Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2013 Apr 1.
Published in final edited form as: Mol Microbiol. 2012 Mar 20;84(2):370–382. doi: 10.1111/j.1365-2958.2012.08028.x

Multiple ABC transporters are involved in the acquisition of petrobactin in Bacillus anthracis

Shandee D Dixon 1, Brian K Janes 1, Alexandra Bourgis 1, Paul E Carlson Jr 1, Philip C Hanna 1,*
PMCID: PMC3323712  NIHMSID: NIHMS360934  PMID: 22429808

Summary

In Bacillus anthracis the siderophore petrobactin is vital for iron acquisition and virulence. The petrobactin-binding receptor FpuA is required for these processes. Here additional components of petrobactin reacquisition are described. To identify these proteins, mutants of candidate permease and ATPase genes were generated allowing for characterization of multiple petrobactin ATP-binding cassette (ABC)-import systems. Either of two distinct permeases, FpuB or FatCD, are required for iron acquisition and play redundant roles in petrobactin transport. A mutant strain lacking both permeases, ΔfpuBΔfatCD, was incapable of using petrobactin as an iron source and exhibited attenuated virulence in a murine model of inhalational anthrax infection. ATPase mutants were generated in either of the permease mutant backgrounds to identify the ATPase(s) interacting with each individual permease channel. Mutants lacking the FpuB permease and FatE ATPase (ΔfpuBΔfatE) and a mutant lacking the distinct ATPases FpuC and FpuD generated in the ΔfatCD background (ΔfatCDΔfpuCΔfpuD) displayed phenotypic characteristics of a mutant deficient in petrobactin import. A mutant lacking all three of the identified ATPases (ΔfatEΔfpuCΔfpuD) exhibited the same growth defect in iron-depleted conditions. Taken together, these results provide the first description of the permease and ATPase proteins required for the import of petrobactin in B. anthracis.

Keywords: anthrax, iron acquisition, petrobactin, ABC transport, siderophore

Introduction

Bacillus anthracis, a gram-positive, spore forming bacterium, is the causative agent of the disease anthrax, which affects a wide range of mammals, including humans (Dixon et al., 1999, Hanna, 1998a, Hanna, 1998b). Over the course of its life cycle, B. anthracis exists in two distinct morphotypes, the metabolically active vegetative cell and the dormant spore. Vegetative bacilli within the host acquire enough nutrients to replicate rapidly and to very high titers (Dixon et al., 1999). Upon death of the host, the bacillus enters an environment lacking the nutrients required to sustain growth and replication, and sporulates (Dutz & Kohout, 1971, Dutz & Kohout-Dutz, 1981, Guidi-Rontani et al., 1999). The spores are the infectious particles of anthrax and are highly resistant to heat, cold, radiation, desiccation, and disinfectants and persist in the environment in a dormant state until taken up by another host (Doganay & Welsby, 2006, Almeida et al., 2008, Nicholson et al., 2000).

B. anthracis is capable of causing three forms of human disease, dependent on the route of spore entry into the host. While cutaneous and gastrointestinal anthrax are medical concerns, the most severe form of the disease is inhalational anthrax (Inglesby et al., 1999, Inglesby et al., 2002, Dixon et al., 1999, Doganay & Welsby, 2006). Mortality rates from this form of anthrax infection approach 45–50% (Sweeney et al., 2011, Spencer, 2003). Following inhalation, spores are taken up by alveolar phagocytes and transported to the lymph nodes, where the spores germinate and outgrowth to vegetative cells occurs (Dixon et al., 2000, Dutz & Kohout, 1971, Dutz & Kohout-Dutz, 1981, Guidi-Rontani et al., 1999). Eventually the replicating bacilli lyse the phagocytes and escape into the bloodstream, where they can reach titers of up to 108 bacilli per milliliter of blood (Dixon et al., 1999). As the bacteria multiply, they express virulence factors, most notably toxin, which ultimately leads to septic shock and death of the host within a few days (Dixon et al., 1999). Following host death, bacteria will sporulate once again and remain dormant until a suitable environment is encountered.

The robust growth rate of B. anthracis necessitates the need for highly efficient mechanisms for nutrient acquisition within the host (Faraldo-Gomez & Sansom, 2003, Ratledge & Dover, 2000, Wandersman & Delepelaire, 2004). One vital nutrient required for all bacteria is iron (Ratledge & Dover, 2000). Ferric iron (Fe3+) is found in highly insoluble forms and is toxic to host cells through the formation of damaging oxygen radicals (Ratledge & Dover, 2000, Ratledge, 2004, Miethke & Marahiel, 2007, Davidson et al., 2008). Consequently, free iron concentrations in the host are low. The majority of iron in the mammalian host is bound to proteins such as hemoglobin, transferrin, and ferritin (Ratledge & Dover, 2000, Glanfield et al., 2007). Since low concentrations of free iron can constitute a barrier against bacterial growth, the ability to acquire iron from the host is often a major determinant of microbial survival and virulence (Braun & Braun, 2002). To this end, pathogenic microbes, including B. anthracis, have evolved a variety of mechanisms to sequester iron from host proteins, including the production of siderophores (Faraldo-Gomez & Sansom, 2003, Ratledge & Dover, 2000, Glanfield et al., 2007).

Siderophores are high-affinity iron chelating molecules secreted in low iron environments to scavenge ferric iron from host proteins (Neilands, 1995, Zawadzka et al., 2009a). The production and secretion of siderophores is the primary mechanism of iron acquisition by B. anthracis (Ratledge & Dover, 2000). B. anthracis produces two distinct siderophore molecules, bacillibactin and petrobactin (Wilson et al., 2006, Hotta et al., Cendrowski et al., 2004b, Koppisch et al., 2005, Lee et al., 2007, Pfleger et al., 2007, Pfleger et al., 2008b, Zawadzka et al., 2009b, Zawadzka et al., 2009a) Petrobactin is the only siderophore essential for growth in macrophages and murine virulence (Koppisch et al., 2005, Cendrowski et al., 2004b, Garner et al., 2004, Abergel et al., 2006a, Abergel et al., 2008). The siderophore bacillibactin, conversely, is thought to be dispensable during B. anthracis pathogenesis, as strains deficient in bacillibactin synthesis are fully virulent in a murine inhalational anthrax infection model (Cendrowski et al., 2004b). While both petrobactin and bacillibactin are catecholate siderophores, a possible explanation for their relative importance in pathogenesis may be found in their distinct chemical structures. Bacillibactin, commonly found in several Bacillus species (Koppisch et al., 2005) has a catecholate orientation (2,3-dihydroxybenzoate) widely observed in siderophores (Miethke & Marahiel, 2007), while petrobactin has a unique catecholate orientation (3,4-dihydroxybenzoate). This uncommon orientation allows this siderophore to evade recognition by the human immune protein siderocalin, thus petrobactin has been termed the “stealth siderophore” of B. anthracis (Abergel et al., 2006a, Pfleger et al., 2008b, Zawadzka et al., 2009b).

The stages of petrobactin biosynthesis have been well studied in B. anthracis (Abergel et al., 2008, Abergel et al., 2006b, Barbeau et al., 2002, Cendrowski et al., 2004a, Challis, 2005, Fox et al., 2008, Kadi & Challis, 2009, Koppisch et al., 2008a, Koppisch et al., 2005, Koppisch et al., 2008b, Lee et al., 2007, Lee et al., 2011, Liu et al., 2007, Oves-Costales et al., 2009, Oves-Costales et al., 2007, Oves-Costales et al., 2008, Pfleger et al., 2008a, Pfleger et al., 2007, Wilson et al., 2009, Wilson et al., 2006). However, only some of the details about iron-petrobactin import are known We have previously shown that FpuA is the receptor protein required for normal growth under iron-depleted conditions and for murine virulence (Carlson et al., 2010). Furthermore, FpuA shows high sequence homology with the receptor components of ATP-binding cassette (ABC)-transport systems from other bacteria; therefore transport of iron-petrobactin most likely occurs through an ABC-transport system. Here we present the identification and characterization of the permease and ATPase components of the petrobactin ABC-import system.

Results

Identification of two individual permeases involved in petrobactin reacquisition

Seven iron-hydroxamate transporter permeases were identified as putative components of the B. anthracis petrobactin import system. Each of these proteins has significant sequence homology to the well characterized ATP-dependent iron (III) hydroxamate permease (FhuB) from Escherichia coli (Koster, 2001, Koster, 2005), and all are induced by iron starvation (Carlson et al., 2009). Genetic organization of these putative permeases fall into two classes: those that are encoded by a single gene (GBAA4767, GBAA4596, GBAA4785, and GBAA5630), and those that are encoded by two consecutive genes (GBAA5328-5329, GBAA3865-3866, and GBAA0616-0617) (Fig. 1). Of these predicted permeases, the most obvious candidate for a role in petrobactin import was GBAA4767 (fpuB), as it is located directly downstream and likely co-transcribed with fpuA, which encodes the petrobactin receptor protein (Carlson et al., 2010). Another attractive candidate was the heterodimeric permease FatCD (GBAA5328-5329). An orthologue of this permease, YclNO, was previously shown to be required for petrobactin reacquisition in B. subtilis (Zawadzka et al., 2009b).

Figure 1. Organization of genes investigated in this work.

Figure 1

Open in a new tab

The genes encoding the iron associated ABC transporter components investigated in this work reside in seven separate clusters. Those found to be involved in the reacquisition of petrobactin belong to four of these clusters; individual genes directly involved in this process are marked with asterisks. Gene names for fpuB (GBAA4767; previously annotated as fhuB), fpuC (GBAA4595), fpuD (GBAA0618), and fatE (GBAA5327) have been updated to reflect their involvement in petrobactin transport. The three other gene clusters investigated here showed no involvement in this process. All clusters are aligned in the order receptor/permease/ATPase, with the exception of GBAA5629, which is labeled separately as this ATPase gene is positioned between the receptor and permease genes in its cluster. Dotted lines between consecutive genes were used for alignment purposes and do not indicate actual space between the genes. The annotated or predicted functions of all genes flanking each cluster are also shown. Intergenic region between the clusters and the flanking genes are not to scale.

To test if any of these putative permease proteins were required for the import of petrobactin, individual mutants lacking each of the seven permeases were constructed and analyzed. Each mutant was examined for the ability to grow in iron-depleted media (IDM). Mutants unable to synthesize or import petrobactin display a severe growth defect under these conditions (Carlson et al., 2010, Cendrowski et al., 2004b). Surprisingly, none of the single permease mutants, including ΔfpuB and ΔfatCD, exhibited a growth defect in IDM (Fig. 2A, solid squares and solid triangles, Fig. S1 and Table S1). It was therefore hypothesized that more than one of the putative permeases could facilitate the import of petrobactin. To test this, a mutant lacking the two most likely candidate permeases, FpuB and FatCD, was generated. The ΔfpuBΔfatCD mutant exhibited a severe growth defect in IDM (Fig. 2A, open diamonds), similar to that of mutants deficient in both petrobactin transport (ΔfpuA) and petrobactin biosynthesis (ΔasbABCDEF) (Fig. 2A, open squares and open triangles, respectively). These results suggest that these proteins play redundant roles in petrobactin transport. It is important to note that this growth defect was iron dependent, as all mutants tested exhibited wild-type growth levels in rich media (Fig. 2B, and data not shown).

Figure 2. Growth phenotypes of B. anthracis mutant strains.

Figure 2

Open in a new tab

All cultures were inoculated with actively growing vegetative bacilli at an initial OD600 of 0.05. Growth was monitored hourly by measuring OD600. Wild-type and ΔasbABCDEF strains were used in all experiments as controls. (A, B) Growth of permease deletion mutants. Wild-type (solid diamonds), ΔfpuB (solid squares), ΔfatCD (solid triangles), ΔfpuBΔfatCD (open diamonds), ΔfpuA (open squares), and ΔasbABCDEF (open triangles) strains were grown in either IDM media (A) or BHI media (B). (C, D) Growth of ATPase deletion mutants. Wild-type (solid diamonds), ΔfpuBΔfatE (solid squares), ΔfatCDΔfpuCΔfpuD (solid triangles), ΔfatEΔfpuCΔfpuD (open diamonds), and ΔasbABCDEF (open triangles) strains were grown in either IDM media (C) or BHI media (D). Data are presented as mean ± standard deviation of triplicate measures from one experiment and represent at least three independent experiments.

To further demonstrate the role of these permeases in petrobactin import, it was necessary to eliminate the possibility that these mutants were unable to produce or secrete the siderophore. There are several phenotypes that can distinguish an import deficient mutant (e.g. ΔfpuA), from a biosynthetic mutant (e.g. ΔasbABCDEF), including the inability to be chemically rescued with supplemental petrobactin, accumulation of extracellular catechol, and resistance to gallium toxicity (Carlson et al., 2010). The first phenotype tested was the ability to be chemically rescued to wild-type growth levels in IDM by the addition of exogenous petrobactin. This supplementation allows for recovery of growth of petrobactin biosynthetic mutants, while transport deficient mutants are not complemented in this manner. Spores of wild-type, ΔasbABCDEF, ΔfpuA, or ΔfpuBΔfatCD strains were grown in IDM with or without supplemental petrobactin (2.5 μM). As expected, the growth of the petrobactin biosynthetic mutant was fully restored by this supplementation (Fig 3. A and B, solid triangles). However, this treatment did not restore growth of the double permease mutant (ΔfpuBΔfatCD), indicating an inability to import petrobactin (Fig 3. A and B, open squares). This result was identical to that of the known petrobactin transport mutant (ΔfpuA) (Fig 3. A and B, solid circles) (Carlson et al., 2010, Arnow, 1937).

Figure 3. Petrobactin supplementation does not restore growth of transport deficient mutants in IDM.

Figure 3

Open in a new tab

Cultures of either IDM (A) or in IDM supplemented with 2.5 μM purified petrobactin (B) were inoculated with 1×105 spores of wild-type (solid squares), ΔasbABCDEF (solid triangles), ΔfpuA (solid circles), ΔfpuBΔfatCD (open squares), ΔfpuBΔfatE (open triangles), or ΔfatCDΔfpuCΔfpuD (open circles). Growth was monitored by measuring OD600 over nine hours. Data are presented as mean ± standard deviation of triplicate measures from one experiment and represent at least three independent experiments.

A second phenotype of mutants unable to import petrobactin is significant accumulation of catechol in the culture supernatant, compared to that seen in wild-type strains (Carlson et al., 2010). The individual permease mutants, ΔfpuB and ΔfatCD, and the double mutant, ΔfpuBΔfatCD, were assayed for extracellular catechol using the Arnow assay (Arnow, 1937). The petrobactin biosynthetic mutant was included as a control for non-petrobactin catechols. As reported previously (Carlson et al., 2010), culture supernantants from this strain exhibited minimal levels of catechol, indicating that the majority of what was observed is petrobactin (Fig. 4, ΔasbABCDEF). Catechol levels detected in the supernatants of all single permease mutants were nearly identical to those found in wild-type supernatants (Fig. 4). However, extracellular catechol levels in the culture supernatant of ΔfpuBΔfatCD were significantly higher than those detected in wild-type (Fig. 4). These results are similar to those obtained for ΔfpuA, which is unable to import petrobactin (Fig. 4 and (Carlson et al., 2010)).

Figure 4. Accumulation of extracellular catechols in petrobactin transport deficient strains.

Figure 4

Open in a new tab

Catechols were measured in filtered culture supernatants following six-hour growth of either control strains (black bars), permease mutants (white bars), or ATPase mutants (grey bars) using the Arnow assay. Data were normalized to the OD600 of cultures and are presented as percent of wild-type catechol levels. Data are presented as mean ± standard deviation of triplicate measures from one experiment and represent three or more independent experiments. * = p ≤ 0.005. The level of catechol observed from ΔfpuBΔfatCD is not statistically significant (p = 0.52) from ΔfpuA.

The final phenotype tested was resistance to gallium toxicity. Gallium resistance has been used to show siderophore transport in several bacterial systems (Olakanmi et al., 2000, Banin et al., 2008, Ecker & Emery, 1983, Carlson et al., 2010). Gallium is able to bind to siderophores with high efficiency (Zawadzka et al., 2009b, Banin et al., 2008) and is toxic when imported into the bacterial cytoplasm (Banin et al., 2008). Previous studies have shown that the addition of 20 μM gallium sulfate to IDM culture media results in a petrobactin-dependent growth defect in wild-type B. anthracis (Carlson et al., 2010). To further test the ability of ΔfpuBΔfatCD to import petrobactin, growth of this strain was examined in the presence of gallium. Wild-type, ΔasbABCDEF, ΔfpuA, ΔfpuB, ΔfatCD, and ΔfpuBΔfatCD strains were incubated in the presence or absence of gallium sulfate and growth was measured by change in OD600 after two hours. The addition of gallium sulfate to wild-type B. anthracis resulted in a significant growth inhibition when compared to cultures grown without gallium (Fig. 5). In contrast, strains unable to produce or import petrobactin are protected from this toxicity (Fig. 5, ΔfpuA and ΔasbABCDEF) (Carlson et al., 2010, Cendrowski et al., 2004b). As predicted by their ability to grow in IDM, both single permease mutants (ΔfpuB and ΔfatCD) were significantly inhibited by the presence of gallium (Fig. 5). Much like the petrobactin biosynthetic mutant, the double permease mutant, ΔfpuBΔfatCD, was not significantly inhibited by the presence of gallium (Fig. 5).

Figure 5. Resistance of petrobactin transport deficient strains to gallium toxicity.

Figure 5

Open in a new tab

Control strains (black bars), permease mutants (white bars), or ATPase mutants (grey bars) were grown in IDM with or without 20 μM gallium sulfate and examined for change in OD600 after two hours. Results are presented as percent growth inhibition in the presence of 20 μM gallium sulfate. Data are presented as mean ± standard deviation of triplicate measures from one experiment and represent at least three independent experiments. * = p ≤ 0.0001. Percent growth inhibition was calculated as {[(OD600 IDM + gallium)/(OD600 IDM)]*100}.

The ΔfpuBΔfatCD mutant is attenuated for virulence in a murine model of inhalational anthrax

Known petrobactin biosynthetic (ΔasbABCDEF) and receptor (ΔfpuA) mutants exhibit significant attenuation in murine virulence (Cendrowski et al., 2004b, Carlson et al., 2010). Therefore, it was hypothesized that a strain lacking all permease components of the petrobactin import system would exhibit a similar attenuation. To test this hypothesis, a murine model of inhalational anthrax was used (Cendrowski et al., 2004b). Mice were inoculated intratracheally with either wild-type (n=8) or ΔfpuBΔfatCD (n=16) spores at a dose of approximately 20 times the LD50 (1 × 105 spores/mouse). Mice were thenmonitored for 14 days post-infection. As expected, all mice infected with wild-type spores succumbed to infection within four days (Fig. 6, circles) (Cendrowski et al., 2004b). In sharp contrast, mice inoculated with the ΔfpuBΔfatCD strain exhibited a significant increase in survival (p ≤ 0.0001), with the majority of mice (15 of 16) surviving the full two-week experiment (Fig. 6, solid squares).

Figure 6. Attenuation of double permease mutant in murine model of inhalational anthrax.

Figure 6

Open in a new tab

DBA/2J mice were infected via intratracheal inoculation with either wild-type (solid circles, n=8) or ΔfpuBΔfatCD (solid squares, n=16) mutant spores at a dose of 1 × 105 spores/mouse. Mice were monitored for fourteen days after infection. The survival curve for the ΔfpuBΔfatCD strain was significantly different from wild-type by the log-rank test (p ≤ 0.0001).

Identification of three ATPase components involved in petrobactin transport

A similar approach was taken to identify the ATPase components of the petrobactin transport system. Six ATPase proteins were identified as candidates for a role in petrobactin import. These putative ATPases are encoded by GBAA4595, GBAA0618, GBAA5629, GBAA4784, GBAA3864, and GBAA5327 (Fig. 1). To assess the putative role of these candidate proteins in petrobactin transport, six single deletion mutants were generated, each lacking one of these genes. Similar to what was observed for the permeases, none of these single mutants exhibited a growth defect in IDM (Fig. S1 and Table S1). These findings, and the identification of two distinct petrobactin-specific permeases as described above, suggested the possibility that distinct ATPases could be functioning individually with each permease. Of the six putative ATPases, fatE is located directly downstream of the fatCD and was, therefore, the most likely candidate to function with this permease. To determine whether FatE was functioning with the FatCD permease, it was necessary to prevent transport through the other permease, FpuB. Therefore, a mutant lacking the FatE ATPase was generated in the ΔfpuB background. This mutant, ΔfpuBΔfatE, displayed all of the hallmark characteristics of a petrobactin import mutant including a growth defect in IDM (Fig. 2C, solid squares), an inability to be restored to wild-type growth levels by the addition of exogenous petrobactin (Fig. 3A and B, open triangles), increased extracellular catechol levels in culture supernatants (Fig. 4, grey bars), and resistance to gallium induced growth inhibition (Fig. 5, grey bars). These phenotypes combined implicate FatE in petrobactin import through interaction with the FatCD permease.

In order to identify the ATPase(s) functioning with the FpuB permease, an analogous approach was taken. Each of the remaining five putative ATPase genes was deleted individually in the ΔfatCD background. However, none of these mutants exhibited a growth defect in IDM (data not shown). This result suggested that multiple ATPases were functioning with this single permease. To test this, a double ATPase deletion mutant was generated in the ΔfatCD background targeting the two genes (GBAA4595 and GBAA0618) having the highest amino acid sequence identity to the FhuC ATPase from Escherichia coli (45% and 42% identity, respectively). This mutant, ΔfatCDΔfpuCΔfpuD, displayed all of the phenotypic characteristics of a mutant deficient in petrobactin import. These included an inability to grow to wild-type levels in IDM (Fig. 2C, solid triangles), an inability to be restored to wild-type growth levels by the addition of exogenous petrobactin (Fig. 3A and B, open circles), increased extracellular catechol levels in culture supernatants (Fig. 4, grey bars), and protection from gallium induced growth inhibition (Fig. 5, grey bars). We therefore propose naming these genes fpuC (GBAA4595) and fpuD (GBAA0618). A mutant lacking only these two ATPases, but still encoding the FatCD permease (ΔfpuCΔfpuD) did not have a growth defect in IDM (data not shown). Indeed, no mutant lacking two of these ATPases (fatE, fpuC, or fpuD) showed any phenotype. All of these data combine to implicate the ATPases encoded by fpuC and fpuD in the import of petrobactin through interaction with the FpuB permease.

Finally, a mutant lacking all three ATPase components was constructed (ΔfatEΔfpuCΔfpuD). This strain retained wild-type copies of both of the identified petrobactin reacquisition permeases. The triple ATPase mutant exhibited the expected growth defect in IDM (Fig. 2C, open diamonds). As expected, the ΔfatEΔfpuCΔfpuD mutant also exhibited increased catachol levels (Fig. 4, grey bars), and no sensitivity to gallium, (Fig. 5, grey bars). However, in addition to the growth defect observed in IDM, this mutant grew poorly in sporulation media, and failed to sporulate efficiently. Due to the inability to isolate spores, the petrobactin supplementation assay could not be performed. Although the mutant failed to grow well in sporulation media, it did not exhibit a general growth defect, as it grew as well as wild-type in rich media, (Fig. 2D, open diamonds) or in IDM supplemented with 20 μM ferrous sulfate (data not shown). The growth and sporulation defects observed for the ΔfatEΔfpuCΔfpuD mutant could be complemented in trans. Growth in IDM was restored to wild-type levels when either fpuD or fatE was expressed from a plasmid, (Fig. 7, solid triangles and solid circles, respectively). The ability to grow well in sporulation media and produce spores was restored in the complemented strains as well (data not shown). For unknown reasons, attempts to complement fpuC were unsuccessful.

Figure 7. Complementation of triple ATPase mutant.

Figure 7

Open in a new tab

All cultures were inoculated with vegetative bacilli at an initial OD600 of 0.05 and growth was monitored hourly for six hours by measuring increase in OD600. Wild-type/pMJ01+ and ΔfatCDΔfpuCΔfpuD/pMJ01+ strains were used as empty vector controls. Wild-type/pMJ01+ (solid squares), ΔfatEΔfpuCΔfpuD/pMJ01+ (open diamonds), ΔfatEΔfpuCΔfpuD/pfpuD+ (solid triangles), ΔfatEΔfpuCΔfpuD/pfatE+ (solid circles) strains were grown in IDM media containing 10μg ml−1 chloramphenicol. Data are presented as mean ± standard deviation of triplicate measures from one experiment and represent at least three independent experiments.

Discussion

B. anthracis encodes a number of genes involved in scavenging iron from a variety of sources, including those responsible for the biosynthesis of two siderophores (Carlson et al., 2009, Lee et al., 2007). However, both murine virulence and the ability to grow in iron depleted medium in vitro are only dependent on the ability to produce and reacquire one of these molecules, petrobactin. Previous work established both the importance of petrobactin biosynthesis, and the requirement of the petrobactin receptor FpuA in its utilization (Lee et al., 2007, Carlson et al., 2009, Carlson et al., 2010, Cendrowski et al., 2004b, Garner et al., 2004). The work presented here identifies two permeases and three ATPases that also function in petrobactin import. These proteins appear to function with the petrobactin receptor FpuA, presumably making at least three ABC transporter complexes, each independently sufficient for the reacquisition of petrobactin (Fig. 8). Two of these transporter complexes involve association of the receptor, FpuA, with the FpuB permease. In turn, FpuB can function with either of two separate ATPases, FpuC or FpuD (Fig. 8, complexes A and B). The third transporter complex consists of FpuA associated with the FatCD permease and the FatE ATPase (Fig. 8, complex C).

Figure 8. Proposed model for Bacillus anthracis petrobactin ATP-Binding Cassette (ABC) Import.

Figure 8

Open in a new tab

Extracellular petrobactin (black crescents) binds to ferric iron ions (grey ovals) prior to reacquisiton. The proteins required for the import of petrobactin include the substrate-binding receptor protein FpuA (required in all three complexes), two hydrophobic membrane-spanning domains, or permeases, FpuB (complex A and B) and FatCD (complex C), and three cytoplasmic ATPase domains, FatE, and proteins FpuC and FpuD that couple the energy of ATP hydrolysis to import petrobactin. It is presumed that the iron-siderophore complex is imported through the cytoplasmic membrane via one of these three canonical (substrate-binding protein dependent) ABC- transport protein complexes.

While it is common for all of the components of a bacterial ABC transporter to be encoded within a single operon, instances exist where the genes encoding these components are located in separate positions on the genome. The genes that encode the components for petrobactin acquisition exhibit this partially unclustered genetic organization. The genes encoding FpuA and FpuB belong to a single operon lacking a gene encoding an ATPase (Fig. 1). Two distinct genes (fpuC and fpuD), found at separate locations on the chromosome, encode ATPase components that can individually energize import through FpuB (Fig. 8, complex A and B). These genes belong to otherwise uncharacterized iron-transport clusters containing both putative receptor and permease genes (Fig. 1) that play no apparent role in petrobactin reacquisition. For the FpuA/FatCDE transport complex (Fig.8, complex C), the genes encoding the permease and ATPase components are contained within the same operon, fatBCDE. FatB, an apparent substrate binding protein, is not required for petrobactin import, but may serve some other undefined role (Carlson et al., 2010).

Often the components of ABC transporters are unique to an individual transporter, although some promiscuity, similar to what is reported here for petrobactin import, has been observed. For example, the MsmK ATPase from Streptococcus pneumoniae associates with the transmembrane domains of multiple carbohydrate transporters, including those involved in the import of sialic acid (SatABC), raffinose (RafEGF) and maltotetraose (MalXCD) (Marion et al., 2011). Additionally, the FhuC ATPase from Staphylococcus aureus functions as the ATPase component of three distinct iron-siderophore transporters, HtsABC, SirABC and FhuCBG. These transporters are required for staphyloferrin A, staphyloferrin B, and hydroxamate-mediated iron acquisition, respectively (Beasley & Heinrichs, 2010). Similarly, the plasmid-encoded anguibactin uptake system of Vibrio anguillarum lacks an ATPase, and relies on a yet unidentified enzyme encoded on the chromosome (Koster et al., 1991, Lopez & Crosa, 2007). The work presented here reports an unusual inverse of these configurations in which a single substrate-binding protein, FpuA, presents petrobactin to two distinct permeases and furthermore, these two permease proteins display association with discrete ATPases.

Despite the compelling genetic analysis presented here suggesting three complexes following the canonical model for ABC transporters (Eitinger et al., 2011), we note that protein-protein interaction studies have not been performed. Additional characterizations, including the relative abundance of each transporter on the cell surface and preference of the receptor FpuA for the permeases FpuB or FatCD remain to be determined. Also, the question of when iron is removed from petrobactin, before or after import, remains. Considering the similarity in structure of petrobactin to other well-characterized siderophores including aerobactin (Koster & Braun, 1990a, Koster & Braun, 1990b, Wooldridge et al., 1992) and bacillibactin (Miethke et al., 2006), it is likely that the intact ferric-petrobactin holo-complex is transported across the membrane. According to this model, reduction of the metal (Miethke & Marahiel, 2007) or degradation of the siderophore (Miethke et al., 2006, Garénaux et al., 2011) by currently unidentified enzymes would then allow for release of iron in the bacterial cytoplasm. However, the possibility exists that the release of iron from petrobactin occurs prior to internalization. This has been observed in Salmonella typhimurium and in Mycobacterium tuberculosis where the enzymatic reduction and release of iron from either ferrioxamine or mycobactin, respectively, occurs by extracellular iron reductases (Cowart, 2002, Ratledge, 2004).

We propose that the permeases FpuB and FatCD play redundant roles in petrobactin import, with either protein able to associate with their respective ATPases and the FpuA receptor in the formation of a canonical ABC transport complex. Additional redundancy is observed by the association of FpuB with two ATPases, FpuC or FpuD (Fig. 8, Complexes A and B), either of which is sufficient for petrobactin import. The genes that encode these two ATPases belong to gene clusters that contain both receptor and permease components and have high homology to other ABC transporters involved in ion transport (Fig. 1, GBAA4597 and GBAA0615 gene clusters). It seems likely, therefore, that these ATPases are functional components of transporters with roles other than petrobactin acquisition. A possible example of this multi-functionality is demonstrated by the growth defect of the triple mutant (ΔfatEΔfpuCΔfpuD) in sporulation media, a defect not present in any other mutant, independent of their growth phenotypes in IDM. This inability to produce spores is most likely the result of the poor growth in the sporulation media, versus a defect in the sporulation machinery. However, the exact nature of this defect is unknown.

Petrobactin-facilitated iron uptake is a determinant of B. anthracis virulence. Through this, and previous work, we have completed the identification of components composing the import machinery facilitating this process. The petrobactin import system consists of redundant gene products that interact with specific partners in the formation of three canonical ABC transport complexes (Fig. 8, complexes A, B, and C). The description of siderophore uptake systems provides the identification of potential therapeutic targets for combating bacterial infections and creates a more accurate model of steps critical to the life cycle B. anthracis during pathogenesis. These findings also highlight the importance of host iron acquisition mechanisms during bacterial infection.

Experimental procedures

Bacterial growth and sporulation conditions

Bacterial strains used for this study are described in Table 1. All mutant strains were derived from the B. anthracis Sterne 34F2 strain (pXO1+, pXO2−). Spores were generated as described previously (Passalacqua & Bergman, 2006), except that growth of the cultures was performed at 37°C and purified by passage through a 3.1 micron glass microfiber filter (National Scientific Company) to increase purity. Spore stocks were stored at room temperature in sterile water and titered using a hematocytometer to the desired concentration for use in mouse infection and petrobactin supplementation studies. All subsequent experiments were performed from these stocks. For experiments performed under low iron conditions, iron-depleted media (IDM) was prepared as previously described (Cendrowski et al., 2004b). For IDM growth experiments, overnight cultures grown in brain heart infusion broth (BHI) were back-diluted 1:50 in fresh medium and allowed to grow for 1 hour at 37°C. Actively growing cells were collected by centrifugation at 1600 ×g, and the pellets were washed five times in IDM to remove residual iron. The washed cells were inoculated into IDM at a final optical density at 600 nm (OD600) of 0.05. For complementation experiments, cultures were supplemented with 10 μg ml−1 of chloramphenicol where indicated for plasmid maintenance. Cultures were grown at 37°C with aeration, and the OD600 was measured hourly for six hours. For experiments performed with supplemental petrobactin, cultures were inoculated with 1 × 105 spores of the specified strains in 2 ml IDM with or without the addition of 2.5 μM petrobactin (Carlson et al., 2010), and were monitored for change in OD600 over nine hours. For gallium sensitivity assays, strains were inoculated into IDM, as described above, with or without the addition of 20 μM gallium sulfate. Results of the gallium sensitivity assay were normalized to culture OD600 and are presented as percent growth inhibition and calculated as ([(OD600 IDM+gallium)/(OD600 IDM)]*100) at two hours (Carlson et al., 2010).

Table 1.

Bacillus anthracis strains used in this study

Strain/Genotype Relevant Characteristics Reference
Sterne 34F2 Wild type (pXO1+, pXO2−) (Sterne, 1939)
34F2, ΔasbABCDEF Petrobactin biosynthesis mutant (Lee et al., 2007)
34F2, ΔfpuA Petrobactin receptor mutant (Carlson et al., 2010)
34F2, ΔfpuB This work
34F2, ΔfatCD This work
34F2, ΔfpuBΔfatCD ΔfatCD into ΔfpuB This work
34F2, Δ GBAA0616-0617 This work
34F2, Δ GBAA3865-3866 This work
34F2, ΔGBAA4596 This work
34F2, ΔfpuC This work
34F2, ΔfpuD This work
34F2, ΔGBAA5629 This work
34F2, ΔGBAA4784 This work
34F2, ΔGBAA3864 This work
34F2, ΔfatE This work
34F2, ΔfpuBΔfatE ΔfatE into ΔfpuB This work
34F2, ΔfatCDΔfpuC ΔfpuC into ΔfatCD This work
34F2, ΔfatCDΔfpuD ΔfpuD into ΔfatCD This work
34F2, ΔfatCDΔfpuCΔfpuD ΔfpuD into ΔfatCDΔfpuC This work
34F2, ΔfpuCΔfpuD ΔfpuC into ΔfpuD This work
34F2, ΔfatEΔfpuC ΔfatE into ΔfpuC This work
34F2, ΔfatEΔfpuD ΔfatE into ΔfpuD This work
34F2, ΔfatEΔfpuCΔfpuD ΔfatE into ΔfpuCΔfpuD This work
Open in a new tab

Isolation of mutants and construction of complementation plasmids

Mutant strains isolated for this work were all constructed via allelic exchange. Each mutant allele was constructed via PCR using Phusion High Fidelity DNA polymerase (New England Biolabs) according to the manufacturer’s instructions. The PCR products were first cloned into the TOPO® cloning vector (Invitrogen), using manufacturer protocols, and the DNA sequence was verified (University of Michigan DNA sequencing core). The mutant allele was then cloned into the NotI site of the allelic exchange vector pBKJ258 (Janes & Stibitz, 2006) using standard methods. Each construct contained approximately 500 bp both upstream and downstream of the target gene with NotI restriction sites on each end for subsequent cloning. Each mutant allele retained the first ten codons, followed by the DNA sequence GGGCCCTCCGGATCCCCCGGG, and then the last nine codons plus the predicted stop codon. A similar strategy was followed for each single gene deletion mutant. For mutations where two sequential genes were deleted, the initial ten codons of the first gene were fused with the final nine codons of the second gene, in the same manner described above. Allelic exchange was performed as described previously (Janes & Stibitz, 2006). The presence of the mutant alleles was verified by PCR, and each resulting mutant was otherwise isogenic to the parental strain. Sequences of all oligonucleotides used in the creation and screening of these mutants are available upon request. Spore stocks for each mutant were generated and stored as described above.

PCR was used to amplify fatE and fpuD by standard methods. DNA fragments were cloned and each DNA sequence verified as described above for mutant allele construction. Primers were designed such that an XbaI site was inserted directly upstream of the intiation codon of the gene of interest, and a HindIII site directly downstream of the native stop codon. Each gene was cloned into the XbaI and HindIII sites of pGFP (Wilson et al., 2011a, Wilson et al., 2011b), replacing the gfpmut3a allele with the gene of interest, expressed by the p43 promoter present on the plasmid. The plasmid pMJ01, a version of pGFP lacking the gfpmut3a allele was used as a control (Wilson et al., 2011b). Plasmids were passaged through SCS110 (dam dcm) and then transferred into the appropriate B. anthracis strain via electroporation (Passalacqua & Bergman, 2006).

Measurement of catechol accumulation

The levels of extracellular catechol were measured using the Arnow assay (Arnow, 1937, Carlson et al., 2010). Strains were grown as described above for six hours and supernatants were collected and filtered using a 0.22 μm syringe filter. Culture supernatants were then mixed with equal volumes of 0.5 M HCl, followed by the sequential addition of equal volumes of nitrate-molybdate reagent (10% sodium nitrate and 10% sodium molybdate), 1 N NaOH, and distilled H2O in 96-well plates. Sample reactions positive for the presence of catechol moieties produced a red color and absorbance was measured at 515 nm. Absorbance values were normalized to OD600 of the original culture. Data are presented as the percentage of wild-type extracellular catechol in culture supernatants at six hours.

Murine virulence assays

DBA/J2 mice (Jackson Laboratories) were infected via intratracheal inoculation as previously described (Heffernan et al., 2007). Groups of eight female mice age 6–8 weeks were infected with either wild-type or ΔfpuBΔfatCD mutant spores at a dose of 1.5 × 105 spores/mouse. Mice were monitored for 14 days following infection. All mouse experiments were performed using protocols approved by the University of Michigan on the Use and Care of Animals.

Supplementary Material

Supp Fig S1 & Table S1

Acknowledgments

The authors would like to thank Tyler D. Nusca and David H. Sherman for the kind gift of purified petrobactin. This work was supported in part by a grant (AI169083) from the National Institutes of Health. S.D.D. was supported in part by the American Society for Microbiology (ASM) Robert D. Watkins Graduate Research Fellowship.

References

  1. Abergel RJ, Wilson MK, Arceneaux JE, Hoette TM, Strong RK, Byers BR, Raymond KN. Anthrax pathogen evades the mammalian immune system through stealth siderophore production. Proc Natl Acad Sci U S A. 2006a;103:18499–18503. doi: 10.1073/pnas.0607055103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Abergel RJ, Wilson MK, Arceneaux JEL, Hoette TM, Strong RK, Byers BR, Raymond KN. Anthrax pathogen evades the mammalian immune system through stealth siderophore production. Proceedings of the National Academy of Sciences. 2006b;103:18499–18503. doi: 10.1073/pnas.0607055103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Abergel RJ, Zawadzka AM, Raymond KN. Petrobactin-mediated iron transport in pathogenic bacteria: coordination chemistry of an unusual 3,4-catecholate/citrate siderophore. J Am Chem Soc. 2008;130:2124–2125. doi: 10.1021/ja077202g. [DOI] [PubMed] [Google Scholar]
  4. Almeida JL, Harper B, Cole KD. Bacillus anthracis spore suspensions: determination of stability and comparison of enumeration techniques. J Appl Microbiol. 2008;104:1442–1448. doi: 10.1111/j.1365-2672.2007.03684.x. [DOI] [PubMed] [Google Scholar]
  5. Arnow LE. Colorimetric determination of the components of 3, 4-dihydroxyphenylalanine-tyrosine mixtures. J Biol Chem. 1937;118:531–537. [Google Scholar]
  6. Banin E, Lozinski A, Brady KM, Berenshtein E, Butterfield PW, Moshe M, Chevion M, Greenberg EP. The potential of desferrioxamine-gallium as an anti-Pseudomonas therapeutic agent. Proc Natl Acad Sci U S A. 2008;105:16761–16766. doi: 10.1073/pnas.0808608105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Barbeau K, Zhang G, Live DH, Butler A. Petrobactin, a photoreactive siderophore produced by the oil-degrading marine bacterium Marinobacter hydrocarbonoclasticus. J Am Chem Soc. 2002;124:378–379. doi: 10.1021/ja0119088. [DOI] [PubMed] [Google Scholar]
  8. Beasley FC, Heinrichs DE. Siderophore-mediated iron acquisition in the staphylococci. J Inorg Biochem. 2010;104:282–288. doi: 10.1016/j.jinorgbio.2009.09.011. [DOI] [PubMed] [Google Scholar]
  9. Braun V, Braun M. Active transport of iron and siderophore antibiotics. Curr Opin Microbiol. 2002;5:194–201. doi: 10.1016/s1369-5274(02)00298-9. [DOI] [PubMed] [Google Scholar]
  10. Carlson PE, Jr, Carr KA, Janes BK, Anderson EC, Hanna PC. Transcriptional profiling of Bacillus anthracis Sterne (34F2) during iron starvation. PLoS ONE. 2009;4:e6988. doi: 10.1371/journal.pone.0006988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Carlson PE, Jr, Dixon SD, Janes BK, Carr KA, Nusca TD, Anderson EC, Keene SE, Sherman DH, Hanna PC. Genetic analysis of petrobactin transport in Bacillus anthracis. Mol Microbiol. 2010;75:900–909. doi: 10.1111/j.1365-2958.2009.07025.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Cendrowski S, MacArthur W, Hanna P. Bacillus anthracis requires siderophore biosynthesis for growth in macrophages and mouse virulence. Molecular Microbiology. 2004a;51:407–417. doi: 10.1046/j.1365-2958.2003.03861.x. [DOI] [PubMed] [Google Scholar]
  13. Cendrowski S, MacArthur W, Hanna P. Bacillus anthracis requires siderophore biosynthesis for growth in macrophages and mouse virulence. Mol Microbiol. 2004b;51:407–417. doi: 10.1046/j.1365-2958.2003.03861.x. [DOI] [PubMed] [Google Scholar]
  14. Challis GL. A widely distributed bacterial pathway for siderophore biosynthesis independent of nonribosomal peptide synthetases. Chembiochem. 2005;6:601–611. doi: 10.1002/cbic.200400283. [DOI] [PubMed] [Google Scholar]
  15. Cowart RE. Reduction of iron by extracellular iron reductases: implications for microbial iron acquisition. Arch Biochem Biophys. 2002;400:273–281. doi: 10.1016/S0003-9861(02)00012-7. [DOI] [PubMed] [Google Scholar]
  16. Davidson AL, Dassa E, Orelle C, Chen J. Structure, function, and evolution of bacterial ATP-binding cassette systems. Microbiol Mol Biol Rev. 2008;72:317–364. doi: 10.1128/MMBR.00031-07. table of contents. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Dixon TC, Fadl AA, Koehler TM, Swanson JA, Hanna PC. Early Bacillus anthracis-macrophage interactions: intracellular survival survival and escape. Cell Microbiol. 2000;2:453–463. doi: 10.1046/j.1462-5822.2000.00067.x. [DOI] [PubMed] [Google Scholar]
  18. Dixon TC, Meselson M, Guillemin J, Hanna PC. Anthrax. N Engl J Med. 1999;341:815–826. doi: 10.1056/NEJM199909093411107. [DOI] [PubMed] [Google Scholar]
  19. Doganay L, Welsby PD. Anthrax: a disease in waiting? Postgrad Med J. 2006;82:754–756. doi: 10.1136/pgmj.2005.044487. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Dutz W, Kohout-Dutz E. Anthrax. Int J Dermatol. 1981;20:203–206. doi: 10.1111/j.1365-4362.1981.tb00461.x. [DOI] [PubMed] [Google Scholar]
  21. Dutz W, Kohout E. Anthrax. Pathol Annu. 1971;6:209–248. [PubMed] [Google Scholar]
  22. Ecker DJ, Emery T. Iron uptake from ferrichrome A and iron citrate in Ustilago sphaerogena. J Bacteriol. 1983;155:616–622. doi: 10.1128/jb.155.2.616-622.1983. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Eitinger T, Rodionov DA, Grote M, Schneider E. Canonical and ECF-type ATP-binding cassette importers in prokaryotes: diversity in modular organization and cellular functions. FEMS Microbiol Rev. 2011;35:3–67. doi: 10.1111/j.1574-6976.2010.00230.x. [DOI] [PubMed] [Google Scholar]
  24. Faraldo-Gomez JD, Sansom MS. Acquisition of siderophores in gram-negative bacteria. Nat Rev Mol Cell Biol. 2003;4:105–116. doi: 10.1038/nrm1015. [DOI] [PubMed] [Google Scholar]
  25. Fox DT, Hotta K, Kim CY, Koppisch AT. The missing link in petrobactin biosynthesis: asbF encodes a (−)-3-dehydroshikimate dehydratase. Biochemistry. 2008;47:12251–12253. doi: 10.1021/bi801876q. [DOI] [PubMed] [Google Scholar]
  26. Garénaux A, Caza M, Dozois CM. The Ins and Outs of siderophore mediated iron uptake by extra-intestinal pathogenic Escherichia coli. Veterinary Microbiology. 2011;153:89–98. doi: 10.1016/j.vetmic.2011.05.023. [DOI] [PubMed] [Google Scholar]
  27. Garner BL, Arceneaux JE, Byers BR. Temperature control of a 3,4-dihydroxybenzoate (protocatechuate)-based siderophore in Bacillus anthracis. Curr Microbiol. 2004;49:89–94. doi: 10.1007/s00284-004-4286-7. [DOI] [PubMed] [Google Scholar]
  28. Glanfield A, McManus DP, Anderson GJ, Jones MK. Pumping iron: a potential target for novel therapeutics against schistosomes. Trends Parasitol. 2007;23:583–588. doi: 10.1016/j.pt.2007.08.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Guidi-Rontani C, Weber-Levy M, Labruyere E, Mock M. Germination of Bacillus anthracis spores within alveolar macrophages. Mol Microbiol. 1999;31:9–17. doi: 10.1046/j.1365-2958.1999.01137.x. [DOI] [PubMed] [Google Scholar]
  30. Hanna P. Anthrax pathogenesis and host response. Curr Top Microbiol Immunol. 1998a;225:13–35. doi: 10.1007/978-3-642-80451-9_2. [DOI] [PubMed] [Google Scholar]
  31. Hanna P. How anthrax kills. Science. 1998b;280:1671, 1673–1674. doi: 10.1126/science.280.5370.1671c. [DOI] [PubMed] [Google Scholar]
  32. Heffernan BJ, Thomason B, Herring-Palmer A, Hanna P. Bacillus anthracis anthrolysin O and three phospholipases C are functionally redundant in a murine model of inhalation anthrax. FEMS Microbiol Lett. 2007;271:98–105. doi: 10.1111/j.1574-6968.2007.00713.x. [DOI] [PubMed] [Google Scholar]
  33. Hotta K, Kim CY, Fox DT, Koppisch AT. Siderophore-mediated iron acquisition in Bacillus anthracis and related strains. Microbiology. 2010;156:1918–1925. doi: 10.1099/mic.0.039404-0. [DOI] [PubMed] [Google Scholar]
  34. Inglesby TV, Henderson DA, Bartlett JG, Ascher MS, Eitzen E, Friedlander AM, Hauer J, McDade J, Osterholm MT, O’Toole T, Parker G, Perl TM, Russell PK, Tonat K. Anthrax as a biological weapon: medical and public health management. Working Group on Civilian Biodefense. JAMA. 1999;281:1735–1745. doi: 10.1001/jama.281.18.1735. [DOI] [PubMed] [Google Scholar]
  35. Inglesby TV, O’Toole T, Henderson DA, Bartlett JG, Ascher MS, Eitzen E, Friedlander AM, Gerberding J, Hauer J, Hughes J, McDade J, Osterholm MT, Parker G, Perl TM, Russell PK, Tonat K. Anthrax as a biological weapon, 2002: updated recommendations for management. JAMA. 2002;287:2236–2252. doi: 10.1001/jama.287.17.2236. [DOI] [PubMed] [Google Scholar]
  36. Janes BK, Stibitz S. Routine markerless gene replacement in Bacillus anthracis. Infect Immun. 2006;74:1949–1953. doi: 10.1128/IAI.74.3.1949-1953.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Kadi N, Challis GL. Chapter 17. Siderophore biosynthesis a substrate specificity assay for nonribosomal peptide synthetase-independent siderophore synthetases involving trapping of acyl-adenylate intermediates with hydroxylamine. Methods Enzymol. 2009;458:431–457. doi: 10.1016/S0076-6879(09)04817-4. [DOI] [PubMed] [Google Scholar]
  38. Koppisch A, Dhungana S, Hill K, Boukhalfa H, Heine H, Colip L, Romero R, Shou Y, Ticknor L, Marrone B, Hersman L, Iyer S, Ruggiero C. Petrobactin is produced by both pathogenic and non-pathogenic isolates of the Bacillus cereus group of bacteria. Biometals. 2008a doi: 10.1007/s10534-008-9144-9. [DOI] [PubMed] [Google Scholar]
  39. Koppisch AT, Browder CC, Moe AL, Shelley JT, Kinkel BA, Hersman LE, Iyer S, Ruggiero CE. Petrobactin is the primary siderophore synthesized by Bacillus anthracis str. Sterne under conditions of iron starvation. Biometals. 2005;18:577–585. doi: 10.1007/s10534-005-1782-6. [DOI] [PubMed] [Google Scholar]
  40. Koppisch AT, Hotta K, Fox DT, Ruggiero CE, Kim CY, Sanchez T, Iyer S, Browder CC, Unkefer PJ, Unkefer CJ. Biosynthesis of the 3,4-dihydroxybenzoate moieties of petrobactin by Bacillus anthracis. J Org Chem. 2008b;73:5759–5765. doi: 10.1021/jo800427f. [DOI] [PubMed] [Google Scholar]
  41. Koster W. ABC transporter-mediated uptake of iron, siderophores, heme and vitamin B12. Res Microbiol. 2001;152:291–301. doi: 10.1016/s0923-2508(01)01200-1. [DOI] [PubMed] [Google Scholar]
  42. Koster W. Cytoplasmic membrane iron permease systems in the bacterial cell envelope. Front Biosci. 2005;10:462–477. doi: 10.2741/1542. [DOI] [PubMed] [Google Scholar]
  43. Koster W, Braun V. Iron (III) hydroxamate transport into Escherichia coli. Substrate binding to the periplasmic FhuD protein. J Biol Chem. 1990a;265:21407–21410. [PubMed] [Google Scholar]
  44. Koster W, Braun V. Iron(III) hydroxamate transport of Escherichia coli: restoration of iron supply by coexpression of the N- and C-terminal halves of the cytoplasmic membrane protein FhuB cloned on separate plasmids. Mol Gen Genet. 1990b;223:379–384. doi: 10.1007/BF00264443. [DOI] [PubMed] [Google Scholar]
  45. Koster WL, Actis LA, Waldbeser LS, Tolmasky ME, Crosa JH. Molecular characterization of the iron transport system mediated by the pJM1 plasmid in Vibrio anguillarum 775. J Biol Chem. 1991;266:23829–23833. [PubMed] [Google Scholar]
  46. Lee JY, Janes BK, Passalacqua KD, Pfleger BF, Bergman NH, Liu H, Hakansson K, Somu RV, Aldrich CC, Cendrowski S, Hanna PC, Sherman DH. Biosynthetic analysis of the petrobactin siderophore pathway from Bacillus anthracis. J Bacteriol. 2007;189:1698–1710. doi: 10.1128/JB.01526-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Lee JY, Passalacqua KD, Hanna PC, Sherman DH. Regulation of Petrobactin and Bacillibactin Biosynthesis in Bacillus anthracis under Iron and Oxygen Variation. PLoS One. 2011;6:e20777. doi: 10.1371/journal.pone.0020777. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Liu H, Hakansson K, Lee JY, Sherman DH. Collision-activated dissociation, infrared multiphoton dissociation, and electron capture dissociation of the Bacillus anthracis siderophore petrobactin and its metal ion complexes. J Am Soc Mass Spectrom. 2007;18:842–849. doi: 10.1016/j.jasms.2007.01.005. [DOI] [PubMed] [Google Scholar]
  49. Lopez CS, Crosa JH. Characterization of ferric-anguibactin transport in Vibrio anguillarum. Biometals. 2007;20:393–403. doi: 10.1007/s10534-007-9084-9. [DOI] [PubMed] [Google Scholar]
  50. Marion C, Aten AE, Woodiga SA, King SJ. Identification of an ATPase, MsmK, which energizes multiple carbohydrate ABC transporters in Streptococcus pneumoniae. Infect Immun. 2011;79:4193–4200. doi: 10.1128/IAI.05290-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Miethke M, Klotz O, Linne U, May JJ, Beckering CL, Marahiel MA. Ferri-bacillibactin uptake and hydrolysis in Bacillus subtilis. Mol Microbiol. 2006;61:1413–1427. doi: 10.1111/j.1365-2958.2006.05321.x. [DOI] [PubMed] [Google Scholar]
  52. Miethke M, Marahiel MA. Siderophore-based iron acquisition and pathogen control. Microbiol Mol Biol Rev. 2007;71:413–451. doi: 10.1128/MMBR.00012-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Neilands JB. Siderophores: structure and function of microbial iron transport compounds. J Biol Chem. 1995;270:26723–26726. doi: 10.1074/jbc.270.45.26723. [DOI] [PubMed] [Google Scholar]
  54. Nicholson WL, Munakata N, Horneck G, Melosh HJ, Setlow P. Resistance of Bacillus endospores to extreme terrestrial and extraterrestrial environments. Microbiol Mol Biol Rev. 2000;64:548–572. doi: 10.1128/mmbr.64.3.548-572.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Olakanmi O, Britigan BE, Schlesinger LS. Gallium disrupts iron metabolism of mycobacteria residing within human macrophages. Infect Immun. 2000;68:5619–5627. doi: 10.1128/iai.68.10.5619-5627.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Oves-Costales D, Kadi N, Challis GL. The long-overlooked enzymology of a nonribosomal peptide synthetase-independent pathway for virulence-conferring siderophore biosynthesis. Chemical Communications. 2009:6530–6541. doi: 10.1039/b913092f. [DOI] [PubMed] [Google Scholar]
  57. Oves-Costales D, Kadi N, Fogg MJ, Song L, Wilson KS, Challis GL. Enzymatic logic of anthrax stealth siderophore biosynthesis: AsbA catalyzes ATP-dependent condensation of citric acid and spermidine. J Am Chem Soc. 2007;129:8416–8417. doi: 10.1021/ja072391o. [DOI] [PubMed] [Google Scholar]
  58. Oves-Costales D, Kadi N, Fogg MJ, Song L, Wilson KS, Challis GL. Petrobactin biosynthesis: AsbB catalyzes condensation of spermidine with N(8)-citryl675 spermidine and its N(1)-(3,4-dihydroxybenzoyl) derivative. Chem Commun (Camb) 2008:4034–4036. doi: 10.1039/b809353a. [DOI] [PubMed] [Google Scholar]
  59. Passalacqua KD, Bergman NH. Bacillus anthracis: interactions with the host and establishment of inhalational anthrax. Future Microbiol. 2006;1:397–415. doi: 10.2217/17460913.1.4.397. [DOI] [PubMed] [Google Scholar]
  60. Pfleger BF, Kim Y, Nusca TD, Maltseva N, Lee JY, Rath CM, Scaglione JB, Janes BK, Anderson EC, Bergman NH, Hanna PC, Joachimiak A, Sherman DH. Structural and functional analysis of AsbF: Origin of the stealth 3,4-dihydroxybenzoic acid subunit for petrobactin biosynthesis. Proc Natl Acad Sci U S A. 2008a doi: 10.1073/pnas.0808118105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Pfleger BF, Kim Y, Nusca TD, Maltseva N, Lee JY, Rath CM, Scaglione JB, Janes BK, Anderson EC, Bergman NH, Hanna PC, Joachimiak A, Sherman DH. Structural and functional analysis of AsbF: origin of the stealth 3,4-dihydroxybenzoic acid subunit for petrobactin biosynthesis. Proc Natl Acad Sci U S A. 2008b;105:17133–17138. doi: 10.1073/pnas.0808118105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Pfleger BF, Lee JY, Somu RV, Aldrich CC, Hanna PC, Sherman DH. Characterization and analysis of early enzymes for petrobactin biosynthesis in Bacillus anthracis. Biochemistry. 2007;46:4147–4157. doi: 10.1021/bi6023995. [DOI] [PubMed] [Google Scholar]
  63. Ratledge C. Iron, mycobacteria and tuberculosis. Tuberculosis (Edinb) 2004;84:110–130. doi: 10.1016/j.tube.2003.08.012. [DOI] [PubMed] [Google Scholar]
  64. Ratledge C, Dover LG. Iron metabolism in pathogenic bacteria. Annu Rev Microbiol. 2000;54:881–941. doi: 10.1146/annurev.micro.54.1.881. [DOI] [PubMed] [Google Scholar]
  65. Spencer RC. Bacillus anthracis. J Clin Pathol. 2003;56:182–187. doi: 10.1136/jcp.56.3.182. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Sweeney DA, Hicks CW, Cui X, Li Y, Eichacker PQ. Anthrax infection. Am J Respir Crit Care Med. 2011;184:1333–1341. doi: 10.1164/rccm.201102-0209CI. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Wandersman C, Delepelaire P. Bacterial iron sources: from siderophores to hemophores. Annu Rev Microbiol. 2004;58:611–647. doi: 10.1146/annurev.micro.58.030603.123811. [DOI] [PubMed] [Google Scholar]
  68. Wilson MJ, Carlson PE, Janes BK, Hanna PC. Membrane topology of the Bacillus anthracis GerH germinant receptor proteins. J Bacteriol. 2011 doi: 10.1128/JB.06538-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Wilson MK, Abergel RJ, Arceneaux JE, Raymond KN, Byers BR. Temporal production of the two Bacillus anthracis siderophores, petrobactin and bacillibactin. Biometals. 2009;23:129–134. doi: 10.1007/s10534-009-9272-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Wilson MK, Abergel RJ, Raymond KN, Arceneaux JE, Byers BR. Siderophores of Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis. Biochem Biophys Res Commun. 2006;348:320–325. doi: 10.1016/j.bbrc.2006.07.055. [DOI] [PubMed] [Google Scholar]
  71. Wooldridge KG, Morrissey JA, Williams PH. Transport of ferric-aerobactin into the periplasm and cytoplasm of Escherichia coli K12: role of envelope-associated proteins and effect of endogenous siderophores. J Gen Microbiol. 1992;138:597–603. doi: 10.1099/00221287-138-3-597. [DOI] [PubMed] [Google Scholar]
  72. Zawadzka AM, Abergel RJ, Nichiporuk R, Andersen UN, Raymond KN. Siderophore-mediated iron acquisition systems in Bacillus cereus: Identification of receptors for anthrax virulence-associated petrobactin. Biochemistry. 2009a;48:3645–3657. doi: 10.1021/bi8018674. [DOI] [PMC free article] [PubMed] [Google Scholar]
  73. Zawadzka AM, Kim Y, Maltseva N, Nichiporuk R, Fan Y, Joachimiak A, Raymond KN. Characterization of a Bacillus subtilis transporter for petrobactin, an anthrax stealth siderophore. Proc Natl Acad Sci U S A. 2009b;106:21854–21859. doi: 10.1073/pnas.0904793106. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supp Fig S1 & Table S1
NIHMS360934-supplement-Supp_Fig_S1___Table_S1.pdf (864.1KB, pdf)

RESOURCES