Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2013 May 1.
Published in final edited form as: J Immunol. 2012 Mar 21;188(9):4334–4339. doi: 10.4049/jimmunol.1102759

Langerhans Cells require MyD88-dependent signals for C. albicans response but not for contact hypersensitivity or migration

Krystal Haley 1,*, Botond Z Igyártó 1,*, Daniela Ortner 1, Aleh Bobr 1, Sakeen Kashem 1, Dominik Schenten 2, Daniel H Kaplan 1
PMCID: PMC3331889  NIHMSID: NIHMS359552  PMID: 22442445

Abstract

Langerhans cells (LC) are a subset of skin-resident DC that reside in the epidermis as immature DC where they acquire antigen. A key step in the life cycle of LC is their activation into mature DC in response to various stimuli including epicutaneous sensitization with hapten and skin infection with C. albicans. Mature LC migrate to the skin-draining LN where they present antigen to CD4 T cells and modulate the adaptive immune response. LC migration is thought to require the direct action of IL-1β and IL- 18 on LC. In addition, TLR-ligands are present in C. albicans and hapten sensitization produces endogenous TLR-ligands. Both could contribute to LC activation. We generated Langerin-Cre MyD88fl mice in which LC are insensitive to IL-1 family members and most TLR-ligands. LC migration in the steady-state, after hapten sensitization and after infection with C. albicans was unaffected. Contact hypersensitivity in Langerin-Cre MyD88fl mice was similarly unaffected. Interestingly, in response to C. albicans infection these mice displayed reduced proliferation of antigen-specific CD4 T cells and defective Th17 subset differentiation. Surface expression of co-stimulatory molecules was intact on LC but expression of IL-1β, IL-6, and IL-23 was reduced. Thus, sensitivity to MyD88-dependent signals is not required for LC migration but is required for the full activation and function of LC in the setting of fungal infection.

Introduction

Peripheral dendritic cells (DC) reside in an immature state in non-lymphoid tissues where they actively acquire antigen(1). In response to maturation stimuli, peripheral DC become activated and increase surface expression of co-stimulatory markers such as CD80 and CD86 as they migrate out of their resident tissue, through the lymphatics, to the regional draining lymph node (LN). Once in the LN, they present antigen acquired in the periphery to naïve and memory T cells and thereby initiate adaptive immune responses. Peripheral DC that migrate during the steady-state are thought to maintain peripheral self-tolerance.

Langerhans cells (LC) are a subset of skin-resident DC that forms a dense network in the epidermis(2). Though LC acquire antigen in the skin and migrate to the cutaneous LN (CLN) where they present antigen to T cells, their function remains somewhat controversial(3). Contact hypersensitivity (CHS) is a classic technique to assay cutaneous adaptive immune responses. Transgenic mice with an inducible or constitutive ablation of epidermal LC develop increased CHS to multiple haptens that results from the absence of LC during the afferent (i.e. sensitization), but not efferent (elicitation) phase(4-6). Data from other LC ablation mouse models find that CHS is reduced or unaffected by LC absence(7–9). A newer assay of LC function involves skin infection with Candida albicans. In response to C. albicans infection, footpad delayed-type hypersensitivity (DTH) responses are increased in the absence of LC. In addition, the differentiation of antigen-specific Th17 CD4+ T cells but not Th1 or CD8+ CTL cells is greatly diminished in LC-deficient mice(10). This phenotype is recapitulated in mice with a LC-specific ablation of MHC-II. Thus, LC that migrate to the CLN under in response to C. albicans infection present antigen acquired in the skin to CD4 T cells and skew Th-phenotype differentiation, which ultimately determines the degree of the adaptive response.

A key step in the life cycle of LC is their activation from an immature DC in the epidermis to a fully mature DC in the CLN(2). LC migrate from the epidermis in response to many stimuli including microbial products, chemical sensitizers (i.e. haptens) and UV light. LC migration after epicutaneous application of hapten is the best studied. Migration can be inhibited by in vivo blockade of TNFα, IL-1α, IL-1β or IL-18 with neutralizing antibodies(11–13). Dermal injection of these cytokines is also sufficient to induce LC migration. In addition, LC migration is defective in IL-1R−/− and IL-18−/−mice(14–16).

Recently, a crucial role for TLR2 and TLR4 during the early afferent response of CHS was described(17). Mice lacking both TLR2 and TLR4 develop attenuated CHS. TLR2 and TLR4 appear to recognize endogenous ligands in the skin such as low molecular weight breakdown products of high molecular weight hyaluronic acid (HA) that are generated by sensitization(17, 18). CHS also requires inflammasome-dependent production of active IL-1β and IL-18. Mice with defects in this pathway (i.e. P2X7−/−, ASC−/−, NALP3−/−, caspase1−/−, IL-1β −/−, IL-18−/−, and IL-1R−/− mice) all have defective CHS(14, 19–21). These data support a model in which hapten sensitization promotes elaboration of IL-1 family members and TLR-agonists in the skin that induce activation and migration of skin-resident DC to the CLN, thereby initiating an adaptive anti-hapten response. Since C. albicans contains ligands for TLR2/4 and induces inflammasome activation, LC migration to C. albicans infection likely occurs through a similar mechanism(22).

Although many of the factors involved LC migration have been identified, the cell type(s) that senses the presence of TLR-agonists and responds to IL-1/IL-18 has not been definitively demonstrated. Since most DC subtypes respond to these factors, it is likely they act directly on LC to induce migration. To test this hypothesis, we generated Langerin-Cre MyD88-flox mice. MyD88 is a signaling adapter molecule downstream of the IL-1R, IL-18R and most TLRs. MyD88−/− mice with a global MyD88 defects fail to develop CHS(16). Langerin-Cre MyD88-flox mice have a selective ablation of MyD88 in LC that renders only these cells unresponsive. Herein, we examine the migratory capacity and function of MyD88-deficient LC in response to hapten sensitization and skin infection with C. albicans.

Materials and Methods

Mice

MyD88lox/lox mice generated on a C57BL/6 background(23) were obtained and crossed with huLangerin-Cre YFPlox/lox mice which had been backcrossed onto C57BL/6 for 7 generations(24). Unless noted, littermate mice were used as controls. The YFP served as an endogenous reporter for cre expression and, indirectly, MyD88 excision. HuLangerin-DTA(5) mice were employed as a positive control in contact hypersensitivity and delayed-type hypersensitivity experiments. TEα Rag −/− CD4 TCR-transgenic to I-Eα50-66(25) mice on CD90.1 C57BL/6 background were used for adoptive transfer experiments.

The mice used in experiments were 6 to 10 weeks old and sex-matched. Mice were housed in microisolator cages and fed irradiated food and acidified water. The University of Minnesota institutional care and use committee approved all mouse protocols.

Antibodies

Fluorochrome-conjugated antibodies to CD4, CD8, CD11b, CD11c, CD45.2, CD90.1, CD103, MHC-II, IFNγ, IL-17A, TLR-2 were obtained from Biolegend (San Diego, CA). IL-17F and IL-22 were purchased from eBioscience (San Diego, CA). Antibodies to Langerin (clone 929F30.1) were obtained from Imgenex (San Diego, CA).

Flow cytometry

Single-cell suspensions from epidermis, dermis, and CLN were prepared and stained for skin DC subsets as previously described(5). T-cell cytokine expression was determined as previously described(4). Samples were analyzed on LSR-II flow cytometers (BD Bioscience, San Jose, CA), and the resulting data were analyzed with FlowJo software (TreeStar, Ashland, OR).

Cell sorting

Single-cell suspensions from epidermis and skin-draining lymph nodes were prepared using the same method as mentioned under Flow Cytometry. A FACSAria cell sorter was used to isolate LC (YFP+, MHC-II+) from epidermal cells suspensions. Cells from skin-draining lymph nodes were enriched and sorted as described(10).

PCR and qPCR

Epidermis-derived sorted LC underwent an overnight digestion step at 56 oC to release DNA. Polymerase-chain reaction was completed with the DNA and the following primers: GGGAATAATGGCAGTCCTCTCCCAG and CAGTCTCATCTTCCCCTCTGCC. These primers allowed for the discrimination of the WT allele, floxed allele, and deleted allele. The WT product was around 1600 bp, the floxed product was around 1800 bp, and the deleted allele product was around 400 bp.

mRNA was extracted from sorted LC using a MiniPrep kit (Qiagen, Valencia, CA) and analyzed via qPCR with TaqMan Gene Expression Assays and an ABI 7900HT (ABI, Carlsbad, CA), as previously described(10). The data is presented as 2−ΔΔct.

TLR-2 agonist injection

Endotoxin-free Pam3CKS4 was purchased from Invivogen (San Diego, CA) and diluted to 1 mg/mL with sterile water, per manufacturer’s instructions. 20 uL of Pam3CSK4 or sterile water was injected into the dorsal ear pinnae. Four days later, the ears were excised and split in half. The ear sheets were processed into epidermal single cell suspension, as previously described(5).

Epicutaneous cell labeling

Tetramethylrhodamine isothiocyanate (TRITC) was prepared by diluting 20 ug/uL stock solution to 1 ug/uL with 1:1 acetone and dibutyl phthalate. Abdomen hair was removed from mice with an electric clipper one day prior to painting. 50 uL of TRITC solution or vehicle was apply to the skin and allowed to dry before mice were returned to cage. Skin-draining LN were harvested four days later for flow cytometry analysis.

Contact hypersensitivity (CHS)

Allergic contact dermatitis was induced with 2,4-dinitro-1-fluorobenzene (DNFB, Sigma-Aldrich, St Louis, MO), as previously described(5). 0.5% DNFB was applied to abdominal skin for sensitization and 0.2% DNFB was used for the challenge. Five days passed between sensitization and challenge, and ear swelling was measured one day after challenge.

Candida albicans skin infection

The dorsal flanks of mice were infected with recombinant C. albicans (designated Calb-Ag), as previously described(10). C. albicans was grown in YPAD at 30°C until the OD600 measured between 1.5 and 2. Mice were anesthetized with ketamine/xylazine mixture (100/10 μg per kg body weight). Hair was removed from the skin with an electric clipper and Nair, per manufacturer’s instructions. The stratum corneum was removed with 220 grit sandpaper (3M, St Paul, MN) before the application of 2 x 108 C. albicans in 50 μl sterile PBS.

Delayed-type hypersensitivity (DTH)

The adaptive immune response was assessed after recombinant C. albicans infection via DTH, as previously described(10). 107 heat-killed yeast cells were injected into the footpad of mice seven days after skin infection. The footpad swelling was measured one day later. The specific DTH was calculated by subtracting the degree of swelling in PBS treated mice from the degree of swelling in C. albicans infected mice. The same recombinant strain of C. albicans was used for both skin infection and challenge.

Adoptive T cell transfer

TEα transgenic T-cells were isolated and transferred as previously described(10). Single cells suspensions were created from the skin-draining and mesenteric lymph nodes of TEα mice. The cells were labeled with CFSE (Invitrogen, Carlsbad, CA), according to the manufacturer’s instructions, and re-suspended in sterile PBS. 3 x 105 cells, in 300 μl, were injected intravenously and were later detected in recipient mice by their expression of congenic CD90.1.

Statistical analysis

The significant differences between populations were calculated using the Mann- Whitney test. All mRNA data comparisons used the Student’s unpaired, two-tailed t-test.

Results

Generation of Langerin-Cre MyD88-flox mice

Langerin-Cre transgenic mice constitutively express Cre recombinase under the control of the human promoter for langerin(24). We have previously reported, using Langerin-Cre mice bred onto the YFP Cre reporter strain (Rosa26.stopfl-YFP), that Cre expression is restricted to epidermal LC and that floxed allele excision occurs efficiently. Other DC subsets, including Langerin+ CD103+ dermal DC, do not express Cre. We crossed Langerin-Cre Rosa26.stopfl-YFP mice with MyD88fl mice(23) and generated Langerin-Cre MyD88fl Rosa26.stopfl-YFP mice, henceforth referred to as Langerin-Cre MyD88. As expected, all LC in the epidermis and CLN expressed YFP (data not shown). Although expression of YFP should be linked to excision of MyD88, we confirmed the efficient excision of MyD88 by FACS sorting LC from Langerin-Cre MyD88 mice and isolating DNA for genomic PCR across the MyD88 locus. As expected, only a product from the 367 bp, fully excised MyD88 locus was visualized (LC, Figure 1a). DNA isolated from the total LN of WT or Langerin-Cre MyD88 mice showed the expected 1543 bp product for the native MyD88 locus and 1761 bp for the unexcised MyD88fl locus, respectively. As was observed with mice that constitutively lack LC, Langerin-Cre MyD88 mice displayed no gross abnormalities or evidence of spontaneous skin inflammation(5).

Figure 1. MyD88-deficient LC migrate in the steady state.

Figure 1

Open in a new tab

a. DNA was isolated from lymph nodes of WT and MyD88-flox mice (left) and from LC sorted from Langerin-Cre MyD88 mice. PCR across the MyD88 locus is shown (expected products: endogenous locus 1543 bp, unexcised floxed locus 1761 bp, excised locus 367 bp). b. Single cell suspensions of epidermis were gated on LC based on expression of MHC-II and stained for TLR-2. Representative data from 10 individual mice is shown. c. Langerin-Cre MyD88 mice (black) and littermate controls (WT, white) were injected in the ear with Pam3CSK4 or vehicle (sterile water). The percentage of LC in the epidermis was determined by flow cytometry 4 days after injection (* indicates p < 0.05). Data was pooled from 4 independent experiments. d. Numbers of LC (CD11c, MHC-IIbright, Langerin+, CD103-, CD11b+), Langerin+ dDC (CD11c, MHC-IIbright, Langerin+, CD103+, CD11b-) and Langerin- dDC (CD11c, MHC-IIbright, Langerin-) were determined from skin-draining LN isolated from naive WT (open symbols) and Langerin-Cre MyD88 (closed symbols) mice.

MyD88-deficient LC Migrate in the Steady State

To evaluate whether steady-state LC migration occurs through a MyD88-dependent process, we compared the number of resident epidermal LC in Langerin-Cre MyD88 and littermate control mice (WT). Flow cytometry of epidermal single-cell suspensions revealed a similar density of LC in both strains of mice (Figure 1c). The number of LC, Langerin+ dermal DC (dDC) as Langerin- dDC found in CLN was also similar in Langerin-Cre MyD88 and WT mice (Figure 1d). These data are consistent with a previous report that the numbers of all Langerin+ DC in CLN are unaffected in MyD88−/−mice(26). LC in mice express TLR-2 (Figure 1b). To confirm that LC in Langerin-Cre MyD88 mice were functionally defective, we injected Pam3CSK4, a synthetic TLR1/2 agonist, or PBS into the dermis of both mouse strains (Figure 1c). As expected, Pam3CSK4 induced migration of LC from the epidermis in WT but not Langerin-Cre MyD88 mice. Thus, activation via TLR1/2 is sufficient to induce LC migration but steady-state LC migration does not require LC-intrinsic MyD88-dependent signaling.

MyD88-deficient LC Migrate in Response to Hapten

Although LC migration to pharmacologic doses of TLR agonist required sensitivity to MyD88, we next examined whether MyD88 participates in the more physiologic assay of hapten-induced LC migration using tetramethylrhodamine isothiocyanate (TRITC). In addition to inducing inflammation, TRITC has the advantage of labeling those DC that are present in the skin at the time of painting thereby allowing discrimination of DC that have migrated in response to hapten from those that migrated previously(27, 28). TRITC was applied to cohorts of Langerin-Cre MyD88 and control Langerin-Cre YFP mice. After four days, CLN cells were analyzed via FACS and four populations were identified: TRITC+YFP+ (LC that migrated in response to TRITC), TRITC+ YFP –(dDC that migrated in response to TRITC), TRITC –YFP + (LC that migrated prior to TRITC application), and TRITC–YFP–cells (dDC that migrated prior to TRITC application) (Figure 2a). We did not observe a difference in the number of these cell populations between Langerin-Cre MyD88 and Langerin-Cre YFP mice (Figure 2b). Surface expression of DC activation markers such as CD40, CD80 and CD86 were highly expressed on migratory LC in CLN but were equivalent in LC from both strains of mice (Figure 2c). Similar results were obtained after application of the hapten DNFB (data not shown). Thus, the ability of LC to respond to MyD88-dependent signals is not required for migration or expression of activation markers in response to hapten-induced inflammation.

Figure 2. LC migration to hapten and CHS are normal in Langerin-Cre MyD88 mice.

Figure 2

Open in a new tab

Langerin-Cre MyD88 and Langerin-Cre YFP mice were epicutaneously sensitized with TRITC. Four days later, single cell suspensions of skin-draining LN were analyzed via flow cytometry. a. TRITC-labeling and expression of YFP were used to discriminate and compare four populations: YFP+ TRITC+ (migrated LC), YFP+ TRITC- (resident LC), YFP- TRITC+ (skin-derived migratory cells), and YFP- TRITC- (resident LN cells). b. Total numbers of each DC subset is shown. Each symbol represents an individual mouse. c. Expression of CD40, CD80, and CD86 were evaluated on LC isolated from the skin-draining LN of Langerin-Cre YFP (dashed line) and Langerin-Cre MyD88 (solid line) mice. Isotype control staining is shown in gray. d. Littermate control (WT), Langerin-Cre MyD88 (MyD88), and Langerin-DTA (DTA) mice were sensitized with 0.5% DNFB and challenged five days later with 0.2% DNFB. Control (Neg) were mice sensitized with vehicle alone. Specific ear swelling one day after challenge is shown. Data is pooled from two experiments with at least 4 mice per group. (*<0.05, n.s.= not significant).

We have previously reported that Langerin-DTA mice that lack LC develop exaggerated contact hypersensitivity (CHS) to numerous haptens(4, 5). To examine whether LC from Langerin-Cre MyD88 mice were functionally impaired, we sensitized Langerin-Cre Myd88 and littermate control mice with 0.5% DNFB. After five days, mice were challenged with 0.2% DNFB. As expected, the degree of ear swelling was exaggerated in Langerin-DTA mice (DTA), whereas ear swelling was unaffected in Langerin-Cre MyD88 mice (MyD88) (Figure 2d). Thus, hapten-induced migration of LC and LC-mediated suppression of CHS does not require LC-intrinsic MyD88-dependent signaling.

MyD88-deficient LC Migrate in Response to C. albicans skin infection

Infection with the dimorphic fungus Candida albicans has been shown in vivo to promote inflammasome activation and elaboration of IL-1β(22). C. albicans also contains ligands that are recognized by TLR-2 and TLR-4(29). Since these are the same pathways that promote hapten-induced LC migration, we next examined LC migration in response to C. albicans skin infection. Four days after infection, the number of LC, Langerin+ dermal DC and Langerin – dermal DC in CLN of Langerin-Cre MyD88 and WT mice were compared. As was the case for hapten-induced migration, the numbers of migratory LC in Langerin-Cre MyD88 mice was unaltered (Figure 3a). Surface expression of the activation markers CD40, CD80 and CD86 were similarly unaffected (Figure 3b).

Figure 3. MyD88-deficient LC migrate in response to C. albicans.

Figure 3

Open in a new tab

a. Littermate control (WT, white symbols) or Langerin-Cre MyD88 (MyD88, black symbols) were skin infected with C. albicans. Sham infected mice (Neg) are shown in gray. The number of LC, Langerin+ dDC and Langerin-dDC in skin-draining LN 4 days after infection is shown. Each symbol represents an individual animal. b. Expression of CD40, CD80 and CD86 on LC isolated from skin-draining LN 4 days after infection from littermate control (dashed line) and Langerin-Cre MyD88 (solid line) is shown. (* indicates p < 0.05).

MyD88-deficient LC are functionally impaired

We have recently reported that Langerin-DTA mice that lack epidermal LC developed an exaggerated delayed type hypersensitivity (DTH) response after skin infection with C. albicans(10). This was associated with modest decreased in proliferation of antigen-specific CD4 T cells and a near absence of antigen-specific Th17 cells. To test the functional importance of LC engagement with IL-1 family members and/or TLR agonists, we infected cohorts of Langerin-Cre MyD88, Langerin-DTA and control mice with C. albicans. The footpad DTH response was examined 7 days later. As expected, Langerin-DTA mice developed an exaggerated specific DTH response. Interestingly, Langerin-Cre MyD88 mice developed an intermediate phenotype that was significantly increased above control but was less than mice lacking LC (Figure 4a). To examine the antigen-specific T cell response in more detail, we adoptively transferred CD90.1, TEα transgenic CD4 T cells (specific for the Eα peptide) into WT, Langerin-Cre MyD88, and Langerin-DTA mice. Mice were then skin infected with recombinant C. albicans that had been engineered to express the Eα peptide(10). Similar to Langerin-DTA mice, the expansion of TEα cells was significantly reduced in Langerin-Cre MyD88 mice (Figure 4b). The development of Th17 cells, as assayed by the expression of IL-17A, IL-17-F and IL-22, was also significantly reduced compared with WT mice (Figure 4c). Thus, MyD88-dependent signaling in LC was required for the development of an optimal anti-Candida DTH response and differentiation of antigen-specific Th17 cells.

Figure 4. MyD88 signaling is required for an antigen-specific Th17 response.

Figure 4

Open in a new tab

a. Littermate (WT), Langerin-Cre MyD88 (MyD88), and huLangerin-DTA (DTA) mice were skin infected with C. albicans. Specific DTH was measured on day +8. Data is pooled from two individual experiments with at least 5 mice per group. b. 3x105 CFSE-labeled, CD90.1+ TEα cells were adoptively transferred into WT, Langerin-Cre MyD88 and Langerin-DTA mice. On Day +1, mice were infected with recombinant C. albicans expressing I-Eα50-66. The total number of CD90.1+ TEα cells recovered 4 days after infection from sham infected (Neg), littermate control (WT), Langerin-Cre MyD88 (MyD88) and Langerin-DTA (DTA) mice is shown. c. Cytokine production by TEα cells was assessed by intracellular flow cytometry after activation by PMA/Ionomycin. Data is pooled from 3 individual experiments with at least 4 mice per group. d. LC were purified by FACS sorting from the skin-draining LN of WT and Langerin-Cre MyD88 mice four days after C. albicans skin infection. Levels of mRNA expression of cytokines was determined by qPCR, normalized to HPRT and is expressed as the ratio between Langerin-Cre MyD88 and WT mice. (* indicates p < 0.05).

Since increased surface expression of co-stimulatory markers on LC after C. albicans infection was intact in Langerin-Cre MyD88 mice (Figure 3b), we examined levels of cytokine expression. LC from Langerin-Cre MyD88 and control Langerin-Cre YFP mice were FACS sorted from CLN four days after C. albicans infection based on expression of CD11c+, MHC-IIbright, and YFP+. Levels of mRNA for IL-1β, IL-6, TGFβ, IL-12α, IL-12β, and IL-23α were examined by RT qPCR (Figure 4d). We observed a modest but significant decrease in IL-1β and IL-6 production in Langerin-Cre MyD88 mice. There was, however, a marked decreased expression of IL-12β (p40), a subunit shared between IL-12 and IL-23. Since LC do not produce message for IL-12α, these results indicate that LC from Langerin-Cre MyD88 mice have greatly reduced expression of IL-23. Generation of Th17 cells has been shown to depend on IL-1β , IL-6, IL-23 and TGFβ . The observed reduction of IL-1β , IL-6 and IL-23 expression in LC in the absence of MyD88-depdendent signals is consistent with the reduced efficiency of Th17 development in response to infection with C. albicans.

Discussion

We have generated mice in which MyD88 is selectively ablated in LC. These mice show no deficit in LC migration during steady-state conditions, in response to hapten application, or as a result of skin infection with C. albicans. CHS is also functionally unaffected in these mice. In contrast, after skin infection with C. albicans, specific DTH responses, proliferation of antigen-specific CD4 T cells, differentiation of Th17 cells and LC expression of Th17 promoting cytokines were all defective.

Skin application with haptens and infection with C. albicans have both been shown to activate the inflammasome and result in secretion of active IL-1β and IL-18. In addition, ligands for TLR2 and TLR4 are expressed by C. albicans and are generated in the skin in response to application of hapten(18, 29). The absence of MyD88 renders LC insensitive to IL-1β and IL-18. LC are also insensitive to many TLR-agonists except those binding TLR4 or TLR3. Thus, our observation that LC migration in Langerin-Cre MyD88 mice is intact, demonstrates that direct activation of LC by MyD88-depdendent TLR agonists, IL-1 or IL-18 is not an obligate step for inflammation induced LC migration. TLR4 is not expressed by LC(30), and TLR3 has not been reported to contribute to the in vivo hapten or C. albicans response. Thus, these data suggests a model in which IL-1 family members and TLR agonists act indirectly via cells other than LC, most likely keratinocytes, that then promote LC-migration through a non-MyD88 dependent signal. TNFα, a well described keratinocyte-derived cytokine that induces LC migration through a MyD88-independent signaling pathway, is a possible candidate(11). Interestingly, dermal injection of Pam3CSK4, a synthentic TLR1/2 agonist, produces modest MyD88-dependent LC migration. Thus, a strong MyD88-dependent signal when given in pharmacologic doses can induce LC migration. This raises the possibility that in response to physiologic stimuli, direct LC migration may occur but be redundant or that it may occur, but only with stimuli other than those we have examined.

Contact hypersensitivity to epicutaneouly applied hapten is the standard assay of the cutaneous adaptive immune response which is regulated by LC(3). Unlike Langerin-DTA mice that lack LC and develop exaggerated CHS, Langerin-Cre MyD88 mice manifest normal CHS. Thus, hapten mediated release of IL-1β and production of endogenous TLR ligands which are all required for optimal CHS do not directly affect LC function and must act on other cell types. Expression of MyD88 in radio-resistant cells has been shown to be required for CHS(16). Our data show that this dependence must reside in a cell type other than LC.

In the setting of skin infection with C. albicans, MyD88-deficient and sufficient LC efficiently migrated to skin-draining LN and increased surface expression of co-stimulatory molecules. In contrast, antigen-specific T cell proliferation was decreased and differentiation of Th17 cells was severely impacted in Langerin-Cre MyD88 mice. Thus, indirect activation of LC is sufficient for migration but does not result in the full activation required for appropriate T cell activation. We also observed that MyD88- deficient LC expressed reduced message for IL-1β, IL-6 and IL-23 which all participate in the development of Th17 cells. These data are consistent with earlier reports showing that DC require direct engagement with TLR-agonists in order to elaborate the cytokines that are required for a productive T cell response(31). Thus, the commonly use assays of LC maturation, LC migration and expression costimulatory markers, need to be coupled with an examination of LC-derived cytokines to accurately determine the activation state of LC.

Acknowledgments

We would like to acknowledge Dr. Emily Gillespie and the members of her laboratory, especially Thearith Koeuth and Joe Wilson. Paul Champoux and the Flow Cytometry Core Facility at the Center for Immunology (University of Minnesota) assisted with sorting and flow-cytometry experiments.We thank the University of Minnesota Research Animal Resources staff for their support and animal care.

This work was supported by a grant from the NIH AR056632 and the American Skin Association. BZI was supported by a grant from the Dermatology Foundation. DS was supported by a grant from the Cancer Research Institute.

References

  • 1.Banchereau J, Briere F, Caux C, Davoust J, Lebecque S, Liu YJ, Pulendran B, Palucka K. Immunobiology of dendritic cells. Annu Rev Immunol. 2000;18:767–811. doi: 10.1146/annurev.immunol.18.1.767. [DOI] [PubMed] [Google Scholar]
  • 2.Romani N, Clausen BE, Stoitzner P. Langerhans cells and more: langerin-expressing dendritic cell subsets in the skin. Immunol Rev. 2010;234:120–141. doi: 10.1111/j.0105-2896.2009.00886.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Kaplan DH. In vivo function of Langerhans cells and dermal dendritic cells. Trends Immunol. 2010 doi: 10.1016/j.it.2010.08.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Igyarto BZ, Jenison MC, Dudda JC, Roers A, Muller W, Koni PA, Campbell DJ, Shlomchik MJ, Kaplan DH. Langerhans cells suppress contact hypersensitivity responses via cognate CD4 interaction and langerhans cell-derived IL-10. J Immunol. 2009;183:5085–5093. doi: 10.4049/jimmunol.0901884. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Kaplan DH, Jenison MC, Saeland S, Shlomchik WD, Shlomchik MJ. Epidermal langerhans cell-deficient mice develop enhanced contact hypersensitivity. Immunity. 2005;23:611–620. doi: 10.1016/j.immuni.2005.10.008. [DOI] [PubMed] [Google Scholar]
  • 6.Bobr A, Olvera-Gomez I, Igyarto BZ, Haley KM, Hogquist KA, Kaplan DH. Acute ablation of Langerhans cells enhances skin immune responses. J Immunol. 2010;185:4724–4728. doi: 10.4049/jimmunol.1001802. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Bennett CL, Noordegraaf M, Martina CA, Clausen BE. Langerhans cells are required for efficient presentation of topically applied hapten to T cells. J Immunol. 2007;179:6830–6835. doi: 10.4049/jimmunol.179.10.6830. [DOI] [PubMed] [Google Scholar]
  • 8.Noordegraaf M, Flacher V, Stoitzner P, Clausen BE. Functional redundancy of Langerhans cells and Langerin+ dermal dendritic cells in contact hypersensitivity. J Invest Dermatol. 2010;130:2752–2759. doi: 10.1038/jid.2010.223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Honda T, Nakajima S, Egawa G, Ogasawara K, Malissen B, Miyachi Y, Kabashima K. Compensatory role of Langerhans cells and langerin-positive dermal dendritic cells in the sensitization phase of murine contact hypersensitivity. J Allergy Clin Immunol. 2010;125:1154–1156. e1152. doi: 10.1016/j.jaci.2009.12.005. [DOI] [PubMed] [Google Scholar]
  • 10.Igyarto BZ, Haley K, Ortner D, Bobr A, Gerami-Nejad M, Edelson BT, Zurawski SM, Malissen B, Zurawski G, Berman J, Kaplan DH. Skin-resident murine dendritic cell subsets promote distinct and opposing antigen-specific T helper cell responses. Immunity. 2011;35:260–272. doi: 10.1016/j.immuni.2011.06.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Cumberbatch M, Dearman RJ, Kimber I. Langerhans cells require signals from both tumour necrosis factor-alpha and interleukin-1 beta for migration. Immunology. 1997;92:388–395. doi: 10.1046/j.1365-2567.1997.00360.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Cumberbatch M, Dearman RJ, Antonopoulos C, Groves RW, Kimber I. Interleukin (IL)-18 induces Langerhans cell migration by a tumour necrosis factor-alpha-and IL-1beta-dependent mechanism. Immunology. 2001;102:323–330. doi: 10.1046/j.1365-2567.2001.01187.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Cumberbatch M, Dearman RJ, Groves RW, Antonopoulos C, Kimber I. Differential regulation of epidermal langerhans cell migration by interleukins (IL)-1alpha and IL-1beta during irritant- and allergen-induced cutaneous immune responses. Toxicol Appl Pharmacol. 2002;182:126–135. doi: 10.1006/taap.2002.9442. [DOI] [PubMed] [Google Scholar]
  • 14.Antonopoulos C, Cumberbatch M, Dearman RJ, Daniel RJ, Kimber I, Groves RW. Functional caspase-1 is required for Langerhans cell migration and optimal contact sensitization in mice. J Immunol. 2001;166:3672–3677. doi: 10.4049/jimmunol.166.6.3672. [DOI] [PubMed] [Google Scholar]
  • 15.Antonopoulos C, Cumberbatch M, Mee JB, Dearman RJ, Wei XQ, Liew FY, Kimber I, Groves RW. IL-18 is a key proximal mediator of contact hypersensitivity and allergen-induced Langerhans cell migration in murine epidermis. J Leukoc Biol. 2008;83:361–367. doi: 10.1189/jlb.0604352. [DOI] [PubMed] [Google Scholar]
  • 16.Klekotka PA, Yang L, Yokoyama WM. Contrasting roles of the IL-1 and IL-18 receptors in MyD88-dependent contact hypersensitivity. J Invest Dermatol. 2010;130:184–191. doi: 10.1038/jid.2009.242. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Martin SF, Dudda JC, Bachtanian E, Lembo A, Liller S, Durr C, Heimesaat MM, Bereswill S, Fejer G, Vassileva R, Jakob T, Freudenberg N, Termeer CC, Johner C, Galanos C, Freudenberg MA. Toll-like receptor and IL-12 signaling control susceptibility to contact hypersensitivity. J Exp Med. 2008;205:2151–2162. doi: 10.1084/jem.20070509. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Martin SF, Esser PR, Weber FC, Jakob T, Freudenberg MA, Schmidt M, Goebeler M. Mechanisms of chemical-induced innate immunity in allergic contact dermatitis. Allergy. 2011 doi: 10.1111/j.1398-9995.2011.02652.x. [DOI] [PubMed] [Google Scholar]
  • 19.Sutterwala FS, Ogura Y, Szczepanik M, Lara-Tejero M, Lichtenberger GS, Grant EP, Bertin J, Coyle AJ, Galan JE, Askenase PW, Flavell RA. Critical role for NALP3/CIAS1/Cryopyrin in innate and adaptive immunity through its regulation of caspase-1. Immunity. 2006;24:317–327. doi: 10.1016/j.immuni.2006.02.004. [DOI] [PubMed] [Google Scholar]
  • 20.Watanabe H, Gaide O, Petrilli V, Martinon F, Contassot E, Roques S, Kummer JA, Tschopp J, French LE. Activation of the IL-1beta-processing inflammasome is involved in contact hypersensitivity. J Invest Dermatol. 2007;127:1956–1963. doi: 10.1038/sj.jid.5700819. [DOI] [PubMed] [Google Scholar]
  • 21.Weber FC, Esser PR, Muller T, Ganesan J, Pellegatti P, Simon MM, Zeiser R, Idzko M, Jakob T, Martin SF. Lack of the purinergic receptor P2X(7) results in resistance to contact hypersensitivity. J Exp Med. 2010;207:2609–2619. doi: 10.1084/jem.20092489. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Joly S, Ma N, Sadler JJ, Soll DR, Cassel SL, Sutterwala FS. Cutting edge: Candida albicans hyphae formation triggers activation of the Nlrp3 inflammasome. J Immunol. 2009;183:3578–3581. doi: 10.4049/jimmunol.0901323. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Kleinridders A, Schenten D, Konner AC, Belgardt BF, Mauer J, Okamura T, Wunderlich FT, Medzhitov R, Bruning JC. MyD88 signaling in the CNS is required for development of fatty acid-induced leptin resistance and diet-induced obesity. Cell Metab. 2009;10:249–259. doi: 10.1016/j.cmet.2009.08.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Kaplan DH, Li MO, Jenison MC, Shlomchik WD, Flavell RA, Shlomchik MJ. Autocrine/paracrine TGF{beta}1 is required for the development of epidermal Langerhans cells. J Exp Med. 2007;204:2545–2552. doi: 10.1084/jem.20071401. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Grubin CE, Kovats S, deRoos P, Rudensky AY. Deficient positive selection of CD4 T cells in mice displaying altered repertoires of MHC class II-bound self-peptides. Immunity. 1997;7:197–208. doi: 10.1016/s1074-7613(00)80523-3. [DOI] [PubMed] [Google Scholar]
  • 26.Wilson NS, Young LJ, Kupresanin F, Naik SH, Vremec D, Heath WR, Akira S, Shortman K, Boyle J, Maraskovsky E, Belz GT, Villadangos JA. Normal proportion and expression of maturation markers in migratory dendritic cells in the absence of germs or Toll-like receptor signaling. Immunol Cell Biol. 2007 doi: 10.1038/sj.icb.7100125. [DOI] [PubMed] [Google Scholar]
  • 27.Henri S, Vremec D, Kamath A, Waithman J, Williams S, Benoist C, Burnham K, Saeland S, Handman E, Shortman K. The dendritic cell populations of mouse lymph nodes. J Immunol. 2001;167:741–748. doi: 10.4049/jimmunol.167.2.741. [DOI] [PubMed] [Google Scholar]
  • 28.Jakubzick C, Bogunovic M, Bonito AJ, Kuan EL, Merad M, Randolph GJ. Lymph-migrating, tissue-derived dendritic cells are minor constituents within steady-state lymph nodes. J Exp Med. 2008;205:2839–2850. doi: 10.1084/jem.20081430. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Netea MG, Gow NA, Munro CA, Bates S, Collins C, Ferwerda G, Hobson RP, Bertram G, Hughes HB, Jansen T, Jacobs L, Buurman ET, Gijzen K, Williams DL, Torensma R, McKinnon A, MacCallum DM, Odds FC, Van der Meer JW, Brown AJ, Kullberg BJ. Immune sensing of Candida albicans requires cooperative recognition of mannans and glucans by lectin and Toll-like receptors. J Clin Invest. 2006;116:1642–1650. doi: 10.1172/JCI27114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Flacher V, Bouschbacher M, Verronese E, Massacrier C, Sisirak V, Berthier-Vergnes O, de Saint-Vis B, Caux C, Dezutter-Dambuyant C, Lebecque S, Valladeau J. Human Langerhans cells express a specific TLR profile and differentially respond to viruses and Gram-positive bacteria. J Immunol. 2006;177:7959–7967. doi: 10.4049/jimmunol.177.11.7959. [DOI] [PubMed] [Google Scholar]
  • 31.Sporri R, Reis e Sousa C. Inflammatory mediators are insufficient for full dendritic cell activation and promote expansion of CD4+ T cell populations lacking helper function. Nat Immunol. 2005;6:163–170. doi: 10.1038/ni1162. [DOI] [PubMed] [Google Scholar]

RESOURCES