Skip to main content
Proceedings of the National Academy of Sciences of the United States of America logoLink to Proceedings of the National Academy of Sciences of the United States of America
. 2012 Mar 13;109(13):5110–5115. doi: 10.1073/pnas.1119623109

Tomato immune receptor Ve1 recognizes effector of multiple fungal pathogens uncovered by genome and RNA sequencing

Ronnie de Jonge a,1, H Peter van Esse a,1, Karunakaran Maruthachalam b, Melvin D Bolton c, Parthasarathy Santhanam a, Mojtaba Keykha Saber a, Zhao Zhang a, Toshiyuki Usami d, Bart Lievens e,f, Krishna V Subbarao b, Bart P H J Thomma a,g,2
PMCID: PMC3323992  PMID: 22416119

Abstract

Fungal plant pathogens secrete effector molecules to establish disease on their hosts, and plants in turn use immune receptors to try to intercept these effectors. The tomato immune receptor Ve1 governs resistance to race 1 strains of the soil-borne vascular wilt fungi Verticillium dahliae and Verticillium albo-atrum, but the corresponding Verticillium effector remained unknown thus far. By high-throughput population genome sequencing, a single 50-Kb sequence stretch was identified that only occurs in race 1 strains, and subsequent transcriptome sequencing of Verticillium-infected Nicotiana benthamiana plants revealed only a single highly expressed ORF in this region, designated Ave1 (for Avirulence on Ve1 tomato). Functional analyses confirmed that Ave1 activates Ve1-mediated resistance and demonstrated that Ave1 markedly contributes to fungal virulence, not only on tomato but also on Arabidopsis. Interestingly, Ave1 is homologous to a widespread family of plant natriuretic peptides. Besides plants, homologous proteins were only found in the bacterial plant pathogen Xanthomonas axonopodis and the plant pathogenic fungi Colletotrichum higginsianum, Cercospora beticola, and Fusarium oxysporum f. sp. lycopersici. The distribution of Ave1 homologs, coincident with the presence of Ave1 within a flexible genomic region, strongly suggests that Verticillium acquired Ave1 from plants through horizontal gene transfer. Remarkably, by transient expression we show that also the Ave1 homologs from F. oxysporum and C. beticola can activate Ve1-mediated resistance. In line with this observation, Ve1 was found to mediate resistance toward F. oxysporum in tomato, showing that this immune receptor is involved in resistance against multiple fungal pathogens.

Keywords: fungus, genomics, elicitor, pathogen-associated molecular pattern


Throughout evolution, pathogenicity toward plant hosts independently emerged on multiple occasions in diverse taxa harboring plant-associated microbes, including bacteria, oomycetes, and fungi (1). At the same time, plant genomes evolved to encode immune receptors that sense various types of microbial invaders by detection of microbial molecules or their plant-manipulating activities (2–4). Cell-surface receptors, referred to as “pattern recognition receptors” (PRR), detect conserved microbial molecules, referred to as “microbe-associated molecular patterns” (MAMPs), to activate MAMP-triggered immunity (MTI). Successful plant pathogens overcome MTI by the use of secreted effectors, many of which have molecular targets inside host cells, which perturb host defenses in a proactive manner (4, 5). In turn, plants evolved to intercept the activity of particular pathogen effectors through novel receptors that are generally referred to as “resistance proteins.” Although some of these resistance proteins have been characterized as cell-surface receptors, most of them are cytoplasmic proteins of the nucleotide-binding leucine-rich repeat type that again activate inducible host defenses, referred to as “effector-triggered immunity” (ETI) (4, 6). Nevertheless, the delineation between MAMPs and effectors, as well as between MTI and ETI, is blurred and rather a continuum (3).

The acquisition of particular effector genes in microbial genomes has resulted in emergence of pathogenicity, or in host-range expansion (7–9). Novel effectors can be acquired in various ways, including gene duplication and subsequent diversification. Expansion of effector families is especially striking in plant pathogenic oomycete species that harbor large repertoires of RXLR and Crinkler effectors (9–11). Substantial expansion of effector gene families has also been observed in the genomes of the fungal plant pathogens Ustilago maydis and Blumeria graminis (12–14). Interestingly, effector genes are frequently found in regions that are enriched for transposable elements that may provide a mechanism for amplification and diversification of effectors in pathogen genomes (9, 14, 15).

Novel effectors can also be acquired through horizontal gene transfer (HGT), which involves the transmission of genetic material across species boundaries. The extent to which HGT contributes to genome evolution in eukaryotes is not clear, but multiple reports have proposed that HGT occurred regularly among eukaryotic plant pathogens (8, 16–18). Moreover, recent evidence for frequent HGT events between fungi and oomycetes suggests that HGT facilitated the evolution of plant parasitism in oomycetes (17).

Verticillium dahliae is an asexual soil-borne, xylem-invading, fungal plant pathogen that is responsible for vascular wilt diseases in over 200 dicotyledonous plant species, including economically important crops, such as tomato (19, 20). A typical infection starts by penetration of the root, after which the fungus enters the xylem and starts to produce conidia that are carried with xylem to distal plant parts (19). In only a few plant species, monogenic sources of resistance toward Verticillium wilt have been described, including the Ve locus from tomato that controls race 1 V. dahliae and Verticillium albo-atrum strains (21–24). The resistance is mediated by the Ve1 gene that encodes a predicted receptor-like protein-type cell-surface receptor (23, 25). Strains that are not contained by the Ve locus are assigned to race 2 and are generally less aggressive on tomato plants that lack Ve1 compared with race 1 strains (26, 27). This finding suggests that Ve1 recognizes a virulence factor in race 1 strains that is absent in race 2 strains.

Various methods have been used to identify pathogen effectors that activate host immune receptors. Whereas in sexually propagating fungi genetic mapping can be used, in asexual fungi most approaches are based on functional screens for a hypersensitive response (HR): tissue necrosis as culmination of a strong immune reaction (28–30). So far, attempts to identify the V. dahliae effector that triggers Ve1-mediated resistance have been unsuccessful. In this study, we performed a unique comparative population genomics approach, by applying high-throughput population genome sequencing, to identify the V. dahliae effector that activates tomato Ve1.

Results

Comparative Population Genomics Identifies Verticillium Effector Ave1.

Recently, the genome of the V. dahliae race 2 strain VdLs17 was sequenced using Sanger technology and determined to be ∼34 Mb, with ∼10,500 predicted genes (31). In this study, we determined the genome sequences of 10 V. dahliae strains, four of which belonged to race 1 and six to race 2. For each strain, ∼11 million paired-end Illumina reads, representing a predicted 30× genome coverage based on the VdLs17 reference genome sequence, were de novo assembled into draft genomes of ∼34 Mb (Table 1). The completeness of the genomes was assessed by the core eukaryotic gene-mapping approach (32). We subsequently aligned race 1 scaffold and contig sequences with all race 2 sequences, including the VdLs17 reference genome, and all unaligned race 1 sequences were retained. This process revealed a small number of race 1 scaffolds that were larger than 1 Kb and that did not align to race 2 sequences. Further comparisons between the race 1-specific sequences revealed a single 50-Kb region that was shared by all race 1 strains (Fig. 1) and that contains 68 predicted ORFs (>180 nucleotides), including 10 that encode putative secreted effectors.

Table 1.

Assembly statistics of V. dahliae genome sequences

Strain Origin Race Assembly size (Mb) Scaffold N50 (Kb) No. of scaffolds % CEGMA partial (complete)*
JR2 Tomato 1 35.1 59.4 4,753 95.2 (87, 5)
St14.01 Pistachio 1 34.7 65.9 3,684 95.6 (89, 9)
CBS381.66 Tomato 1 34.5 48.3 4,411 94.0 (87, 1)
VdLs16 Lettuce 1 34.9 68.0 3,469 96.4 (92, 3)
DVD-3 Potato 2 34.1 43.9 9,318 91.5 (81, 0)
DVD-31 Tomato 2 34.0 36.9 4,513 93.6 (86, 3)
DVD-161 Potato 2 34.1 42.4 4,078 94.0 (86, 7)
DVD-S26 Soil 2 35.3 47.1 5,361 94.4 (87, 9)
DVD-S29 Soil 2 34.1 49.2 3,712 92.7 (86, 3)
DVD-S94 Soil 2 35.0 57.4 4,073 95.6 (89, 1)
VdLs17 Lettuce 2 33.8 1,270 52 97.6 (94, 8)

*Percentage of partial and complete gene models determined by the Core Eukaryotic Genes Mapping Approach (CEGMA).

Fig. 1.

Fig. 1.

Verticillium comparative population genomics and transcriptome sequencing identifies race 1-specific effector Ave1. Alignment of race 1 (blue) and race 2 (red) contigs outlining a 50-Kb race 1-specific region comprising 68 ORFs >180 nucleotides. RNA sequencing reads mapped only to the Ave1 locus, identifying two exons split by a 55 bp 5′ UTR intron. The Ave1 gene model was confirmed by RACE PCR.

To validate the bioinformatic ORF prediction in the 50-Kb race 1-specific region, deep RNA sequencing was performed on a time course of Nicotiana benthamiana plants infected by race 1 strain JR2 (Table S1). For each sample, ∼25 million paired-end reads were mapped onto the JR2 genome. Although over 8,000 V. dahliae genes were expressed, reads mapped only to a single locus in the 50-Kb race 1-specific region that was called Ave1, for Avirulence on Ve1 tomato. RACE PCR experiments confirmed that the Ave1 gene model spans 582 bp and comprises two exons that are interrupted by an intron in the 5′ UTR (Fig. 1 and Fig S1A). Ave1 encodes a predicted 134 aa secreted (D > 0.8) protein, and based on the RNA-Seq reads it was determined that Ave1 expression is induced during host colonization, a characteristic of typical effector proteins (Fig. S1B) (5, 33).

Verticillium Ave1 Is a Virulence Factor That Activates Ve1-Mediated Resistance.

We subsequently performed functional analyses to prove that Ave1 is the V. dahliae effector that is recognized by tomato Ve1. First, heterologous expression of Ave1 using Potato Virus X resulted in a HR only on Ve1 tomato (Fig. S2). This recognition was confirmed by Agrobacterium tumefaciens mediated transient expression assays in Nicotiana tabacum, showing that coexpression of Ave1 with Ve1, but not with Ve2, resulted in HR (Fig. 2A). We subsequently performed genetic deletion and complementation experiments in V. dahliae to confirm the role of Ave1 in activating disease resistance. As expected, targeted deletion of Ave1 in race 1 V. dahliae strain JR2 resulted in gain of virulence on Ve1 tomato (Fig. 3A), but subsequent complementation of the deletion strains using a genomic fragment including 1.5 Kb up- and downstream of the Ave1 coding sequence (pAve1::Ave1) restored avirulence on Ve1 tomato (Fig. S3A). In addition, complementation of the V. dahliae race 2 strains VdLs17 and Dvd-S26 with pAve1::Ave1 resulted in loss of virulence on these plants (Fig. 3B). Collectively, these experiments provide solid evidence for a role of Ave1 as elicitor of disease resistance mediated by the Ve1 immune receptor in tomato.

Fig. 2.

Fig. 2.

Coexpression of Ave1 and Ve1 in N. tabacum activates a hypersensitive response. (A) V. dahliae Ave1 was transiently coexpressed with tomato Ve1 and Ve2 in N. tabacum. As a negative control, Ve1, Ve2, and Ave1 were expressed separately. (B) Ave1 homologs of V. dahliae (VdAve1), F. oxysporum f. sp. lycopersici (FoAve1), C. higginsianum (ChAve1), C. beticola (CbAve1), and tomato (SlAve1) were coexpressed with tomato Ve1 in N. tabacum. As a negative control, Ave1 homologs were expressed separately. Leaves were photographed at 5 d after infiltration to visualize cell death resulting from recognition by Ve1.

Fig. 3.

Fig. 3.

V. dahliae Ave1 activates the tomato immune receptor Ve1 and enhances virulence on susceptible tomato. (A) (Upper) Ave1 deletion strains escape recognition by Ve1 tomato compared with wild-type (WT) and ectopic transformant (EC) evidenced by stunted Ve1 plants at 14 days postinoculation and fungal outgrowth upon plating of stem sections. (Lower) Ave1 deletion strains show compromised virulence on tomato lacking Ve1. Pictures for two independent Ave1 deletion strains are shown. (B) (Upper) Ave1 expression in race 2 V. dahliae (pAve1::Ave1) results in recognition by Ve1 tomato at 14 d postinoculation. (Lower) Race 2 pAve1::Ave1 transformants show enhanced virulence on tomato lacking Ve1. Pictures for two independent Ave1-transgenic strains are shown.

According to the paradigm that plant immune receptors intercept pathogen virulence factors, it was expected that Ave1 acts as a virulence factor on tomato plants lacking Ve1. To test this hypothesis, Ave1 deletion strains were inoculated on ve1 tomato plants, showing that Ave1 deletion strains displayed markedly reduced aggressiveness on tomato plants lacking Ve1 (Fig. 3A and Fig. S3A). Compared with the wild-type fungus, inoculation with Ave1 deletion strains resulted in reduced stunting and fungal colonization (Fig. S3B). Conversely, complementation of race 2 strains and Ave1 deletion strains with pAve1::Ave1 resulted in significantly increased virulence on tomato plants lacking Ve1 (Fig. 3B and Fig. S3A).

We have recently shown that Ve1 remains fully functional after interfamily transfer to the Brassicaceous model plant Arabidopsis thaliana, as Ve1-transgenic Arabidopsis is resistant to race 1 but not to race 2 strains of V. dahliae and V. albo-atrum (24). To confirm that Ave1 activates Ve1-mediated resistance in Arabidopsis, we inoculated the Ave1 deletion strains along with the corresponding wild-type race 1 V. dahliae on wild-type and Ve1-transgenic Arabidopsis plants (Fig. S4A). Whereas Ve1-expressing Arabidopsis were resistant to the wild-type race 1 strain, resistance was broken using Ave1 deletion strains. As expected, resistance was restored by complementation of the Ave1 deletion strains with pAve1::Ave1. Our results confirm that in Arabidopsis, similar to tomato, Ve1-mediated race 1 resistance is activated by Ave1 (Fig. S4A). Interestingly, complementation with pAve1::Ave1 enhanced the virulence of a race 2 strain on Arabidopsis plants, demonstrated by a significant increase in fungal colonization, suggesting that Ave1 acts as a virulence factor also on Arabidopsis (Fig. S4B).

Absence of Ave1 Allelic Variation in a Collection of Verticillium Strains.

To analyze Ave1 diversity, we sequenced 85 alleles from Verticillium strains isolated from various host plants and different geographical locations (Table S2). Intriguingly, no SNP was found in the 85 Ave1 alleles tested. Interestingly, an Ave1 allele was amplified from the sequenced V. albo-atrum strain VaMs102 (31) that, based on BLAST analysis, was thought not to contain Ave1. Likely, Ave1 is lacking in the genome assembly as a consequence of the low coverage of sequencing (31). The finding that V. albo-atrum Ave1 alleles are identical is remarkable as V. dahliae and V. albo-atrum share only 92% nucleotide sequence identity, with only 0.3% identical genes (31). As expected, Ave1 alleles were not identified in any of the 19 Verticillium race 2 strains analyzed nor in the 32 V. dahliae and 3 V. albo-atrum strains that are not pathogenic on tomato (Table S2).

Gene Distribution Strongly Suggests that Ave1 Was Horizontally Acquired from Plants.

Interestingly, not a single fungal homolog of V. dahliae Ave1 was identified in BLASTp analysis. Remarkably, however, over 200 Ave1 homologs were identified in plants. In addition, an Ave1 homolog has previously been identified as the virulence factor XacPNP in the plant pathogenic bacterium Xanthomonas axonopodis pv. citri, causal agent of citrus canker (34). Further in-depth analysis with tBLASTn revealed an unannotated Ave1 homolog in the genome of the tomato pathogenic, xylem-invading fungus Fusarium oxysporum f. sp. lycopersici, designated FoAve1, and two homologs in the genomes of the fungal pathogens Colletotrichum higginsianum and Cercospora beticola, designated ChAve1 and CbAve1, respectively. To assess the evolutionary relationships between the various Ave1 homologs, V. dahliae Ave1 (VdAve1) was aligned with FoAve1, ChAve1, CbAve1, XacPNP, and the 50 most homologous plant proteins (Fig. S5). Phylogenetic analysis applying maximum likelihood indicated that VdAve1 shares common ancestry with ChAve1, CbAve1, and five closely related plant proteins from the taxonomically diverse species grape (Vitis vinifera), castor bean (Ricinus communis), and tomato (Solanum lycopersicum), as well as with XacPNP, although the latter protein is significantly divergent (Fig. 4). FoAve1 clusters in a distinct clade that contains 11 proteins from poplar (Populus trichocarpa), soybean (Glycine max), grape, and castor bean (Fig. 4). All proteins share four cysteine residues that are likely involved in disulphide bridges that contribute to protein stability upon secretion (Fig. S5).

Fig. 4.

Fig. 4.

Evolutionary relationship of Ave1 homologs from V. dahliae (VdAve1), C. higginsianum (ChAve1), C. beticola (CbAve1), F. oxysporum f. sp. lycopersici (FoAve1), X. axonopodis (XacPNP) (indicated by arrows), and 50 related plant-derived proteins, determined using maximum-likelihood analyses. Branch lengths are proportional to phylogenetic distances, and the result of the approximate likelihood ratio test is given at the nodes to indicate branch support.

It has previously been suggested that X. axonopodis pv. citri acquired XacPNP from plants by horizontal gene transfer (34). The abundance of Ave1 orthologs in plants, combined with the absence of orthologous sequences in fungi other than F. oxysporum f. sp. lycopersici, C. higginsianum, and C. beticola similarly suggests that Verticillium horizontally acquired Ave1 from plants. Robust phylogenetic analysis reveals evolutionary relationships between Ave1 homologs that contradict species phylogeny, which is generally considered as evidence for HGT (17, 18) (Fig. 4 and Fig. S5). Additional evidence for HGT can be found in the genomic context of Ave1. The recent genome comparison between V. dahliae strain VdLs17 and the highly homologous V. albo-atrum strain VaMs102 revealed four lineage-specific regions (LS1–LS4) that are absent in VaMs102 (31). These regions are highly enriched in transposable elements, supporting their plasticity (31). Interestingly, the race 1-specific region harboring Ave1 is physically associated with LS3 (Fig. S6A) and is characterized by a Ty1-copia retro-transposon immediately adjacent to Ave1 and variability in GC content (Fig. S6A).

FoAve1 is located on chromosome 14 of the F. oxysporum f. sp. lycopersici genome, a lineage-specific chromosome that is proposed to be responsible for pathogenicity toward tomato (35). Various transposable elements flank FoAve1 (Fig. S6B).

FoAve1 Is Restricted to F. oxysporum f. sp. lycopersici.

F. oxysporum as a species includes morphologically indistinguishable pathogenic as well as nonpathogenic strains. Despite the broad host range of the species, individual strains typically infect only a single or a few plant species and are assigned to formae speciales based on host specificity (35, 36). To investigate whether Ave1 is restricted to the formae specialis lycopersici, we assessed the presence of FoAve1 in other formae speciales of F. oxysporum. However, FoAve1 was exclusively detected in tomato pathogenic F. oxysporum f. sp. lycopersici strains (Table S2). We subsequently assessed the allelic variation of FoAve1. In 72 F. oxysporum f. sp. lycopersici strains tested FoAve1 was identified and determined to be identical.

Homologs of V. dahliae Ave1 Are Recognized by Ve1.

We have previously argued that the Ve1 receptor shares traits with MAMP receptors, such as CEBiP, CERK1, FLS2, and EFR (3, 24). The identification of Ave1 homologs in a number of fungal pathogens allowed testing this hypothesis. Intriguingly, A. tumefaciens mediated coexpression of Ve1 with FoAve1 and CbAve1, but not with ChAve1 in N. tabacum induced HR, demonstrating that tomato Ve1 recognizes Ave1 homologs from four distinct fungal pathogenic species; V. dahliae, V. albo-atrum, F. oxysporum, and C. beticola (Fig. 2B). Remarkably, coexpression of Ve1 with the Ave1 homolog from tomato, SlAve1, in N. tabacum also induced HR (Fig. 2B).

The finding that coexpression of Ve1 with the Ave1 homolog from the tomato pathogen F. oxysporum f. sp. lycopersici, FoAve1, induces HR allowed us to test whether Ve1 confers resistance also to this pathogen. Therefore, we inoculated nontransgenic MoneyMaker (LA2706) tomato plants, which lack resistance against V. dahliae and F. oxysporum, and Ve1 transgenes (21) with F. oxysporum f. sp. lycopersici (Fig. 5). A clear disease reduction was observed on Ve1 plants, demonstrating that Ve1 confers resistance to F. oxysporum f. sp. lycopersici.

Fig. 5.

Fig. 5.

Immune receptor Ve1 controls infection of F. oxysporum f. sp. lycopersici in tomato. Side view (Upper) and top view (Lower) of nontransgenic (MoneyMaker) and Ve1-transgenic (35S::Ve1) tomato plants at 13 d after mock-inoculation (mock) or inoculation with F. oxysporum f. sp. lycopersici (Fol).

Discussion

In tomato, resistance against race 1 strains of the vascular fungi V. dahliae and V. albo-atrum is mediated by the cell-surface receptor-like protein Ve1 (21). Unfortunately, traditional approaches used in the past to identify the Verticillium effector that activates Ve1-mediated resistance in tomato, including the biochemical characterization of protein fractions that induce necrosis in resistant plants (28–30) and heterologous in planta expression of pathogen cDNA libraries (37) were unsuccessful. In this study, we employed a unique approach to identify the avirulence protein that corresponds to Ve1, making use of high-throughput sequencing. To this end, we sequenced the genomes of multiple Verticillium race 1 and race 2 strains. Comparative analyses revealed only a single 50-Kb sequence stretch that was specifically present in race 1 strains, containing only a single ORF that was highly expressed in planta. Functional analysis of this locus, named Ave1, confirmed that it encodes the effector that is recognized by Ve1. Thus, our study shows that population genomics can be used as a powerful tool for the identification of novel avirulence components in complex fungal genomes.

Pathogen effectors are typically lineage-specific, meaning that generally no homologs occur in other species, and often not even in all strains of the same species (5). Thus, it was expected that homologs could not be found in other fungal species. Surprisingly, BLASTp analyses identified many Ave1 homologs in plants, several of which are annotated as expansin-like proteins that share a conserved family-45 endoglucanase (EG45-like) domain with cell wall-loosening expansins (38). Other Ave1 homologs are characterized as plant natriuretic peptides (PNPs) (39). Natriuretic peptides were originally identified in vertebrates where they have been implicated in the maintenance of osmotic and cardiovascular homeostasis (40). In plants, PNPs are mobile signaling molecules that are secreted in the apoplast, particularly under conditions of biotic and abiotic stress, and that play an important role in the regulation of water and ion homeostasis and consequently can affect many downstream processes, including photosynthesis (39, 41). Our analyses have shown that Ave1 acts as a potent virulence factor of Verticillium, not only in tomato plants that lack the Ve1 resistance protein, but also in Arabidopsis. Possibly, modulation of water and ion homeostasis by Ave1 increases the sap stream in the xylem, leading to accelerated host colonization. In addition to the many plant homologs, a homolog was identified in the citrus canker pathogen, X. axonopodis pv. citri, that was previously characterized as a bacterial virulence factor (34, 42). XacPNP is thought to mimic PNPs by manipulating the physiology of the host, including water homeostasis, stomatal opening, and photosynthesis to promote bacterial proliferation (42). The presence of numerous Ave1 orthologs in plants, absence of orthologs in fungi other than F. oxysporum f. sp. lycopersici, C. higginsianum, and C. beticola, and the association of Ave1 with a flexible genomic region containing various transposable elements in the genome, strongly suggest that Verticillium acquired Ave1 from plants through HGT. Despite similar ancestry of VdAve1, phylogenetic analysis of ChAve1, CbAve1, and XacPNP suggests that direct transfer between Verticillium, C. higginsianum, C. beticola, and X. axonopodis is unlikely because these plant pathogens infect different hosts, occupy distinct niches within these hosts, and are thus unlikely to encounter each other.

Eventually, in-depth analyses revealed unannotated Ave1 homologs in the genomes of the plant pathogenic fungi, F. oxysporum f. sp. lycopersici, C. higginsianum, and C. beticola. Verticillium spp., F. oxysporum and C. higginsianum belong to the Sordariomycetes, whereas C. beticola belongs to the Dothideomycetes. Both classes comprise many other plant pathogens with sequenced genomes such as the Sordariomycetes Fusarium graminearum, Fusarium solani, Fusarium verticillioides, Colletotrichum graminicola, and Magnaporthe oryzae and the Dothideomycetes Mycosphaerella gramincola and Leptosphaeria maculans (15, 35, 43–46). Ave1 is not found in these close relatives, nor was it detected in F. oxysporum formae speciales other than lycopersici. Interestingly, our phylogenetic analysis identified distinct origins for VdAve1, ChAve1, and CbAve1 on the one hand, and FoAve1 on the other hand, suggesting independent HGT events. Independence of the HGT events is further supported by different transposable elements flanking the Ave1 loci in Verticillium and Fusarium and the absence of Ave1 homologs in closely related fungi. Recently, a large phylogenomic analysis involving six plants species and 46 fungal species identified four plant-to-fungus HGTs, suggesting that genetic exchange between plants and fungi occurs more often than previously thought (16).

We have noted that Ve1 has traits of a PRR that acts in MAMP-triggered immunity (3, 24). This finding was based on the observation that Ve1 resistance affects two fungal species, V. dahliae and V. albo-atrum, involvement of the PRR coreceptor BAK1/SERK3 in Ve1 signaling, the relatively weak nature of Ve1-mediated resistance, the existence of Ve1 homologs in various plant families, and the transferability of Ve1 across plant families. Our present evidence showing that FoAve1 and CbAve1 are also recognized by Ve1, and that Ve1-expressing tomato is resistant to F. oxysporum, further substantiates its role as a PRR and further adds to the notion that PRRs and R proteins cannot strictly be separated and should be considered as a continuum (3).

The Ave1 gene is fully conserved in all race 1 Verticillium strains that were tested, suggesting that identical alleles are required for maximum virulence. Deletion of Ave1 from the genome imposes a significant virulence penalty, because Ave1 acts as a virulence factor not only on tomato, but also on Arabidopsis. The absence of Ave1 in race 2 Verticillium strains explains earlier observations that race 1 Verticillium strains are more aggressive on ve1 tomato than race 2 strains (26, 27). FoAve1, like Ave1, is fully conserved in all F. oxysporum f. sp. lycopersici tested, suggesting that FoAve1 is crucial for the virulence of F. oxysporum f. sp. lycopersici.

Materials and Methods

Verticillium Genomics.

V. dahliae genomic DNA was isolated from conidia that were harvested from 10-d-old cultures grown on potato dextrose agar. Library preparation (500-bp inserts) and Illumina sequencing (100-bp paired-end reads) was performed at the Beijing Genome Institute (BGI, Hong Kong). Draft genome assemblies and the VdLs17 reference assembly (31) were compared all versus all by MUMMER3 (47) to identify race 1-specific sequences as described in SI Material and Methods.

For deep transcriptome sequencing, 3-wk-old N. benthamiana plants were inoculated with strain JR2, as previously described (21), harvested at 4, 8, 12, and 16 d postinoculation, and flash-frozen in liquid nitrogen. Total RNA was extracted using the RNeasy Mini Kit (Qiagen). cDNA synthesis, library preparation (200-bp inserts), and Illumina sequencing (90-bp paired-end reads) was performed at BGI and the obtained reads were mapped on the draft JR2 genome using Tophat (48) as described in the SI Materials and Methods.

Ave1 Functional Analysis.

For heterologous expression, we cloned VdAve1 in the binary pSfinx vector (29) and performed A. tumefaciens mediated transformation on tomato plants (47). For constitutive expression, Ave1 homologs were cloned in the modified, Gateway compatible, pBIN variant pSol2092, and Ve1 and Ve2 were used in pEarleyGate100 and pMOG800 (21, 49). A. tumefaciens mediated transformation of N. benthamiana was performed as described previously (50). Ave1 knock-outs in V. dahliae were generated by cloning of the Ave1 flanking sequences in pRF-HU2 (51). For genomic complementation Ave1 and flanking sequences were cloned in pRW1P (52). Also see SI Materials and Methods.

Ave1 Protein Sequence Analysis.

Ave1 homologs were identified in public databases by BLAST analyses (SI Materials and Methods and Table S3), and phylogenetic analyses were conducted as described in the SI Materials and Methods.

Ave1 Allelic Variation.

To determine the allelic variation, the coding sequence of Ave1 from 85 race 1 V. dahliae strains and two V. albo-atrum strains and of FoAve1 from 72 F. oxysporum f. sp. lycopersici strains (Table S2) was amplified and sequenced using primers VdAve1F (AAGGGGTCTTGCTAGGATGG) and VdAve1R (TGAAACACTTGTCCTCTTGCT) and primers FoAve1-F (TCCCTTTTCACGCTCCTACT) and FoAve1-R (GACAGATGCAGATTGCTGGA) respectively.

Supplementary Material

Supporting Information

Acknowledgments

We thank Dr. Patrick Smit for providing the pSol2092 plasmid. This work was supported in part by the Netherlands Organization for Scientific Research (B.P.H.J.T. and H.P.v.E.); the Centre for BioSystems Genomics (B.P.H.J.T.); the Dutch Technology Foundation (B.P.H.J.T.); the European Research Area-Network Plant Genomics (B.P.H.J.T.); and Japan Society for the Promotion of Science Grant KAKENHI 23780039 (to T.U.).

Footnotes

The authors declare no conflict of interest.

This article is a PNAS Direct Submission.

Data deposition: The sequences reported in this paper have been deposited in the GenBank database [accession nos. JN616379 (VdAve1), JQ283440 (FoAve1), JQ283439 (ChAve1), JQ583777 (CbAve1), and JQ625338–JQ625341 (race 1 scaffold sequences from Verticillium dahliae strains Ls16, CBS381.66, JR2, and Vd14.01 respectively)].

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1119623109/-/DCSupplemental.

References

  • 1.Morris CE, et al. Expanding the paradigms of plant pathogen life history and evolution of parasitic fitness beyond agricultural boundaries. PLoS Pathog. 2009;5:e1000693. doi: 10.1371/journal.ppat.1000693. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Boller T, Felix G. A renaissance of elicitors: Perception of microbe-associated molecular patterns and danger signals by pattern-recognition receptors. Annu Rev Plant Biol. 2009;60:379–406. doi: 10.1146/annurev.arplant.57.032905.105346. [DOI] [PubMed] [Google Scholar]
  • 3.Thomma BPHJ, Nürnberger T, Joosten MHAJ. Of PAMPs and effectors: The blurred PTI-ETI dichotomy. Plant Cell. 2011;23:4–15. doi: 10.1105/tpc.110.082602. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Dodds PN, Rathjen JP. Plant immunity: Towards an integrated view of plant-pathogen interactions. Nat Rev Genet. 2010;11:539–548. doi: 10.1038/nrg2812. [DOI] [PubMed] [Google Scholar]
  • 5.de Jonge R, Bolton MD, Thomma BPHJ. How filamentous pathogens co-opt plants: The ins and outs of fungal effectors. Curr Opin Plant Biol. 2011;14:400–406. doi: 10.1016/j.pbi.2011.03.005. [DOI] [PubMed] [Google Scholar]
  • 6.Jones JDG, Dangl JL. The plant immune system. Nature. 2006;444:323–329. doi: 10.1038/nature05286. [DOI] [PubMed] [Google Scholar]
  • 7.Richards TA, Dacks JB, Jenkinson JM, Thornton CR, Talbot NJ. Evolution of filamentous plant pathogens: Gene exchange across eukaryotic kingdoms. Curr Biol. 2006;16:1857–1864. doi: 10.1016/j.cub.2006.07.052. [DOI] [PubMed] [Google Scholar]
  • 8.Friesen TL, et al. Emergence of a new disease as a result of interspecific virulence gene transfer. Nat Genet. 2006;38:953–956. doi: 10.1038/ng1839. [DOI] [PubMed] [Google Scholar]
  • 9.Raffaele S, et al. Genome evolution following host jumps in the Irish potato famine pathogen lineage. Science. 2010;330:1540–1543. doi: 10.1126/science.1193070. [DOI] [PubMed] [Google Scholar]
  • 10.Tyler BM, et al. Phytophthora genome sequences uncover evolutionary origins and mechanisms of pathogenesis. Science. 2006;313:1261–1266. doi: 10.1126/science.1128796. [DOI] [PubMed] [Google Scholar]
  • 11.Haas BJ, et al. Genome sequence and analysis of the Irish potato famine pathogen Phytophthora infestans. Nature. 2009;461:393–398. doi: 10.1038/nature08358. [DOI] [PubMed] [Google Scholar]
  • 12.Kämper J, et al. Insights from the genome of the biotrophic fungal plant pathogen Ustilago maydis. Nature. 2006;444:97–101. doi: 10.1038/nature05248. [DOI] [PubMed] [Google Scholar]
  • 13.Ridout CJ, et al. Multiple avirulence paralogues in cereal powdery mildew fungi may contribute to parasite fitness and defeat of plant resistance. Plant Cell. 2006;18:2402–2414. doi: 10.1105/tpc.106.043307. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Sacristán S, et al. Coevolution between a family of parasite virulence effectors and a class of LINE-1 retrotransposons. PLoS ONE. 2009;4:e7463. doi: 10.1371/journal.pone.0007463. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Rouxel T, et al. Effector diversification within compartments of the Leptosphaeria maculans genome affected by Repeat-Induced Point mutations. Nat Commun. 2011;2:202. doi: 10.1038/ncomms1189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Richards TA, et al. Phylogenomic analysis demonstrates a pattern of rare and ancient horizontal gene transfer between plants and fungi. Plant Cell. 2009;21:1897–1911. doi: 10.1105/tpc.109.065805. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Richards TA, et al. Horizontal gene transfer facilitated the evolution of plant parasitic mechanisms in the oomycetes. Proc Natl Acad Sci USA. 2011;108:15258–15263. doi: 10.1073/pnas.1105100108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Richards TA. Genome evolution: Horizontal movements in the fungi. Curr Biol. 2011;21:R112–R114. doi: 10.1016/j.cub.2011.01.028. [DOI] [PubMed] [Google Scholar]
  • 19.Fradin EF, Thomma BPHJ. Physiology and molecular aspects of Verticillium wilt diseases caused by V. dahliae and V. albo-atrum. Mol Plant Pathol. 2006;7:71–86. doi: 10.1111/j.1364-3703.2006.00323.x. [DOI] [PubMed] [Google Scholar]
  • 20.Klosterman SJ, Atallah ZK, Vallad GE, Subbarao KV. Diversity, pathogenicity, and management of verticillium species. Annu Rev Phytopathol. 2009;47:39–62. doi: 10.1146/annurev-phyto-080508-081748. [DOI] [PubMed] [Google Scholar]
  • 21.Fradin EF, et al. Genetic dissection of Verticillium wilt resistance mediated by tomato Ve1. Plant Physiol. 2009;150:320–332. doi: 10.1104/pp.109.136762. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Schaible L, Cannon OS, Waddoups V. Inheritance of resistance to Verticillium wilt in a tomato cross. Phytopathology. 1951;41:986–990. [Google Scholar]
  • 23.Kawchuk LM, et al. Tomato Ve disease resistance genes encode cell surface-like receptors. Proc Natl Acad Sci USA. 2001;98:6511–6515. doi: 10.1073/pnas.091114198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Fradin EF, et al. Interfamily transfer of tomato Ve1 mediates Verticillium resistance in Arabidopsis. Plant Physiol. 2011;156:2255–2265. doi: 10.1104/pp.111.180067. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Wang G, et al. The diverse roles of extracellular leucine-rich repeat-containing receptor-like proteins in plants. Crit Rev Plant Sci. 2010;29:285–299. [Google Scholar]
  • 26.Amen J, Shoemaker PB. Histopathology of resistant and susceptible tomato cultivars inoculated with Verticillium dahliae races 1 and 2. Phytopathology. 1985;75:1361–1362. [Google Scholar]
  • 27.Paternotte SJ, van Kesteren HA. A new aggressive strain of Verticillium albo-atrum in Verticillium-resistant cultivars of tomato in the Netherlands. Neth J Plant Pathol. 1993;99:169–172. [Google Scholar]
  • 28.Wevelsiep L, Kogel KH, Knogge W. Purification and characterization of peptides from Rhynchosporium secalis inducing necrosis in barley. Physiol Mol Plant Pathol. 1991;39:417–482. [Google Scholar]
  • 29.Takken FL, et al. A functional cloning strategy, based on a binary PVX-expression vector, to isolate HR-inducing cDNAs of plant pathogens. Plant J. 2000;24:275–283. doi: 10.1046/j.1365-313x.2000.00866.x. [DOI] [PubMed] [Google Scholar]
  • 30.Joosten MHAJ, Cozijnsen TJ, De Wit PJGM. Host resistance to a fungal tomato pathogen lost by a single base-pair change in an avirulence gene. Nature. 1994;367:384–386. doi: 10.1038/367384a0. [DOI] [PubMed] [Google Scholar]
  • 31.Klosterman SJ, et al. Comparative genomics yields insights into niche adaptation of plant vascular wilt pathogens. PLoS Pathog. 2011;7:e1002137. doi: 10.1371/journal.ppat.1002137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Parra G, Bradnam K, Korf I. CEGMA: A pipeline to accurately annotate core genes in eukaryotic genomes. Bioinformatics. 2007;23:1061–1067. doi: 10.1093/bioinformatics/btm071. [DOI] [PubMed] [Google Scholar]
  • 33.Bolton MD, et al. The novel Cladosporium fulvum lysin motif effector Ecp6 is a virulence factor with orthologues in other fungal species. Mol Microbiol. 2008;69:119–136. doi: 10.1111/j.1365-2958.2008.06270.x. [DOI] [PubMed] [Google Scholar]
  • 34.Nembaware V, Seoighe C, Sayed M, Gehring C. A plant natriuretic peptide-like gene in the bacterial pathogen Xanthomonas axonopodis may induce hyper-hydration in the plant host: A hypothesis of molecular mimicry. BMC Evol Biol. 2004;4:10. doi: 10.1186/1471-2148-4-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Ma LJ, et al. Comparative genomics reveals mobile pathogenicity chromosomes in Fusarium. Nature. 2010;464:367–373. doi: 10.1038/nature08850. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Lievens B, Houterman PM, Rep M. Effector gene screening allows unambiguous identification of Fusarium oxysporum f. sp. lycopersici races and discrimination from other formae speciales. FEMS Microbiol Lett. 2009;300:201–215. doi: 10.1111/j.1574-6968.2009.01783.x. [DOI] [PubMed] [Google Scholar]
  • 37.Luderer R, Takken FL, de Wit PJGM, Joosten MHAJ. Cladosporium fulvum overcomes Cf-2-mediated resistance by producing truncated AVR2 elicitor proteins. Mol Microbiol. 2002;45:875–884. doi: 10.1046/j.1365-2958.2002.03060.x. [DOI] [PubMed] [Google Scholar]
  • 38.Ludidi NN, Heazlewood JL, Seoighe C, Irving HR, Gehring CA. Expansin-like molecules: Novel functions derived from common domains. J Mol Evol. 2002;54:587–594. doi: 10.1007/s00239-001-0055-4. [DOI] [PubMed] [Google Scholar]
  • 39.Gehring CA, Irving HR. Natriuretic peptides—A class of heterologous molecules in plants. Int J Biochem Cell Biol. 2003;35:1318–1322. doi: 10.1016/s1357-2725(03)00032-3. [DOI] [PubMed] [Google Scholar]
  • 40.Toop T, Donald JA. Comparative aspects of natriuretic peptide physiology in non-mammalian vertebrates: A review. J Comp Physiol B. 2004;174:189–204. doi: 10.1007/s00360-003-0408-y. [DOI] [PubMed] [Google Scholar]
  • 41.Ruzvidzo O, Donaldson L, Valentine A, Gehring CA. The Arabidopsis thaliana natriuretic peptide AtPNP-A is a systemic regulator of leaf dark respiration and signals via the phloem. J Plant Physiol. 2011;168:1710–1714. doi: 10.1016/j.jplph.2011.03.011. [DOI] [PubMed] [Google Scholar]
  • 42.Göttig N, et al. Xanthomonas axonopodis pv. citri uses a plant natriuretic peptide-like protein to modify host homeostasis. Proc Natl Acad Sci USA. 2008;105:18631–18636. doi: 10.1073/pnas.0810107105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Dean RA, et al. The genome sequence of the rice blast fungus Magnaporthe grisea. Nature. 2005;434:980–986. doi: 10.1038/nature03449. [DOI] [PubMed] [Google Scholar]
  • 44.Cuomo CA, et al. The Fusarium graminearum genome reveals a link between localized polymorphism and pathogen specialization. Science. 2007;317:1400–1402. doi: 10.1126/science.1143708. [DOI] [PubMed] [Google Scholar]
  • 45.Coleman JJ, et al. The genome of Nectria haematococca: Contribution of supernumerary chromosomes to gene expansion. PLoS Genet. 2009;5:e1000618. doi: 10.1371/journal.pgen.1000618. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Goodwin SB, et al. Finished genome of the fungal wheat pathogen Mycosphaerella graminicola reveals dispensome structure, chromosome plasticity, and stealth pathogenesis. PLoS Genet. 2011;7:e1002070. doi: 10.1371/journal.pgen.1002070. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Kurtz S, et al. Versatile and open software for comparing large genomes. Genome Biol. 2004;5:R12. doi: 10.1186/gb-2004-5-2-r12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Trapnell C, Pachter L, Salzberg SL. TopHat: Discovering splice junctions with RNA-Seq. Bioinformatics. 2009;25:1105–1111. doi: 10.1093/bioinformatics/btp120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Earley KW, et al. Gateway-compatible vectors for plant functional genomics and proteomics. Plant J. 2006;45:616–629. doi: 10.1111/j.1365-313X.2005.02617.x. [DOI] [PubMed] [Google Scholar]
  • 50.Van der Hoorn RAL, Laurent F, Roth R, De Wit PJGM. Agroinfiltration is a versatile tool that facilitates comparative analyses of Avr9/Cf-9-induced and Avr4/Cf-4-induced necrosis. Mol Plant Microbe Interact. 2000;13:439–446. doi: 10.1094/MPMI.2000.13.4.439. [DOI] [PubMed] [Google Scholar]
  • 51.Frandsen RJ, Andersson JA, Kristensen MB, Giese H. Efficient four fragment cloning for the construction of vectors for targeted gene replacement in filamentous fungi. BMC Mol Biol. 2008;9:70. doi: 10.1186/1471-2199-9-70. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Houterman PM, Cornelissen BJ, Rep M. Suppression of plant resistance gene-based immunity by a fungal effector. PLoS Pathog. 2008;4:e1000061. doi: 10.1371/journal.ppat.1000061. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supporting Information
1119623109_st01.docx (17.7KB, docx)
1119623109_st02.docx (97.3KB, docx)
1119623109_st03.docx (39.3KB, docx)

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences

RESOURCES