Skip to main content
Translational Oncology logoLink to Translational Oncology
. 2012 Apr 1;5(2):85–91. doi: 10.1593/tlo.11328

Expression of Leukocyte Inhibitory Immunoglobulin-like Transcript 3 Receptors by Ovarian Tumors in Laying Hen Model of Spontaneous Ovarian Cancer1

Mohammad Faisal Khan *, Janice M Bahr †, Aparna Yellapa *, Pincas Bitterman ‡, Jacques S Abramowicz §, Seby L Edassery *, Sanjib Basu , Jacob Rotmensch §, Animesh Barua *,‡,§
PMCID: PMC3323929  PMID: 22496924

Abstract

Attempts to enhance a patient's immune response and ameliorate the poor prognosis of ovarian cancer (OVCA) have largely been unsuccessful owing to the suppressive tumor microenvironment. Leukocyte immunoglobulin-like transcript 3 (ILT3) inhibitory receptors have been implicated in immunosuppression in several malignancies. The expression and role of ILT3 in the progression of ovarian tumors are unknown. This study examined the expression and association of ILT3 in ovarian tumors in laying hens, a spontaneous preclinical model of human OVCA. White Leghorn laying hens were selected by transvaginal ultrasound scanning. Serum and normal ovaries or ovarian tumors were collected. The presence of tumors and the expression of ILT3 were examined by routine histology, immunohistochemistry, Western blot analysis, and reverse transcription-polymerase chain reaction. In addition to stromal immune cell-like cells, the epithelium of the ovarian tumors also expressed ILT3 with significantly high intensity than normal ovaries. Among different subtypes of ovarian carcinomas, serous OVCA showed the highest ILT3 staining intensity, whereas endometrioid OVCA had the lowest intensity. Similar to humans, an immunoreactive protein band of approximately 55 kDa for ILT3 was detected in the ovarian tumors in hens. The patterns of ILT3 protein and messenger RNA expression by ovarian tumors in different subtypes and stages were similar to those of immunohistochemical staining. The results of this study suggest that laying hens may be useful to generate information on ILT3-associated immunosuppression in OVCA. This animal model also offers the opportunity to develop and test anti-ILT3 immunotherapy to enhance antitumor immunity against OVCA in humans.

Introduction

Despite the remarkable improvements in cytoreductive surgeries and chemotherapeutics, ovarian cancer (OVCA) remains one of the most lethal gynecologic malignancies of women with a high death rate [1]. Owing to the lack of an effective early detection test, OVCA in most cases is detected at late stages, and its high recurrence rate (80%–90%) contributes to poor prognosis [2,3]. There is an emerging recognition that tumor growth, in general, elicits specific immune responses mediated by cell-mediated immunity [4]. As a result, immunotherapies against several cancers are being developed [4–6]. Although recent advances in immunotherapy have been shown to improve the overall survival ability of patients with hematologic tumors and melanoma [7], most immunotherapeutic trials have failed to demonstrate success in clinical responses [6,8]. Thus, development of new strategies to promote immune responses against malignancies is critical in overcoming the limited efficacy of conventional therapies. Despite the presentation of antigens by ovarian malignant cells, which should induce immune-mediated rejection, spontaneous rejection of an established tumor is rare [9]. This lack of immune response is not only because of the ignorance of the immune system but also because of the tumor-induced immune suppression that protects the tumor from eradication [9]. Therefore, a better understanding of the mechanisms of tumor-induced immunosuppression will enhance our ability to prevent ovarian tumor progression and to design antitumor interventional strategies.

Numerous studies on cancers of several organs have reported several mechanisms of tumor-induced immune suppression including induction of regulatory T cells [10], expression of immunosuppressive factors (transforming growth factor β, interleukin 10, and chemokine ligand 22) [10–12], down-regulation of intracellular adhesion molecules [13], and induction of peripheral tolerance [4,14,15]. In contrast, studies on the mechanism of immune suppression in ovarian malignancy are very limited. OVCA differs from other malignancies in its specific dissemination pattern [9]. The tumor typically spreads in a diffuse intra-abdominal fashion rather than through systemic circulation. Thus, antitumor immune response at the tumor environment plays a critical role to ovarian tumor metastasis. Immunosuppressive regulatory T cells [10], transforming growth factor β [11,12], tolerance-inducing plasmacytoid dendritic cells [16], B7-H4+ macrophages [17], and interleukin 10 [18] have been reported to be present in the tumor microenvironment. However, how these immunosuppressive factors and agents are recruited into the tumor environment is not known. Emerging studies suggest that induction of inhibitory receptor immunoglobulin (Ig)-like transcript 3 (ILT3) expression is one of the mechanisms contributing to the tumor-induced immune suppression in several malignancies [19].

ILT3 is a member of leukocyte Ig-like receptors family with inhibitory functions and exists in both membrane and soluble forms [20]. Both forms of ILT3s have been suggested to inhibit T-cell proliferation, CD4+ T-cell anergy, suppressing the differentiation of interferon γ-producing CD8+ cytotoxic lymphocytes. In addition, membrane and soluble ILT3 were also reported to stimulate the differentiation of regulatory T cells in various cancer patients [4,5,10]. All these findings suggest that ILT3 may be involved in the immunosuppression against tumor antigens and prevention or blocking of ILT3 expression may enhance a patient's immune responses to malignancies. The expression of ILT3 in OVCA patients has not yet been reported. Difficulties in identifying and access to patients at the early stage of OVCA hinder the ability to study the involvement of ILT3 in OVCA progression and develop interventional strategies for its prevention. Rodents do not develop OVCA spontaneously, and the histopathologies of induced OVCA in rodents do not resemble the spontaneous OVCA in humans [21]. Recently, we have shown that laying hens are the only widely available animals that develop OVCA spontaneously with a high incidence rate and histopathologies remarkably similar to human OVCA [22]. The expression of leukocyte Ig-like receptors has been reported in chicken, which are shown to be orthologus to those of mammals including humans [23,24]. Thus, the goal of this study was to examine whether ILT3 is expressed in ovarian tumors in the laying hen model of spontaneous OVCA and, if so, whether ILT3 expression is associated with the progression of ovarian tumors in hens.

Materials and Methods

Animals

Commercial strains of approximately 3-year-old white Leghorn laying hens (Gallus domesticus) were selected from a flock of layers maintained under standard poultry husbandry practices. The incidence of OVCA in hens of this age group is approximately 15% to 20% and is associated with low or complete cessation of egg laying [25]. Hens (n = 148) were selected on the basis of their egg-laying rates (normal, low, or ceased egg laying) and transvaginal ultrasound scanning as reported previously [25]. All experimental procedures were performed according to the institutional animal care and use committee approved protocol.

Tissue Collection and Processing

Serum samples. Blood was obtained from brachial veins of all hens before euthanasia, centrifuged (1000g for 20 minutes), and serum samples were stored at -80°C until further use.

Gross ovarian morphology and histopathology. Ovarian pathology and tumor staging were performed by gross and histologic examination as reported previously [22]. Each normal ovary or ovary with tumor was divided into four portions for protein extraction, total RNA collection, paraffin and frozen embedding for routine histology, and immunohistochemical studies as reported previously [26]. Ovarian surface epithelial (OSE) cells from normal or ovaries with tumor were collected similarly as reported earlier [27]. All collected samples were grouped into three groups including normal-, early-, and late-stage OVCA based on the diagnosis of the histopathologic ovarian tissue examination as reported previously [22].

Preparation of Ovarian Specimen for Biochemical Analysis

Snap-frozen normal ovaries and ovaries with tumor as well as OSE from normal ovaries and ovaries with tumor were homogenized with a Polytron homogenizer (Brinkman Instruments, Westbury, NY) as reported previously [28] and centrifuged, the supernatant was collected, and the protein content of the extract was measured and stored at -80°C until further use.

Histopathologic Examination and Immunohistochemistry

Paraffin or frozen sections from each ovary with tumor or ovaries that appeared normal without any grossly detectable tumor were stained with hematoxylin and eosin and observed under a light microscope. Presence or absence of tumors in the section and their histologic types were determined as reported earlier [22]. Immunohistochemical detection of ILT3 expression was performed using goat anti-ILT3 (R&D Systems, Inc, Minneapolis, MN) as primary antibodies (n = 15 hens each, for normal, early, and late stages as reported previously) [26]. The number of hens for each group was determined based on statistical power analysis to achieve significant differences in the intensities of ILT3 immunostaining among the hens of normal or OVCA groups. These hens were selected from each group randomly. Briefly, sections were deparaffinized, and antigens on the sections were unmasked by heating the sections with an antigen-unmasking solution (Vector Laboratories, Burlingame, CA) for 20 minutes in a microwave oven. Endogenous peroxidase in the sections was inactivated, and nonspecific staining was blocked by incubating with 0.3% hydrogen peroxide in methanol for 30 minutes followed by 1% (vol/vol) normal horse serum for 15 minutes, respectively. Sections were then incubated overnight with primary antibodies (1:100 dilution) followed by 1 hour of incubation with anti-goat IgG-HRP secondary antibodies (R&D Systems). Immunoprecipitates on the sections were visualized by incubation with a mixture of diaminobenzidine and hydrogen peroxide in diaminobenzidine buffer (Vector Laboratories). Sections were then counterstained with hematoxylin, dehydrated, and covered. Control staining was carried out simultaneously in which the first antibodies were omitted and normal goat serum was used. No staining was found in these control slides.

Sections were then examined under a light microscope attached to digital imaging software (MicroSuite version 5; Olympus Corporation, Tokyo, Japan). Three sections per ovary and five regions of interest (20,000 µm2/region at x40 objective and x10 ocular magnification) per section were randomly selected. Using the software, the intensity of the ILT3 immunostaining in each region was measured and recorded as pixel values in 20,000 µm2 of the section. The mean of pixel values of these five regions in a section was considered as the intensity of each section, and the mean of intensities of three sections was considered as the mean of ILT3 staining intensity in normal or tumor-bearing ovaries.

One-dimensional Western Blot

The expression of ILT3 proteins by normal ovaries or ovarian tumors as well as OSE from normal ovaries or ovaries with tumor was determined by Western blot analysis using primary and secondary antibodies mentioned above. On the basis of immunohistochemical staining results, representative samples of ovarian as well as OSE homogenates from normal or ovarian tumors at early and late stages were used in immunoblot analysis. Immunoreactions on the membrane were visualized as a chemiluminescence product (Super Dura West substrate; Pierce/Thermo Fisher, Rockford, IL), and the image was captured using a Chemidoc XRS (Bio-Rad, Hercules, CA). Digital images obtained with Chemidoc XRS were analyzed by Quantity One software (Bio-Rad) according to the manufacturer's recommendation, and the intensities of immunoreactive bands were expressed as density per intensity in squared millimeter and the mean of intensities for each normal or pathologic group as well as for the stages of OVCA were calculated. No immune reaction was observed in controls where protein samples were omitted. Serum samples for Western blot analysis were selected similar to ovarian samples and tested to confirm the presence of soluble ILT3.

Reverse Transcription-Polymerase Chain Reaction

ILT3 messenger RNA (mRNA) expression in ovarian tissues or epithelial cells from normal hens or hens with OVCA was assessed by semiquantitative reverse transcription-polymerase chain reaction (RT-PCR) as reported previously [29]. Representative samples of normal ovaries or ovaries with tumor as well as OSE from hens were selected for RT-PCR analyses based on their immunoreactivities in immunohistochemistry and immunoblot analysis were used. Hen-specific ILT3 primers were designed by Oligoperfect Designer software (Invitrogen, Carlsbad, CA) using the ILT3 sequence from the National Center for Biotechnology Information (GenBank: NM_001146134.1). The forward primer was 5-TGG CTG TAC CAG GAA AGA GG and the reverse primer was 5-CTC TGA TGC CCC TAC TGA CC. β-Actin was used as the endogenous control with a forward primer of TGCGTGACATCAAGGAGAAG and a reverse primer of ATGCCAGGGTACATTGTGGT. The expected base pair size for the ILT3 amplicon was 150 bp and that for β-actin was 300 bp. PCR amplicons were visualized in a 3% agarose gel (Pierce) in TAE buffer and stained with ethidium bromide, and images were captured using a ChemiDoc XRS system (Bio-Rad). PCR products were sequenced, and the sequence was the same as the sequence of primers from the National Center for Biotechnology Information GenBank (NM_001146134.1).

Statistical Analysis

The differences in the pixel intensities of ILT3 immunostaining among different histologic subtypes and stages (early vs late) were assessed by two-way analysis of variance. This was followed by pairwise comparison between the histologic subtypes (normal, endometrioid, mucinous, and serous) within each stage and comparison of the stages within histologic subtypes by two-sample t tests and alternative Mann-Whitney tests. All reported P values are 2-sided, and P < .05 was considered significant. Statistical analyses were performed with SPSS (PASW) version 18 software (IBM, Inc, Armonk, NY) and R statistical software.

Results

Morphologic and Histologic Features of Hen Ovaries and Ovarian Tumors

Gross morphology. A fully functional ovary in a healthy laying hen contained five to six developing large preovulatory follicles (Figure 1A), whereas the ovaries of low-laying healthy hens contained less than three preovulatory follicles. In normal hens that had stopped egg laying, ovaries and oviducts were regressed without any detectable abnormality. Solid tissue masses either limited to a small part or to the whole ovary and with or without ascites were observed in 14 hens and classified as hens with early-stage OVCA (Figure 1B). In 17 hens, the tumor had metastasized to abdominal organs with moderate to profuse ascites and classified as hens with late-stage OVCA (Figure 1, C and D).

Figure 1.

Figure 1

Gross morphology of normal ovaries and ovaries with tumor in laying hens. (A) Normal ovary: A normal laying hen ovary contained a hierarchy of multiple large preovulatory follicles (F1–F3) with an active oviduct. (B) OVCA at early stage in a laying hen. The tumor mass was limited to the ovary (shown in a dotted circle). (C and D) OVCAs at late stages in laying hens. Tumors were metastasized to distant organs including intestine (C) and liver (D, arrows indicate the examples of tumor seeding) with accompanied profuse ascites (*).

Histopathology. A total of 105 hens were found to have normal ovaries in which embedded primordial and primary follicles were observed in the ovarian stromal tissue (Figure 2A). Ovarian tumors were confirmed by routine histology in 31 hens that had solid masses limited to the ovaries (n = 14, early stage) or metastasized to other organs (n = 17, late stage). In addition, microscopic OVCAs were detected in 12 hens without any grossly detectable solid mass in the ovary and grouped in early-stage OVCA. Thus, a total of 26 (14 + 12) hens had early and 17 had late-stage OVCA. Tumors were typed (Figure 2, B–D)asserous(n = 18), endometrioid (n =13), mucinous (n =10), as well as mixed (n = 2, seromucinous and endoserous) as reported previously [22].

Figure 2.

Figure 2

Histologic presentation of different types of malignant ovarian tumors in laying hens detected in the present study. Formalin-fixed paraffin-embedded ovarian tissues were stained for hematoxylin and eosin. (A) A section of a normal ovary showing a follicle embedded in the ovarian stroma. (B) A section of an ovarian serous carcinoma-containing tumor cells with large pleomorphic nucleus and mitotic nuclear bodies. (C) A section of an ovarian endometrioid carcinoma showing confluent back-to-back tumor glands containing a single layer of epithelium with sharp luminal margin. (D) A section of an ovarian mucinous carcinoma. The tumor contained a single layer of columnar epithelium with intercalated ciliated goblet cells. Mucin-like secretion is seen in the lumen of the tumor gland (*). Original magnifications: x40. F indicates follicle; S, stroma; Tu, tumor.

Tissue Expression of ILT3

Immunohistochemical detection of ovarian ILT3 expression. T-lymphocyte-like rounded cells and macrophage-like irregular-shaped cells in the stroma of normal ovaries or ovaries with tumor were found positive for ILT3. Some surface epithelial cells (not all) above the developing cortical follicles in normal ovaries and the epithelium of the ovarian tumors were also stained positive for ILT3 expression (Figure 3, A–-D). The expression of ILT3 by the epithelial cells of the tumor in hens with OVCA varied with respect to the histologic subtypes of tumors and their stages. As compared with normal hens (mean ± SD = 23029.23 ± 2725.01), the intensities of ILT3 expression were significantly higher (P < .001) in hens with early-stage OVCA irrespective of their histologic subtypes (Figure 4). Similar patterns were also observed for hens with late-stage OVCA.

Figure 3.

Figure 3

Expression of ILT3 by normal ovaries or ovaries with tumor in laying hens. (A) A section of normal ovary showing ILT3+ OSE cells (examples are shown by arrows) near a developing follicle. An immune cell-like ILT3+ cell is seen beneath the ovarian surface (arrowhead). (B–D) Expression of ILT3 by the epithelium of the ovarian serous (B), endometrioid (C), and mucinous (D) carcinomas at late stages in laying hens. Intense staining for ILT3 by epithelial cells of the tumors was observed in all tumor types. F indicates follicle; G, granulosa layer; T, theca layer; TS, tumor stroma.

Figure 4.

Figure 4

Changes in the ovarian ILT3 expression are associated with ovarian tumor development and progression. The intensity of ILT3 staining is expressed as pixel values (mean ± SD) in a 20,000-µm2 area of the ovarian stroma in normal ovaries or ovaries with tumor. Compared with normal hens, the intensities of the ILT3 staining were significantly greater in hens with early-stage OVCA (P < .001) and increased further in hens with late-stage OVCA irrespective of their tumor types. The intensity of ILT3 staining was significantly lower (P < .03) in hens with endometrioid OVCA than hens with serous OVCA. Significant differences were not observed in the intensity of ILT3 staining between the hens with serous and mucinous OVCA irrespective of their stages. Bars with different letters within the same group indicate significant differences in ILT3 staining intensity.

Among different histologic subtypes at early-stage OVCA, the intensities of ILT3 staining were lowest in hens with ovarian endometrioid tumors (mean ± SD = 36,807.56 ± 2843.56) followed by mucinous (40,207.86 ± 2858.27) and highest in serous OVCA (40,924.40 ± 1400.26) in a 20,000-µm2 area of tissue (Figure 4). The differences in ILT3 staining intensities were significantly higher in hens with serous OVCA than hens with endometrioid OVCA irrespective of their stages (P < .028 and .025 for early and late stages of OVCA, respectively). However, significant differences in ILT3 staining intensities were not observed between the hens with ovarian endometrioid and mucinous OVCA as well as mucinous and serous OVCA at early and late stages. In hens with serous OVCA, the intensities of ILT3 staining were significantly high in late stages than in early stage (P < .05). However, a significant difference in ILT3 staining intensities between the early and late stages of hens with ovarian endometrioid or mucinous OVCA was not observed.

Immunoblot analysis for ILT3 protein in ovarian tissues and serum samples. Immunohistochemical observation of ILT3 expression was confirmed by immunoblot analysis using homogenates of normal ovaries and ovaries with tumors as well as OSE from normal ovaries and ovarian tumors. As expected, immunoreactive ILT3 protein with a band size of approximately 55 kDa was detected in the homogenates of OSE and ovarian tissues from normal hens and hens with OVCA at early stage (Figure 5A). Similar patterns were also observed for serum samples (data not shown). Compared with the normal OSE or OSE from ovarian tumors at early stage, ILT3 protein expression was stronger in the OSE from hens at late-stage OVCA (Figure 5A). Conversely, the expression of immunoreactive ILT3 proteins was weaker in the homogenates of ovarian endometrioid tumors, moderate in mucinous, and stronger in ovarian serous tumors at the early stage (Figure 5A). Similar patterns were also observed for ovarian tumors at late stage (data not shown). These results confirm the immunohistochemical observation that epithelial cells of ovarian tumors in hens express ILT3.

Figure 5.

Figure 5

Examples of immunoreactive ILT3 protein (A) or mRNA (B) expression in the homogenates of OSE and ovaries from normal hens or hens with OVCA by one-dimensional Western blot (WB) analysis and semiquantitative PCR, respectively. One-dimensional WB (A): Immunoreactive ILT3 protein of approximately 55-kDa molecular weight was detected in the 1) OSE extract from normal or ovarian tumors and 2) homogenates from different histologic subtypes of ovarian tumors at early stage of OVCA. Compared with the normal OSE or OSE from ovarian tumors at early stage, ILT3 protein expression was stronger in the OSE from hens at late-stage OVCA. Serous ovarian tumors at the early stage showed strong ILT3 staining followed by mucinous and endometrioid tumors. No ILT3 expression was detected in negative control in which protein sample was omitted. RT-PCR (B): mRNA expression by the OSE extract from normal or ovarian tumor and from different histologic subtypes of ovarian tumors at early and late stages of OVCA. Compared to the normal OSE, or OSE from ovarian tumor at early stage, a strong expression of ILT3 mRNA was observed in the OSE from hens with late-stage OVCA. Similarly, strong expression patterns were also observed for the homogenates of ovarian tumors at late stages than early stages irrespective of tumor subtypes. As observed in immunohistochemistry and immunoblot analysis, endometrioid tumors at early stage were weaker in ILT3 mRNA expression than their counterpart serous and mucinous tumors. No ILT3 mRNA expression was detected in the negative control in which mRNA sample was omitted.

Expression of ILT3 mRNA. Observed variations in ILT3 protein expression among different histologic subtypes of OVCA and their stages were confirmed by ILT3 mRNA expression. Hens with early serous and mucinous ovarian tumors showed strong amplification signal for ILT3, whereas its amplification was low for endometrioid ovarian tumors. However, no differences were observed for ILT3 mRNA expression by different histologic subtypes of late-stage OVCA (Figure 5B). Similar patterns were also observed for the epithelial cells of ovarian tumors. Thus, the results of gene expression study confirm the immunohistochemical and immunoblot analysis observations that the epithelium of ovarian tumors expresses ILT3 proteins.

Discussion

This is the first report on the expression of ILT3 by the epithelium of ovarian tumors in laying hens, an animal model of spontaneous OVCA. This study showed that the expression of ILT3 increases significantly in association with ovarian tumor development and progression. These results suggest that laying hens can be used to generate information on the mechanism of spontaneous ovarian tumor-associated immunosuppression and may lead to the development of antitumor immunotherapies and the testing of their efficacies.

Recent progresses in the understanding of tumor-immune interactions have led to the successful development of a number of immunotherapeutic approaches. However, tumor escape from immune recognition is a significant barrier to the success of these immunotherapies. Although the process of escaping immune surveillance by tumors or suppression of antitumor immune response is not well understood, tumor cells, immune cells, and other stromal cells in the tumor surroundings have been reported to interact and create an immunosuppressive micro-environment through a variety of immunosuppressive factors [30]. Enhanced expression of ILT3 by few members of the immune system has been suggested as one of such immunosuppressive factors in the tumor microenvironment [31]. In the present study, in addition to immune cell-like cells, the epithelium of the ovarian tumors in laying hens also expressed ILT3. Under normal physiological condition, ILT3 has been reported to be expressed selectively by professional antigen-presenting cells including monocytes, macrophages, and dendritic cells [32]. The expression of ILT3 on exposure to alloantigen-specific suppressor T cells or cytokines by nonprofessional antigen-presenting cells, like endothelial cells as well as tumor cells from chronic lymphocytic leukemia, was also reported previously [33,34]. Thus, the present results suggest that ovarian tumors also express immunosuppressive ILT3 as reported for few other cancers.

In the present study, compared with normal hens, the intensity of the ILT3 expression was significantly high in hens with early-stage OVCA and increased further as the disease progressed to late stages, suggesting that changes in ILT3 expression may be associated with ovarian tumor development and progression. The presence of active antitumor immune responses against ovarian tumors at the early stage has been reported earlier [9]. However, despite the presence of an antitumor immune response, OVCAs in most cases, progress to late stages. Although the precise mechanisms of such immune escaping are not known, our results suggest that the enhanced expression of immune inhibitory receptor ILT3 by the ovarian tumors may contribute to the progression of OVCA.

The results of the present study suggest that the expression pattern of ILT3 varies with the different histologic subtypes of ovarian tumors. Significantly high ILT3 staining intensity was observed in serous compared with endometrioid ovarian tumors at early as well as late stages of OVCA. The specific reasons for higher ILT3 expression by serous OVCA are not known. It is possible that higher ILT3 expression will contribute to the faster progression of OVCA by imparting higher immune tolerance to tumors. Serous malignant ovarian tumors are considered aggressive tumors, and increased ILT3 expression may contribute to their faster progression. Similar observations in cancers of other organs were also reported previously [31,34]. Thus, it is possible that ILT3 will contribute to ovarian tumor progression by suppressing antitumor immunity.

In the present study, a portion of the epithelial cells of the normal ovarian surface epithelium above the cortical developing follicles (not all epithelial cells) were positive for ILT3 expression albeit with lower intensity than the epithelium of ovarian tumors. Although the precise reason(s) for such expression is not known, it is possible that ILT3 expressed by surface epithelial cells near cortical follicles will protect them from immune cells by suppression of local antifollicular autoimmune response. Various structures in the developing follicles including the perivitelline membrane, granulosa and theca layers, as well as the degenerated cellular components of postovulatory follicles may appear as “foreign” to the circulating immune cells because these structures were not present during the evolution and maturation of the immune system.

Our understanding regarding the biology and the role of ILT3 in the context of OVCA is very limited, in part, because of the lack of an animal model that develops spontaneous OVCA. Because of the difficulty of detecting OVCA at an early stage, access to patient specimens to study and develop an effective antitumor immunotherapy is difficult and time consuming. Similarities between the spontaneous OVCA in humans and hens in histologic subtypes, risk factors (e.g., incessant ovulation), and expression of several molecular makers of OVCA represent a high probability that results obtained from this study may be translated to clinics. Furthermore, one of the most important advantages of this animal model relative to the possibilities of translating current findings to OVCA in humans is the ability to monitor hens by contrast enhanced ultrasound imaging using equipment and mechanical setting similar to those used in clinics [25,26]. Thus, there will be less variation in imaging parameters between hens and humans because of the use of similar equipment. With the advancement in in vivo imaging technology, ligands that bind to the epithelial cells of the ovarian tumor are being developed to use as antitumor therapies, and their effectiveness in tumor ablation can be monitored in this animal model using contrast-enhanced ultrasound scanning [35]. Because the epithelial cells of the tumor in OVCA hens express ILT3, laying hens may be used to test the efficacy of anti-ILT3 drug by molecular-targeted ultrasound imaging of ovarian tissues. Thus, it will bring a significant change in the development of tumor specific therapeutics specially immunoenhancing drugs and lead to the development of treatment modalities for OVCA patients. Taken together, information on ILT3 expression and its association with OVCA progression will aid in the development of anti-ILT3 immunotherapies, which will lay the foundation for clinical studies and may ultimately lead to the development of effective therapies for the treatment of OVCA.

Acknowledgments

The authors thank Chet and Pam Utterback and Doug Hilgendorf, staff of the University of Illinois at Urbana-Champaign Poultry Research Farm, for maintenance of the hens. The authors also thank Sergio Abreu Machado and Syed Tahir Abbas Shah, graduate students, Department of Animal Sciences, University of Illinois at Urbana-Champaign, for helping in hen tissue collection.

Footnotes

1

This study was supported by the Idea Development Award from the United States Department of Defense (OCno. 093303), National Cancer Institute Pacific Ovarian Cancer Research Consortium Career Development Program grant P50 CA83636, and the Elmer Sylvia and Sramek Foundation (USA). The authors declare no conflict of interest.

References

  • 1.Jemal A, Siegel R, Xu J, Ward E. Cancer statistics, 2010. CA Cancer J Clin. 2010;60:277–300. doi: 10.3322/caac.20073. [DOI] [PubMed] [Google Scholar]
  • 2.Goodman MT, Correa CN, Tung KH, Roffers SD, Cheng Wu X, Young JL, Jr, Wilkens LR, Carney ME, Howe HL. Stage at diagnosis of ovarian cancer in the United States, 1992–1997. Cancer. 2003;97:2648–2659. doi: 10.1002/cncr.11347. [DOI] [PubMed] [Google Scholar]
  • 3.Ries LA. Ovarian cancer. Survival and treatment differences by age. Cancer. 1993;71:524–529. doi: 10.1002/cncr.2820710206. [DOI] [PubMed] [Google Scholar]
  • 4.Zou W. Regulatory T cells, tumour immunity and immunotherapy. Nat Rev Immunol. 2006;6:295–307. doi: 10.1038/nri1806. [DOI] [PubMed] [Google Scholar]
  • 5.Beyer M, Schultze JL. Regulatory T cells in cancer. Blood. 2006;108:804–811. doi: 10.1182/blood-2006-02-002774. [DOI] [PubMed] [Google Scholar]
  • 6.Figdor CG, de Vries IJ, Lesterhuis WJ, Melief CJ. Dendritic cell immunotherapy: mapping the way. Nat Med. 2004;10:475–480. doi: 10.1038/nm1039. [DOI] [PubMed] [Google Scholar]
  • 7.Dougan M, Dranoff G. Immune therapy for cancer. Annu Rev Immunol. 2009;27:83–117. doi: 10.1146/annurev.immunol.021908.132544. [DOI] [PubMed] [Google Scholar]
  • 8.Shu S, Cochran AJ, Huang RR, Morton DL, Maecker HT. Immune responses in the draining lymph nodes against cancer: implications for immunotherapy. Cancer Metastasis Rev. 2006;25:233–242. doi: 10.1007/s10555-006-8503-7. [DOI] [PubMed] [Google Scholar]
  • 9.Yigit R, Massuger LF, Figdor CG, Torensma R. Ovarian cancer creates a suppressive microenvironment to escape immune elimination. Gynecol Oncol. 2010;117:366–372. doi: 10.1016/j.ygyno.2010.01.019. [DOI] [PubMed] [Google Scholar]
  • 10.Curiel TJ, Coukos G, Zou L, Alvarez X, Cheng P, Mottram P, Evdemon-Hogan M, Conejo-Garcia JR, Zhang L, Burow M, et al. Specific recruitment of regulatory T cells in ovarian carcinoma fosters immune privilege and predicts reduced survival. Nat Med. 2004;10:942–949. doi: 10.1038/nm1093. [DOI] [PubMed] [Google Scholar]
  • 11.Li MO, Wan YY, Sanjabi S, Robertson AK, Flavell RA. Transforming growth factor-β regulation of immune responses. Annu Rev Immunol. 2006;24:99–146. doi: 10.1146/annurev.immunol.24.021605.090737. [DOI] [PubMed] [Google Scholar]
  • 12.Kriegel MA, Li MO, Sanjabi S, Wan YY, Flavell RA. Transforming growth factor-β: recent advances on its role in immune tolerance. Curr Rheumatol Rep. 2006;8:138–144. doi: 10.1007/s11926-006-0054-y. [DOI] [PubMed] [Google Scholar]
  • 13.Liu Z, Guo B, Lopez RD. Expression of intercellular adhesion molecule (ICAM)-1 or ICAM-2 is critical in determining sensitivity of pancreatic cancer cells to cytolysis by human γδ-T cells: implications in the design of γδ-T-cell-based immunotherapies for pancreatic cancer. J Gastroenterol Hepatol. 2009;24:900–911. doi: 10.1111/j.1440-1746.2008.05668.x. [DOI] [PubMed] [Google Scholar]
  • 14.Roncarolo MG, Bacchetta R, Bordignon C, Narula S, Levings MK. Type 1 T regulatory cells. Immunol Rev. 2001;182:68–79. doi: 10.1034/j.1600-065x.2001.1820105.x. [DOI] [PubMed] [Google Scholar]
  • 15.Liu Z, Tugulea S, Cortesini R, Suciu Foca N. Specific suppression of T helper alloreactivity by allo MHC class I-restricted CD8+CD28- T cells. Int Immunol. 1998;10:775–783. doi: 10.1093/intimm/10.6.775. [DOI] [PubMed] [Google Scholar]
  • 16.Wei S, Kryczek I, Zou L, Daniel B, Cheng P, Mottram P, Curiel T, Lange A, Zou W. Plasmacytoid dendritic cells induce CD8+ regulatory T cells in human ovarian carcinoma. Cancer Res. 2005;65:5020–5026. doi: 10.1158/0008-5472.CAN-04-4043. [DOI] [PubMed] [Google Scholar]
  • 17.Kryczek I, Zou L, Rodriguez P, Zhu G, Wei S, Mottram P, Brumlik M, Cheng P, Curiel T, Myers L, et al. B7-H4 expression identifies a novel suppressive macrophage population in human ovarian carcinoma. J Exp Med. 2006;203:871–881. doi: 10.1084/jem.20050930. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Salazar-Onfray F. Interleukin-10: a cytokine used by tumors to escape immunosurveillance. Med Oncol. 1999;16:86–94. doi: 10.1007/BF02785841. [DOI] [PubMed] [Google Scholar]
  • 19.Suciu-Foca N, Feirt N, Zhang QY, Vlad G, Liu Z, Lin H, Chang CC, Ho EK, Colovai AI, Kaufman H, et al. Soluble Ig-like transcript 3 inhibits tumor allograft rejection in humanized SCID mice and T cell responses in cancer patients. J Immunol. 2007;178:7432–7441. doi: 10.4049/jimmunol.178.11.7432. [DOI] [PubMed] [Google Scholar]
  • 20.Kim-Schulze S, Scotto L, Vlad G, Piazza F, Lin H, Liu Z, Cortesini R, Suciu-Foca N. Recombinant Ig-like transcript 3-Fc modulates T cell responses via induction of Th anergy and differentiation of CD8+ T suppressor cells. J Immunol. 2006;176:2790–2798. doi: 10.4049/jimmunol.176.5.2790. [DOI] [PubMed] [Google Scholar]
  • 21.Rodriguez-Burford C, Barnes MN, Berry W, Partridge EE, Grizzle WE. Immunohistochemical expression of molecular markers in an avian model: a potential model for preclinical evaluation of agents for ovarian cancer chemoprevention. Gynecol Oncol. 2001;81:373–379. doi: 10.1006/gyno.2001.6191. [DOI] [PubMed] [Google Scholar]
  • 22.Barua A, Bitterman P, Abramowicz JS, Dirks AL, Bahr JM, Hales DB, Bradaric MJ, Edassery SL, Rotmensch J, Luborsky JL. Histopathology of ovarian tumors in laying hens: a preclinical model of human ovarian cancer. Int J Gynecol Cancer. 2009;19:531–539. doi: 10.1111/IGC.0b013e3181a41613. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Viertlboeck BC, Habermann FA, Schmitt R, Groenen MA, Du Pasquier L, Gobel TW. The chicken leukocyte receptor complex: a highly diverse multi-gene family encoding at least six structurally distinct receptor types. J Immunol. 2005;175:385–393. doi: 10.4049/jimmunol.175.1.385. [DOI] [PubMed] [Google Scholar]
  • 24.Dennis G, Jr, Kubagawa H, Cooper MD. Paired Ig-like receptor homologs in birds and mammals share a common ancestor with mammalian Fc receptors. Proc Natl Acad Sci USA. 2000;97:13245–13250. doi: 10.1073/pnas.230442897. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Barua A, Abramowicz JS, Bahr JM, Bitterman P, Dirks A, Holub KA, Sheiner E, Bradaric MJ, Edassery SL, Luborsky JL. Detection of ovarian tumors in chicken by sonography: a step toward early diagnosis in humans? J Ultrasound Med. 2007;26:909–919. doi: 10.7863/jum.2007.26.7.909. [DOI] [PubMed] [Google Scholar]
  • 26.Barua A, Bitterman P, Bahr JM, Bradaric MJ, Hales DB, Luborsky JL, Abramowicz JS. Detection of tumor-associated neoangiogenesis by Doppler ultrasonography during early-stage ovarian cancer in laying hens: a preclinical model of human spontaneous ovarian cancer. J Ultrasound Med. 2010;29:173–182. doi: 10.7863/jum.2010.29.2.173. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Giles JR, Olson LM, Johnson PA. Characterization of ovarian surface epithelial cells from the hen: a unique model for ovarian cancer. Exp Biol Med (Maywood) 2006;231:1718–1725. doi: 10.1177/153537020623101108. [DOI] [PubMed] [Google Scholar]
  • 28.Barua A, Edassery SL, Bitterman P, Abramowicz JS, Dirks AL, Bahr JM, Hales DB, Bradaric MJ, Luborsky JL. Prevalence of antitumor antibodies in laying hen model of human ovarian cancer. Int J Gynecol Cancer. 2009;19:500–507. doi: 10.1111/IGC.0b013e3181a39db1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Hong YH, Lillehoj HS, Lee SH, Dalloul RA, Lillehoj EP. Analysis of chicken cytokine and chemokine gene expression following Eimeria acervulina and Eimeria tenella infections. Vet Immunol Immunopathol. 2006;114:209–223. doi: 10.1016/j.vetimm.2006.07.007. [DOI] [PubMed] [Google Scholar]
  • 30.Poschke I, Mougiakakos D, Kiessling R. Camouflage and sabotage: tumor escape from the immune system. Cancer Immunol Immunother. 2011;60:1161–1171. doi: 10.1007/s00262-011-1012-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Vlad G, Chang CC, Colovai AI, Vasilescu ER, Cortesini R, Suciu-Foca N. Membrane and soluble ILT3 are critical to the generation of T suppressor cells and induction of immunological tolerance. Int Rev Immunol. 2010;29:119–132. doi: 10.3109/08830180903281185. [DOI] [PubMed] [Google Scholar]
  • 32.Cella M, Dohring C, Samaridis J, Dessing M, Brockhaus M, Lanzavecchia A, Colonna M. A novel inhibitory receptor (ILT3) expressed on monocytes, macrophages, and dendritic cells involved in antigen processing. J Exp Med. 1997;185:1743–1751. doi: 10.1084/jem.185.10.1743. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Manavalan JS, Kim-Schulze S, Scotto L, Naiyer AJ, Vlad G, Colombo PC, Marboe C, Mancini D, Cortesini R, Suciu-Foca N. Alloantigen specific CD8+CD28- FOXP3+ T suppressor cells induce ILT3+ ILT4+ tolerogenic endothelial cells, inhibiting alloreactivity. Int Immunol. 2004;16:1055–1068. doi: 10.1093/intimm/dxh107. [DOI] [PubMed] [Google Scholar]
  • 34.Colovai AI, Tsao L, Wang S, Lin H, Wang C, Seki T, Fisher JG, Menes M, Bhagat G, Alobeid B, et al. Expression of inhibitory receptor ILT3 on neoplastic B cells is associated with lymphoid tissue involvement in chronic lymphocytic leukemia. Cytometry B Clin Cytom. 2007;72:354–362. doi: 10.1002/cyto.b.20164. [DOI] [PubMed] [Google Scholar]
  • 35.Barua A, Bitterman P, Bahr JM, Basu S, Sheiner E, Bradaric MJ, Hales DB, Luborsky JL, Abramowicz JS. Contrast-enhanced sonography depicts spontaneous ovarian cancer at early stages in a preclinical animal model. J Ultrasound Med. 2011;30:333–345. doi: 10.7863/jum.2011.30.3.333. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Translational Oncology are provided here courtesy of Neoplasia Press

RESOURCES