchyme were dissected from E11.5 embryos for whole mount analysis. The tissues were fixed in 4% PFA overnight at 4°C, dehydrated through a PBTX/Methanol series, and stored at −20°C until required. Digoxigenin (DIG) probes were synthesized from plasmid templates using T7 or T3 polymerase.

The tissues were rehydrated, treated with proteinase K, refixed with 0.2% gluteraldehyde/4%PFA and hybridized overnight at 65°C. The following day the tissues were washed and blocked with 10% lamb serum, 2%BSA in TBTX. The preabsorbed anti-DIG antibody was incubated overnight at 4°C. The samples were then washed for two days and color was developed with NBT (4-nitro blue tetrazolium chloride) and BCIP (X-phosphate/5-Bromo-4-chloro-3indolyl-phosphate) in NTMT (pH9.5).

Immunostaining

Embryos from timed matings were collected, imaged directly for GFP fluorescence, fixed in 4% paraformaldehyde and embedded in paraffin. Sections were cut at 5 microns, dewaxed and rehydrated. Antigens were unmasked with VectaLabs Antigen retrival system by microwaving on high for 10 minutes. Primary antibodies were incubated for 2 hours in PBS, 0.1% Tween-20, 2% goat serum followed by two washes in PBS, 0.1% Tween-20. Goat anti-rabbit FITC or TRITC conjugates (Sigma) were incubated for 1 hour and washed. Micrographs were taken with a Nikon ES800 fluorescent microscope and digital Spot camera. All exposure times were set manually and were equivalent among sections. The antibodies used were: GFP (sc-9996, Santa Cruz), laminin (Sigma), Crbs3 (Makarova et al., 2003), ZO1 (61-7300, Zymed Labs), Dlg1 (VAM-PS005, Stressgen), Occludin1 (71-1500, Invitrogen), N-cadherin (05-915, Upstate Biotech.)

Live Imaging

Embryos were dissected at various stages of development E9-E18. Embryos and adult kidneys were examined and imaged with Leica Stereoscope equipped with fluorescence. Renal organ cultures were carried out as previously described (Brophy et al., 2001). At E10.5, whole intermediate mesoderms were isolated and cleaned from the surrounding tissue. Samples were placed on transwell permeable supports from COSTAR (Costar, 0.4um pore size, Cat# 3450-clear) in a homemade stainless steel adapter with a glass bottom 35 mm culture dishes (MatTek Corporation, part #: P35G-0-20-C) or glass bottom 6 well plates (MatTek Corporation, part # P06G-0-20-F). Organs were cultured in DMEM supplemented with 10% fetal calf serum and penicillin / streptomycin in 5% CO2 at 37°C. Live images for movies were taken using the Deltavision System (Applied Precision). Individual frames were taken every 20 min. over a 24-48 hour period. Images were acquired with SoftWoRx 3.5.1 software, automatically saved in DV format, and then transferred to mpg format to make the movies.

Transmission electron microscopy

Embryos were fixed with 2.5% glutaraldehyde in Sorenson’s buffer for 2 hours at room temperature and were processed for transmission electron microscopy following standard procedures. They were embedded in PolyBed 812 resin (Polysciences Inc.), cut into 1-micron slices and stained with toluidine blue. Sample areas were selected based on the presence of developing kidneys and cut into ultra-thin sections for analysis under a Philips CM-100 transmission electron microscope. The selected TEM images are representative of at least 10 different images per embryo.

Results

Creation of two new Pax2 alleles

The Pax2 alleles used in the study are shown schematically (Fig. 1A). A gene targeting vector was created that included the EGFP coding region followed by a PGK-neo cassette inserted into a unique Not1 site upstream of the Pax2 translational start site. The PGK-neo cassette is transcribed in the same orientation as Pax2 and was flanked by Flp recombinase recognition sites. Prior to removal of PGK-neo, we called the allele Pax2^Eneo. Upon crossing to a Flp recombinase expressing deleter strain, we called the second allele Pax2^Egfp. Heterozygotes carrying each allele were crossed to generate homozygous mice in a test for lethality. All of the Pax2^Egfp/Egfp homozygous newborns exhibited exencephaly, complete renal agenesis, and died at birth similar to the Pax2^−/− mice described previously (Favor et al., 1996; Torres et al., 1995). However, Pax2^Eneo/Eneo mice were viable and fertile and were detected at normal Mendelian frequencies. Thus, the Pax2^Eneo allele still must have some Pax2 activity. Because the downstream exons were not disrupted by the EGFP insertion, the possibility that the Pax2^Eneo allele was making an EGFP-Pax2 fusion protein was examined by western blotting from late embryonic and newborn kidneys when Pax2 expression levels are still high (Fig. 1B). The Pax2 protein was similar in size to the wild-type. However protein expression levels were reduced in the Pax2^Eneo/Eneo homozygotes and were less than in the Pax2^Egfp/+ newborns, whose kidneys did not show structural defects.

Figure 1. Pax2 EGFP Insertional Alleles.

A) A schematic of the alleles used in this study. The first two exons (e1, e2) of Pax2 are indicated by boxes, with the coding regions shaded. Restriction sites are indicated by N, NotI; B, BamHI; H, HindIII; P, PstI; Bg, BglII. B) Total protein lysates from embryonic (E18.5) and newborn kidneys with the genotypes indicated were western blotted and probed for Pax2, EGFP, and Tubulin as indicated. C) Bisected adult kidney from Pax2^Eneo/Eneo homozygote showing large fluid filled cysts. D) Two different Pax2^Eneo/Eneo homozygotes each with one normal and one hypoplastic kidney are shown. E) Bisected adult Pax2^Eneo/Eneo kidney showing duplicated ureter and renal papilla with EGFP expression in the papilla. F) Pax2^Eneo/+ adult kidney bisected to show single papilla with EGFP expression. G & H) Urogenital system from Pax2^Eneo/+ newborn mouse showing strong EGFP in the nephrogenic zone. I & J) Urogential system form a male Pax2^Eneo/Egfp mouse showing very rudimentary EGFP positive kidneys (k). Note the ureter (u) and epidydimus (e) are present and are EGFP positive. K) Comparison of kidney size from Pax2^Egfp/+ (top) and Pax2^Egfp/Eneo (bottom) newborn mice.

Despite their viability, it became apparent that Pax2^Eneo/Eneo adult mice were not normal and had a variety of renal defects, suggesting that the Pax2^Eneo was a hypomorphic allele. From 40 adult mice analyzed, structural renal abnormalities included 20% with medullary cysts (Fig. 1C), 50% with unilateral hypoplasia (Fig. 1D), and 25% with duplicated ureters and lobular kidneys (Fig. 1E). Adult kidneys that did not have congenital abnormalities were generally smaller and had on average 36% fewer nephrons than wild-type, based on glomerular counts of serial sections. However the density of glomeruli per unit area was not significantly different between Pax2^+/+ and the Pax2^Eneo/Eneo adults (4.8+0.7 vs. 4.4+0.5 glomeruli/mm² respectively). In adult kidneys, EGFP expression was only observed in the renal papilla (Fig. 1F), where Pax2 expression had been described in the distal collecting ducts (Cai et al., 2005). In newborns, EGFP expression was strong in the entire nephrogenic zone where Pax2 expression and nephron differentiation is still ongoing (Fig. 1H).

We also crossed the Pax2^Eneo and Pax2^Egfp mice to generate compound heterozygotes, in an attempt to reduce Pax2 gene dosage even further. However, all compound Pax2^Eneo/Egfp newborns died at birth presumably due to renal insufficiency, as the double heterozygotes had very rudimentary kidneys (Fig. 1 I-K). In contrast, all Pax2^Egfp/+ and Pax2^Eneo/+ newborns were normal. These data further support the conclusions that Pax2^Eneo is a hypomorphic allele with reduced levels of Pax2 protein.

Characterization of the Egfp expression patterns

Both new Pax2 alleles were examined for EGFP expression at various stages of development (Fig. 2). Qualitatively, there is no difference in the temporal and spatial pattern of EGFP, although the intensity of EGFP is higher in the Pax2^Egfp allele compared to the Pax2^Eneo. At E9.5, EGFP expression in Pax2^Eneo heterozygotes is found in the optic cup, otic vesicle, and the midbrain-hindbrain junction, perfectly mimicking endogenous Pax2 protein. Nephric duct expression was also observed and revealed some unique features. Prior to reaching the cloaca, the caudal end of the nephric duct showed bifurcations and cellular extensions. These cells at the tip of the growing duct were not polarized epithelia and had characteristics of migrating cells, with cellular processes extending into the surrounding mesenchyme as if the cells were sensing the environment and moving towards a chemoattractant (Fig. 2B, C). Similar observations were made by (Chia et al., 2011), using a Hoxb7-GFP transgene expressed in the developing nephric duct.

Figure 2. EGFP Expression in Normal and Pax2 Mutant Embryos.

A) EGFP expression in Pax2^Eneo/+ embryo perfectly mimics the endogenous pattern of Pax2 protein, including the midbrain-hindbrain junction (mh), the otic vesicle (o), the optic cup (c), and the nephric duct (n). Note branched EGFP positive structures at the posterior of the nephric duct (arrow). B & C) Two different Pax2^Eneo/+ E9.5 embryos with high magnification of the posterior nephric duct are shown. Note the cellular processes extending into the mesenchyme and the branched structure of the tube. D) Dissected intermediate mesoderm from Pax2^Eneo/+ E10.5 embryo showing EGFP positive nephric ducts (n) and the mesenchyme (m) of the nephric cord running parallel to the ducts. Anterior is up. E) Dissected metanephric kidney from E11.5 Pax2^Eneo/+ embryo. F & G) Two different E11.5 metanephric kidneys from Pax2^Eneo/Eneo E11.5 embryos are shown with duplication of the ureter (F, arrows) and a supernumerary ureteric bud (G, arrow). H) E11.5 Pax2^Egfp/+ embryo has normal midbrain-hindbrain and expresses EGFP in all Pax2 positive structures. I & J) A E11.5 Pax2^Egfp/Egfp embryo exhibits exencephaly at the midbrain-hindbrain boundary, similar to germline Pax2^−/− embryos.

By E10.5 the nephric duct has reached the cloaca and the EGFP positive cells of the intermediate mesoderm are segregated into epithelial duct cells and adjacent mesenchyme (Fig. 2D). The EGFP positive mesenchyme were a continuous strip from anterior to posterior, as the posterior metanephric mesenchymal aggregate had not yet separated from the more anterior cells. By E11.5, EGFP is seen in the ureteric bud and condensing mesenchyme of the metanephric kidney. In the Pax2^Eneo/Eneo homozygous mutants, evidence for double ureters or supernumerary ureteric buds is seen in a fraction of kidneys (Fig. 2 F, G), consistent with the 25% frequency of lobular kidneys and multiple ureters observed in adults. At E11.5, EGFP was very prominent in the Pax2 positive neurons that were born at this time along the entire neural tube (Fig. 2 H). At later stages of development, kidney epithelia, ureters, and all the male and female specific epithelia derived from the intermediate mesoderm was EGFP positive in Pax2^Eneo/+ heterozygotes. Homozygous Pax2^Egfp/Egfp embryos also showed midbrain-hindbrain defects and lacked kidneys (Fig. 2 I, J), similar to previously described embryos homozygous for the Pax2 null allele.

The percentage of kidneys with duplicate ureters in the Pax2^Eneo/Eneo homozygous embryos was surprising, since supernumerary ureters had not been describe in Pax2^+/− embryos. In fact, previous studies suggested a reduction in c-RET mRNA levels due to loss of one Pax2 allele (Clarke et al., 2006). Thus, we examined the Pax2^Eneo/Eneo homozygotes for c-RET, Wnt11, and Spry1 expression to determine potential changes in the genes that controlled or responded to ureteric budding (Fig. 3). Levels of c-RET were not appreciably different between WT and Pax2^Eneo/Eneo at E11.5, as judged by the intensity of whole mount in situ hybridization. Both the nephric duct (arrowhead) and the ureteric bud (arrows) stained strongly for c-RET. In cases of double ureters in Pax2^Eneo/Eneo embryos, both stained equally strong for c-RET. Spry1 expression was diminished in the Pax2^Eneo/Eneo mutants, especially in the nephric ducts (arrowhead), but also in the ureter bud tips. Wnt11 expression was equally strong in the ureter bud tips of WT and Pax2^Eneo/Eneo mutant ureter bud tips. These data suggest that a reduction of Spry1 expression could be responsible for the ectopic ureters observed in approximately 25% of the Pax2^Eneo/Eneo mice.

Figure 3. Ureteric Bud Gene Expression in WT and Pax2^Egfp/+ embryos.

Whole mount in situ hybridization was done on regions of intermediate mesoderm dissected from E11-E11.5 embryos. Anti-sense DIG probes for the respective genes are listed above and the genotypes are given below the micrographs. The nephric ducts (arrowheads) and the ureteric bud tips (arrows) are indicated. Note reduced staining for Spry1 in the nephric ducts and bud tips of the Pax2^Egfp/Egfp mutant embryos.

Loss of Epithelial Cell Polarity in Pax^Egfp/Egfp Mutants

Given the strong EGFP fluorescence in Pax2 expressing cells of the intermediate mesoderm, we used this marker to study the phenotype of EGFP positive cells in the absence of Pax2 protein. In Pax2 null mutants, the nephric duct forms, due to the redundant function of Pax8. However by E10.5, Pax8 expression is lost and the fate of the nephric duct was not clear. Thus, we cultured regions of E10.5 intermediate mesoderm on transwell filters and used time-lapse video microscopy to follow the EGFP positive cells (Fig. 4A). At this stage, Pax2^Egfp/+ organ cultures showed a nephric duct, well-developed mesonephric tubules, and a ureteric bud just beginning to invade the metanephric mesenchyme. After two days in culture, the metanephric development was more advanced with multiple branches of the ureteric bud and condensing mesenchyme at the tips. The nephric duct was intact and showed few alterations. In contrast, the Pax^Egfp/Egfp cultures exhibited marked differences. There was no evidence of mesonephric tubules as the anterior EGFP positive mesenchyme slowly dissipated (Fig. 4A). The metanephric mesenchyme was EGFP positive at time 0, but there was no evidence of a ureteric bud. After 2 days in culture, this posterior metanephric mesenchyme also was more diffuse with EGFP expression present but much less intense than the Pax2^Egfp/+ counterpart. Also after 2 days in culture, the Pax^Egfp/Egfp mutant nephric duct appeared very different from Pax2 expressing wild-type nephric ducts. In the Pax^Egfp/Egfp cultures, the duct did not disappear, rather it was remarkably dynamic with cell movements and many EGFP positive nodules growing in all directions out from the duct, whereas the Pax2^Egfp/+ duct remained an intact single layer epithelial tube. This nodular appearance of the nephric duct was not an artifact of organ culture, as intermediate mesoderm dissected directly from E11.5 and E12.5 Pax^Egfp/Egfp embryos and imaged live also showed very similar nephric duct morphology (Fig. 4B, C). Furthermore, the nodules observed in Pax^Egfp/Egfp mutant nephric ducts did not stain positive for c-RET expression, at either E11.5 or E12.5, consistent with previous reports in Pax2 null embryos (Brophy et al., 2001).

Figure 4. Intermediate Mesoderm Cultures from Pax2^Egfp/Egfp and Pax2^Egfp/+ embryos.

A) E10.5 dissected regions of intermediate mesoderm were laid flat onto Transwell filters and cultured for 2 days. EGFP expressing cells photographed over time at day 0, 1, and 2 as indicated. Note the dissolution of the mesonephric mesenchyme (m) and the metanephric mesenchyme (mm) in the Pax2^Egfp/Egfp cultures. Also note the distortion of the nephric duct epithelia (n). Pax2^Egfp/+ cultures show a normally developing kidney (k) and an intact nephric duct (n) over the 2 days in culture. B) E11.5 regions of intermediate mesoderm were dissected out and visualized for EGFP (left) and c-RET expression by whole mount in situ (right). The nephric ducts are indicated (arrows). Note the strong c-RET expression in Pax2^Egfp/+ whereas Pax2^Egfp/Egfp show only background staining. C) Intermediate mesoderm form E12.5 embryos dissected out and visualized for EGFP and c-RET as in B. Again, note the lack of c-RET in the Pax2^Egfp/Egfp nephric ducts that exhibit the EGFP positive outgrowths. Pax2^Egfp/+ embryos have turned c-RET off in the nephric duct but express in the ureteric bud tips of the developing kidney.

Time lapse video microscopy revealed a number of unexpected features in the nephric ducts of Pax^Egfp/Egfp organ cultures (Fig. 5, supplemental data). These ducts did not lose EGFP expression, rather the positive cells were mobile and showed dynamic outgrowths and cellular extensions protruding from the duct in all directions. These cellular processes were followed by outgrowths of groups of cells to form the bumpy, disorganized duct. Frequently, EGFP positive cells were seen leaving the epithelium of the duct completely and wandering off into the surrounding mesenchyme. While these real time images are not true lineage traces, because EGFP expression depends on continued Pax2 promoter activity, they do allow for the visualization of cells that leave the duct for many hours afterwards. In Pax2^Egfp/+ cultures, no cells ever left the epithelium of the nephric duct, which remained stable and intact. Another noteworthy feature observed in the Pax2^Egfp/+ cultures was the conversion of EGFP positive mesonephric mesenchyme cells, from the caudal end of the mesonephros, into epithelial, mesonephric tubules despite never making contact with the nephric duct (Fig. 5 G-I). The most caudal mesonephric tubules are not connected to the duct, but it had not been clear whether their conversion to epithelia required inductive interactions. The real time imaging clearly rules out contact mediated induction, as is the case in the metanephric mesenchyme.

Figure 5. Real Time Imaging from E10.5 Cultured Intermediate Mesoderm.

Dissected regions of intermediate mesoderm from Pax2^Egfp/Egfp and Pax2^Egfp/+ E10.5 embryos were cultured on transwell filters and imaged by time lapse video microscopy for 24 hours. A-C) A series of images show a EGFP positive cell migrating laterally out of the nephric duct from a Pax2^Egfp/Egfp organ culture (red arrow). D-F) Examples of cell movement in Pax2^Egfp/Egfp organ cultures. Red arrows point to cellular processes that extend out of the nephric duct or cells that have left the epithelium. Also note the irregular shape of the duct as cells become more mobile. G) Images from a Pax2^Egfp/+ cultures show little movement of ductal epithelia. H & I) Mesenchymal cells from the mesonephric region (blue arrows) condense and form epithelial tubules despite never making contact with the nephric duct. The complete videos are available as supplementary data with 2 representative movies per genotype.

In order to confirm the dynamic changes in the nephric ducts of Pax2^Egfp/Egfp embryos and to characterize the cellular phenotype, we examined E11.5 ducts by immunostaining of transverse sections using markers for epithelial polarity (Fig. 6). As expected, Pax2 positive nephric ducts from Pax2^Egfp/+ embryos consisted of a single-cell, columnar epithelium with a well-defined, laminin positive basement membrane (Fig. 6 A-C). The tight junction maker Zona Occludins 1 (ZO1) was expressed in the sub-apical region between all adjacent epithelial cells. In contrast, Pax2 negative nephric ducts from Pax2^Egfp/Egfp embryos showed multilayered regions with a discontinuous basement membrane and a coincident lack of ZO1 expression in some parts but not others. Transmission electron microscopy revealed clear lack of cell-cell adhesions in the Pax2 mutant ducts, as large gaps were evident between small areas of cell-cell contact (Fig. 6 D, H). Additional makers, Crumbs3 and Occludin1, of the sub-apical tight junction show similar patterns of protein expression with continuous sub-apical staining in normal duct epithelia but patchy and variable staining in the Pax2^Egfp/Egfp ducts (Fig. 6 I, J, M, N). Basolateral expression of Dlg3 appeared normal in wild-type but was also reduced in mutant ducts (Fig. 6 J, N). N-cadherin, a marker of the mesenchyme was excluded from wild-type nephric ducts but could be seen in a few cells from Pax2^Egfp/Egfp ducts (Fig. 6 K, O). These data demonstrate that the nephric duct epithelium has either failed to fully establish proper polarity or cannot maintain polarity in the absence of Pax2.

Figure 6. Loss of Epithelial Cell Polarity In Pax2 Mutants.

Serial transverse sections through the nephric duct and adjacent mesenchyme were taken from Pax2^Egfp/+ (A-D, I-L) and Pax2^Egfp/Egfp (E-H, M-P) E11.5 embryos and immunostained with antibodies and DAPI or used for transmission electron microscopy. A) Laminin (green) and ZO1 (red) mark the columnar epithelium of the nephric duct (nd). B) Pax2 (green) and ZO1 (red) mark the nephric duct, whereas the mesenchyme (m) expresses only Pax2. C) EGFP (red) is seen in the nephric duct and mesenchyme, whereas laminin (green) only stains the basement membrane of the mature epithelia. D) Transmission EM shows cells of the nephric duct with lateral junctions. E & F) Laminin (green) and ZO1 (red) show a disorganized nephric duct with regions of lost polarity and multiple cell layers (arrowhead). G) EGFP (red) and Laminin (green) staining of a nephric duct shows a discontinuous basement membrane (arrows), regions of multiple cell thickness (arrowhead), and a convoluted structure. H) Transmission EM of the nephric duct shows gaps between cells (arrow) and no evidence of tight cell junctions. I) Crumbs3 (red) is localized to all sub-apical tight junctions in normal nephric duct. J) Occludin1 (red) is found at tight junctions and Disc Large homologue 1 (green) is expressed baso-laterally in normal nephric duct epithelia. K) N-cadherin (green) is in the mesenchyme but not the nephric duct epithelia. L) The Laminin (red) basement membrane encircles the N-cadherin (green) negative epithelia. M) Crumbs3 (red) is discontinuous within the abnormal epithelia of the EGFP (green) mutant nephric duct. N) Similar to Crumbs3, Occludin1 is also discontinuous in the duct epithelia, whereas Disc Large homologue 1(green) localizes normally but with reduced intensity. O) Some N-cadherin (green) positive cells are seen within the epithelia (arrow) of Pax2 null nephric ducts. P) Same section as O but stained with laminin (red) to outline the mutant epithelia.

Discussion

The Pax2 gene is critical for kidney development in all vertebrate species examined to date (Favor et al., 1996; Majumdar et al., 2000; Torres et al., 1995). In humans, Pax2 heterozygosity is associated with renal hypoplasia, vesicoureteral reflux, and optic nerve coloboma (Eccles and Schimmenti, 1999; Schimmenti, 2011). However, the penetrance of the phenotypes varies greatly, even within families that carry the same Pax2 mutation. Variations in genetic background may account for some of these differences, however in inbred strains of mice, heterozygotes also show different degrees of hypoplasia , suggesting that there are stochastic effects due to reduced gene dosage (Cross et al., 2011; Favor et al., 1996; Keller et al., 1994).

By inserting an EGFP-PGK-neo cassette into the 5′ UTR of Pax2, we have created a hypomorphic allele that expresses less Pax2 protein and exhibits a stronger phenotype, including smaller kidneys and more congenital defects, when bred to homozygosity than a Pax2^+/− heterozygous genotype. Integrating reporter genes or Cre recombinase into endogenous loci has proved a popular strategy for marking cell types and for lineage tracing in vivo. Our EGFP alleles do not permanently mark the lineage but EGFP is strong enough and stable enough to allow for cell visualization for several hours after migration out of the nephric duct. However, the strategies for inserting into non-coding regions and the use of selectable markers can have unexpected consequences as in the Pax^Eneo allele, which appears to drive the endogenous, downstream Pax2 mRNA from the PGK promoter. Since deletion of PGK-neo creates a true null allele, it appears that the PGK-neo cassette is able to promote transcription of Pax2 despite the presence of a poly-A addition signal at the 3′ end of the neo gene. The Pax2 mRNA generated by the Pax2^Eneo allele may be able to splice out the neo coding region and the associated polyadenylation signal, although alternative mechanisms could exist to create a translatable mRNA.

The hypomorphic phenotype observed in Pax^Eneo/Eneo mutants exhibits some unique features. In addition to the hypoplasia, duplicate ureters are seen in 25% of the kidneys. Ureteric budding is complex process that requires RET/GDNF signaling, with RET expressing nephric duct cells moving caudally and coalescing at the bud region in response to activation by mesenchyme derived GDNF (Chi et al., 2009). Ureteric budding is also suppressed by Spry1 (Basson et al., 2005) and Bmp4 (Michos et al., 2007). Spry1 appears to negatively regulate RET in the ureteric bud epithelium to limit budding and branching to sites of maximum RET activation. Strikingly, in the absence of Spry1, there is no need for RET activation, as the alternative tyrosine kinases of the FGF receptor family can substitute (Michos et al., 2010). Based on whole mount in situ hybridization, we do not see a reduction of RET or Wnt11 expression in the Pax^Eneo/Eneo mutant ureteric buds. This is contrary to RT-PCR data reported previously in Pax2^+/− heterozygote embryos at various stages (Clarke et al., 2006) and may reflect differences in cell number, timing, or Pax2 expression levels among the different genotypes. It is worth noting that Pax2^+/− mutant embryos rarely, if ever, exhibit supernumerary ureteric buds, duplicated ureters, or lobular kidneys. These supernumerary ureteric buds seen in the Pax^neo/neo embryos could be due to a reduction in Spry1 expression. Thus, as Pax2 protein levels are reduced even further in the Pax^Eneo/Eneo embryos, the need for RET activation may be less critical as Spry1 is lower.

How Pax proteins function to specify tissue morphogenesis still remains obscure, despite decades of genetic analyses. Given their DNA binding capacity, Pax proteins are thought to function as transcription factors for regulating tissue and cell-type specific genes during development. More recent studies indicate that Pax2 can provide the DNA binding specificity for an MLL3/4 Trithorax-like protein complex that promotes histone H3, lysine 4 methylation (H3K4me) to mark regions of active chromatin (Patel et al., 2007). Through its interaction with PTIP, Pax2 recruits the MLL proteins such that positive epigenetic marks are established at genes slated for transcription activation. Similar results have been reported for Pax5 in B cell lineage commitment (McManus et al., 2011). The Pax/PTIP complex can also promote long-distance enhancer and promoter interactions through chromatin looping (Schwab et al., 2011), again suggesting effects on chromatin structure to activate gene expression. However, Pax proteins also interact with other proteins, such as the co-repressor Grg4/Tle4, to recruit Polycomb complexes that establish repressive epigenetic marks on chromatin (Patel et al., 2012). Thus, this dual potential for activation and repression may be temporally regulated by the availability of co-factors. Whether the loss of epithelial cell polarity is due to the failure to activate epithelial specific genes or the failure to repress more mesenchymal specific genes is a question that can now be addressed more directly in the EGFP positive cells.

The loss of Pax2 and Pax8 function in the intermediate mesoderm results in the complete absence of the nephric duct, the mesonephros, and the metanephros, and the loss of Lhx1 and GDNF expression (Bouchard et al., 2002). The nephric duct initially forms in Pax2 null embryos because of the redundant function of Pax8 early in the intermediate mesoderm. However, the periductal mesenchyme fails to make mesonephric tubules nor is there evidence of metanephric induction. Our data now suggest that in Pax2 null mutants, the nephric duct forms an initial epithelial tube, as evidenced by basement membrane and tight junction staining, but that these epithelial cells loose their integrity and become mobile. Enhanced mobility may be due to the loss of tight and adherent junctions, which also help establish and maintain apical-basal polarity (Wang and Margolis, 2007). Mobility could be driven by the reduction of Spry1 expression, which leads to ureteric bud like outgrowths, although the nodules that appear in the Pax^Egfp/Egfp embryos are not as distinct as the supernumerary ureteric buds seen in Spry1 mutants (Basson et al., 2005; Basson et al., 2006). The lack of c-RET expression in the mutant nephric ducts, which has been observed previously in Pax2 null embryos (Brophy et al., 2001), is also different than in Spry1 mutants. The mutant nephric ducts in Pax^Egfp/Egfp embryos are similar to those observed at the posterior end of Gata3 mutants, which exhibit multi-cellularity and outgrowths, and are consistent with idea that Gata 3 is a target of Pax2/8 (Grote et al., 2006). The expression of N-cadherin and the loss of tight junction proteins also suggest a cell fate transformation occurs in the Pax2 mutant nephric ducts, prior to any cell death that may be observed at later stages.

If Pax2/8 are required for specifying the renal epithelial lineage in the intermediate mesoderm, then our studies suggest that this specification is reversible. Thus, if Pax8 is sufficient to establish the epithelial phenotype in the nephric duct in the absence of Pax2 (Bouchard et al., 2000), continued expression of Pax2 is needed to maintain that epithelial phenotype once Pax8 is repressed. If Pax proteins drive epigenetic modifications, then those modifications must be maintained. Our studies in more differentiated cells suggest that H3K4me is needed to maintain cellular physiology and a stable pattern of gene expression (Lefevre et al., 2010; Stein et al., 2011). Without either Pax2 or Pax8, epithelial cells begin a transformation towards a more mesenchymal phenotype, including loss of tight junctions and cell adhesion and increased motility and migration out of the epithelial duct. This need for Pax2/8 appears to be transient, as differentiated, non-dividing epithelial cells of the nephron turn off both genes. Our data suggest that the Pax2 function that maintains the epithelial phenotype may be required only in dividing cells. Interestingly, Pax2 is reactivated in the regenerating epithelial cells after injury (Imgrund et al., 1999) that are derived from surviving differentiated epithelial cells (Humphreys et al., 2008). Regenerating epithelial cells require other developmental regulators like HNF1β to reset epigenetic marks (Verdeguer et al., 2009), consistent with the idea that regeneration restarts the embryonic developmental program. These new Pax2-EGFP alleles described in this report will prove valuable for studying such genetic and cell biological events in both developing and regenerating kidneys.

Highlights.

Two new Pax2 mutant alleles were created by EGFP insertion.

A hypomorphic allele shows reduced Pax2 expression and structural kidney defects.

Pax2 functions to maintain epithelial cell polarity in the intermediate mesoderm.

The Pax2-EGFP alleles are valuable for developmental studies in the kidney and nervous system.