Abstract
The long-chain acyl-CoA dehydrogenase (LCAD) (Acadl = gene; LCAD = protein) deficient mouse model has been important in evaluating the role of mitochondrial fatty acid oxidation of long-chain fatty acids in metabolic disorders. The insertion vector-based gene targeting strategy used to generate this model has made it difficult to distinguish homozygous and heterozygous genotypes containing targeted Acadl alleles in LCAD-deficient mice. Herein, we describe the design and validation of Acadl SNP genotyping methods capable of distinguishing between heterozygous and homozygous LCAD-deficient mice. The Acadl SNP genotyping assays are effective at allelic discrimination of both C57BL/6 and 129 mouse strain-based Acadl alleles under conditions including, both low purity and quantity genomic DNA templates. This makes the method practical and provides the necessary tools for genotyping the LCAD-deficient mouse model.000
Keywords: Mouse model, long-chain acyl-CoA dehydrogenase, Acadl alleles, SNP genotyping assay, molecular genotyping
1. Introduction
Long-chain acyl-CoA dehydrogenase (Acadl = gene; LCAD = protein) deficiency in mice closely mimics human very long-chain acyl-CoA dehydrogenase deficiency and is a key enzyme involved in mouse fatty acid oxidation of long chain fatty acids [1-5]. LCAD-deficient mice have been distributed around the world for various studies. Unfortunately, due to the insertion vector-based gene targeting strategy used [1], a simple PCR-based genotyping assay is not possible. As previously described, LCAD-deficient (LCAD-/-) mice were generated using a targeting strategy that resulted in an insertion duplication of a region containing exons 3 through 4 within the Acadl locus [1], which confounds the development of routine genotyping strategies that distinguish targeted and wild-type Acadl alleles in LCAD+/- and LCAD-/- mice.
The generation of the LCAD-deficient mouse model led to construction of a chimeric Acadl locus comprising sequence regions originating from mouse strains of three distinct genetic backgrounds. An insertion-based targeting vector, pAcadltm1Uab, which contains 129X1 (formerly 129/SvJ) genomic sequence from the Acadl locus spanning intron 2 through intron 4 and harbors an 821 base pair deletion in exon 3 was used during the targeted deletion step in TC-1 embryonic stem (ES) cells derived from 129S6 (formerly 129/SvEvTacfBR) mice. Recombinant mice generated from targeted ES cell clones were then backcrossed to C57BL/6 (B6) mice (Taconic Farms) for 10 generations to produce B6 congenic LCAD-deficient (B6.LCAD-/-) mice. Ultimately, this targeting approach led to the generation of B6.LCAD-/- mice with an Acadl locus consisting of proximal 129X1 and 129S6 sequence and distal B6 sequence (Figure 1) [1].
Figure 1. Chimeric Strain-Specific Sequence of the Targeted Acadl locus in LCAD-Deficient Mice.
(Top) Targeted 129X1-129S6 Acadl locus. Acadl locus sequence in LCAD-deficient mice consists of targeted vector comprising 129X1-129S6 chimeric components. Sequence distal to the Acadl locus is of C57BL/6 origin. (Bottom) Wild-type Acadl locus. Wild-type C57BL/6 Acadl locus sequence and distal sequence. (Legend for sequence origin; no color (129S6); blue (129X1); grey (C57BL/6); red (plasmid sequence PGKneobpA/pGEM-11zf(+)). S1 and S2 refer to Acadl SNP 1 and Acadl SNP 2 locations, respectively, in the targeted Acadl (top) locus and wild-type C57BL/6 locus (bottom).
In an effort to develop a simple genotyping method for LCAD-deficient mice, we have utilized the chimeric nature of the targeted Acadl locus and employed targeted mutant 129-based allele and non-targeted wild-type B6 allele-distinguishing single nucleotide polymorphisms (SNPs). We describe here the validation of a SNP-based genotyping method that enables reliable genotyping and discrimination between B6 wild-type and 129-targeted Acadl alleles in B6.LCAD+/- and B6.LCAD-/- mice.
2. Materials and Methods
2.1 Mouse genomic DNA
Genomic DNA samples were prepared from B6.LCAD+/+ wild-type (Taconic), B6.LCAD+/-, B6.LCAD-/- , and 129S6 (wild-type) mice. All procedures were approved by the Sanford-Burnham Medical Research Institute (SBMRI) Institutional Animal Care and Use Committee (IACUC). Genomic DNA was isolated from mice by tissue harvest. DNA was isolated from tail or from liver extraction following humane euthanasia methods. Mouse genomic DNA (spleen) from 129X1 (wild-type) mice (formerly 129/SvJ) was acquired from Jackson Laboratory. For genomic DNA extraction, tail tissue was incubated in 200 μl of solution A (0.2 mM EDTA pH 12, 25 mM NaOH) at 95° C for 45 minutes to 1 hour, followed by the addition of 200 μl of solution B (40 mM Tris pH 5), then vortexed. Liver genomic DNA was extracted using the Genomic DNA Mini Kit (IBI Scientific), followed by purification with Wizard® Genomic DNA Purification Kit (Promega), then further purification using standard phenol-chloroform-isoamyl alcohol (Sigma) and ethanol precipitation methods to ensure purity of the genomic DNA with a 260/280 ratio of 1.8-2.0.
2.2 SNP assay development
A region spanning 1.5 kilobases (kb) between exons 3 and 4 within the Acadl gene locus was amplified with forward primer 5’-GACTTGCTCTCAACAGCAGTTACTTGGG-3’ (exon 3) and reverse primer 5’-GGCTATGGCACCGATACACT-3’ (exon 4), using either genomic DNA isolated from liver of B6.LCAD-/-, B6.LCAD+/+, or 129S6 mice, or from 129X1 genomic DNA (Jackson Laboratory). The respective 1.5 kb products were amplified using the Expand Long Template PCR system (Roche). PCR products were separated by gel electrophoresis on a 1% agarose gel, the 1.5 kb fragments then excised and gel purified (Qiagen). Following quantification, the purified products spanning the Acadl exon 3 to 4 region were sequenced with primers 5’-GACTTGCTC TCAACAGCAGTTACTTGGG-3’ or 5’GGCTATGGCACCGATACACT-3’ with an ABI 3730 sequencer (Retrogen). Sequence data generated was analyzed and aligned using Vector NTI 11 (Invitrogen Life Technologies). Sequence runs for B6.LCAD-/-, B6.LCAD+/+, 129S6, and 129X1 Acadl exon 3 to 4 regions were aligned together or to known Acadl sequence for C57BL/6J (Gene ID: 11363; GenBank: NC_000067.5) (NCBI). Single nucleotide polymorphisms (SNPs) identified in B6.LCAD-/-, 129S6, and 129X1 sequences aligned with B6.LCAD+/+ sequence for the Acadl exon 3 to 4 region were selected for SNP genotyping assay development, based on the following criteria: (1) quality of sequence reads, and (2) no other sequence anomalies (i.e. insertions, deletions, or SNPs) within 50 bases of the target SNP.
Primers (5’ GGAGGATTGCCAAGAGCTCAAG 3’ forward; 5’TTTGTTTTGAAAGCAGCTT CTTGCT 3’ reverse) and probes (5’ TGGCCTAGAACTGACTAT 3’ FAM; 5’TGGCCTAGAA CTAACTAT 3’ VIC) were selected (Acadl SNP 1 assay) to target a 93 base pair amplicon within intron 3 of the Acadl locus with the genotyping SNP located specifically at position 66,900,911 (Acadl SNP 1) on chromosome 1 (Applied Biosystems). Primers (5’ GTGACT GCGGGTACATTAGAGT 3’ forward; 5’ TCTTACCCTGACACTGCAATTGT 3’ reverse) and probes (5’ AAGGTGCCCTCCATAAT 3’ FAM; 5’ CAAGGTGCCCTCTATAAT 3’ VIC) were selected (Acadl SNP 2 assay) to target a 70 base pair amplicon also within intron 3 of the Acadl locus with the genotyping SNP located specifically at position 66,900,172 (Acadl SNP 2) on chromosome 1 (Applied Biosystems). Acadl SNP 1 and SNP 2 were verified as registered SNPs as rs48198501(dbSNP) and rs30323299 (dbSNP), respectively. Both Acadl SNP 1 and 2 assays were then validated by real time PCR using an Applied Biosystems StepOne instrument (ABI). A single reaction consisted of 10 μl of Taqman® Genotyping Master Mix (Applied Biosystems; 4371355), 0.5 μl of either Acadl SNP 1 or 2 assay, 7.5 μl dH2O, and 2 μl of genomic DNA template. Reactions were set up in MicroAmp Fast Optical 96-well plates (Applied Biosystems; 4346906). A SNP genotyping program of (60° C 30 seconds (1X); 95° C 10 minutes (1X); 95° C 15 seconds then 60° C 1 minute (40X); 60° C 30 seconds (1X)) was used with genomic DNA samples for known B6.LCAD-/-, B6.LCAD+/-, B6.LCAD+/+, 129S6, and 129X1 mouse strains, as well as no template controls. Genotyping results were represented as allele intensities and calculated as the endpoint fluorescence of reporter dyes normalized to the Rox passive reference dye, minus the starting background reporter fluorescence normalized to the passive reference dye (ΔRn). An allelic discrimination plot of normalized reporter fluorescence (ΔRn) for each allele was then generated using the StepOne algorithm function. The StepOne software then uses an algorithm to plot the normalized reporter fluorescence (ΔRn) as an allelic discrimination plot. Genotype clusters were defined by the ratio of allele 1 (C) ΔRn/allele 2 (T) ΔRn with ratios ~1 being defined as LCAD+/- genotype clusters, ratios >1 defined as LCAD+/+ genotype clusters, and ratios <1 defined as LCAD-/- genotype clusters.
2.3 Serial dilution analysis
Serial dilution assays were performed for both Acadl SNP 1 and 2 assays. Genomic templates from B6.LCAD-/-, B6.LCAD+/-, and B6.LCAD+/+ mice were diluted serially 2-fold with a maximum of 140 ng/μl of genomic template per reaction and a minimum of 2.18 ng/μl of genomic DNA per reaction. All genomic samples used were purified from liver with a 260/280 ratio of 1.8-2.0. SNP genotyping PCR assays were performed as described above.
Statistical Analysis
Statistical analysis was performed using ANOVA with Tukey post test. Results showing a p-value of p < 0.05 were considered statistically significant.
3. Results
3.1 Development of an Acadl SNP genotyping assay
In order to develop a SNP-based genotyping method to discriminate between the targeted 129 chimeric Acadl allele in B6.LCAD-/- mice from the wild-type Acadl allele in B6.LCAD+/+ mice, we evaluated sequences for both the targeted 129 and wild-type B6 Acadl alleles to identify candidate SNPs. In our sequence analysis of several Acadl genomic regions, PCR amplification and sequencing of a 1.5 kb region located between exons 3 and 4 of the targeted 129 chimeric Acadl allele and the wild-type Acadl allele in B6.LCAD-/- and B6.LCAD+/+ mice, respectively, produced sequence runs that could be aligned together or with known sequence for the C57BL/6 Acadl locus to search for the presence of candidate SNPs. Acadl sequence alignments of the exon 3 to 4 region from B6.LCAD+/+ and B6.LCAD-/- genomic templates indicated the presence of two SNPs [chr 1: 66,900,904 (Acadl SNP 1) and chr 1: 66,900,180 (Acadl SNP 2)]. Alignment of the wild-type Acadl locus from the B6.LCAD+/+ sequence run with known C57BL/6J sequence (Gene ID: 11363; GenBank: NC_000067.5) (NCBI) verified the sequence of the B6 wild-type version of this allele for these two SNPs, where as alignment of the targeted 129 chimeric Acadl locus sequence run from B6.LCAD-/- mice to the known C57BL/6 sequence verified the presence of the two single nucleotide differences [Acadl SNP 1, rs48198501 (dbSNP) and Acadl SNP 2, rs30323299 (dbSNP)]. The presence of these two allele-discriminating SNPs suggested likely candidates for SNP genotyping assay development. Thus, we chose Acadl SNP 1 and 2 for assay development in a SNP-based genotyping assay to distinguish between the targeted 129 chimeric and B6 wild-type Acadl alleles from B6.LCAD-/- and B6.LCAD+/+ mice, respectively (Figure 1). Preliminary screening for SNP-assay design (Applied Biosystems) produced a candidate primer and probe combination for each SNP [Acadl SNP 1 assay and Acadl SNP 2 assay, respectively], that could then be assessed for genotyping validation using genomic templates (Figure 2).
Figure 2. Amplicon sequences for Acadl SNP assays 1 and 2.
Lower case letters signify forward and reverse primer targets for amplification. Uppercase letters denote the remaining intervening sequence of the amplicon and underlined sequences represent allele-specific probe target sequence. Nucleotides within brackets indicate allele-specific SNP nucleotide [allele 1/allele 2] where allele 1 corresponds to the B6 allele and allele 2 corresponds to 129-derived alleles.
The ABI StepOne software platform calculates normalized probe intensities (ΔRn) and plots the values representing each allele on an allelic discrimination plot. In our Acadl SNP assays we assessed the presence of two possible alleles, 129 chimeric and B6, for Acadl SNP 1 and 2. Each axis of an allelic discrimination plot corresponds to the intensity (ΔRn) of one of the two assayed alleles where the location of dots on the plot reflects the contribution of both allele intensities (ΔRn) in a particular sample. In order to validate the ability of our Acadl SNP assays to distinguish the genotypes of mice harboring only B6 alleles (wild-type, B6.LCAD+/+), only 129 chimeric alleles (B6.LCAD-/- mice), or both B6 and 129 chimeric alleles (B6/129 heterozygous B6.LCAD+/- mice), we isolated genomic DNA from B6.LCAD+/+, B6.LCAD+/-, and B6.LCAD-/- mice and performed Acadl SNP genotyping analysis. Our results for Acadl SNP assay 2 indicated clear and reproducible discrimination of cytosine-containing B6 (red circles) and thymine-containing 129 (blue circles) allelic intensities (ΔRn) between B6.LCAD+/+ and B6.LCAD-/- mice (Figure 3, right), respectively. In addition, a third cluster representing B6.LCAD+/- allelic intensities (ΔRn) (green dots) showed an intermediate position on the allelic discrimination plot reflecting equal contributions from both B6 and 129 chimeric alleles in the genomic sample (Figure 3, right). Similar results were also seen with Acadl SNP 1 assay. Taken together, both Acadl SNP 1 and 2 assays serve as effective SNP genotyping methods for discriminating between B6 wild-type and targeted 129 chimeric Acadl alleles in LCAD-deficient mice.
Figure 3. Acadl SNP 2 Assay Validation.
B6.LCAD+/+, B6.LCAD+/-, B6.LCAD-/-, and 129S6 genomic DNA samples were (A) purified from liver [There were no statistical differences among groups homozygous for the 129 allele (B6.LCAD-/-, 129S6, and 129X1), however comparison between (B6.LCAD-/-, 129S6, and 129X1), (B6.LCAD+/-), and (B6.LCAD+/+) groups were significant, p < 0.001], (B) crude preparations from mouse tail clippings [Statistical differences were seen between (B6.LCAD-/-, 129S6, and 129X1), (B6.LCAD+/-), and (B6.LCAD+/+) groups, p < 0.001], or (C) crude genomic DNA from mouse tail clippings diluted to 50ng/μl using a 1:1 solution A/B mix [Statistical differences were seen between (B6.LCAD-/-, 129S6, and 129X1), (B6.LCAD+/-), and (B6.LCAD+/+) groups, p < 0.001. Differences were also seen between B6.LCAD-/- and 129X1, p < 0.01, and between B6.LCAD-/- and 129S6, p < 0.05]. (Left) Ratio of the signal intensity (ΔRn) of the 129 and B6 alleles are shown for the indicated samples subject to Acadl SNP 2 assay. (Right) Allelic discrimination plots showing signal intensities (ΔRn) for the B6 versus the 129 allele using Acadl SNP 2 assay. Each dot represents the genotype of an individual sample (blue circles are homozygous for the 129 allele (LCAD-/-), green circles are heterozygous and contain both B6 and 129 alleles (LCAD+/-), and red circles are homozygous for the B6 allele (LCAD+/+, wild-type). Data are representative of 5 mice per genotype (B6.LCAD+/+, B6.LCAD+/-, B6.LCAD-/-, and 129S6 strains) where both liver and tail clippings (A-C) were used internally from the same respective mice. Genomic DNA from the 129X1 strain was purified from spleen (Jackson Laboratory) and corresponding circles represent technical replicates.
As stated earlier, the Acadl targeted locus is a chimera of 129-based sequence originating from 129S6 ES cell genomic DNA and the 129X1 targeting vector. Specifically, the sequence containing exons 3 to 4, the region used for our Acadl SNP assay design, is duplicated within the targeted locus comprising of one exon 3 to 4 region originating from 129S6 ES cell DNA and one from the 129X1 targeting vector [1]. Given the duplicated nature of the targeted locus our initial validation of the SNP-based genotyping method does not indicate whether the allele intensity signal (ΔRn) for the targeted chimeric Acadl allele originates from the 129S6 or the 129X1 sequence. In order to determine which 129-derived genetic background sequence harbors Acadl SNPs 1 and 2 detected from our initial analysis, genomic DNA from either 129S6 or 129X1 mice were subject to validation by the Acadl SNP 1 and 2 assays. Performing the Acadl SNP 2 assay with genomic DNA from both 129S6 and 129X1 strains showed a significantly higher detection of the 129 allele, compared to the B6 allele in both 129S6 and 129X1 genomic samples, resulting in clustering of these 129-derived samples with B6.LCAD-/- samples (blue circles) (Figure 3). Similar results were also seen with the Acadl SNP 1 assay. Furthermore, sequence analysis of the region spanning exons 3 and 4 of the Acadl locus in either 129X1 or 129S6 genomic DNA confirmed the presence of both 129 SNP variants as seen in genomic samples from LCAD-deficient mice. These results indicated that both 129X1 and 129S6 strain sequences contribute to the detection of 129 SNP variant alleles in our Acadl SNP analysis of the Acadl targeted locus from LCAD-deficient mice.
3.2 The Acadl SNP genotyping assays are reliable under conditions of low DNA purity
In order to validate the utility of the Acadl SNP assays with respect to DNA purity, we compared allelic detection of B6.LCAD+/+, B6.LCAD+/-, and B6.LCAD-/- genomic DNA purified from liver (260/280 ratio~1.8-2.0; 50 ng/μl), crude genomic DNA from tail tips (260/280 ratio~1.50-1.69; 181-339.1 ng/μl), or diluted crude genomic DNA (50 ng/μl) (Figure 3a-c, respectively). Our results indicate that the lower purity crude tail genomic DNA compared to high purity purified genomic DNA showed lower individual allele intensity signals that were either at or just below the acceptable threshold of detection (ΔRn=1) as compared to the separate cluster of assay positive controls (Figure 3b, right) while purified controls gave the highest allelic intensities, well above the threshold of detection (Figure 3a, right). However, despite this more diffuse pattern on the allelic discrimination plot, the ratio of allelic intensities for the 129 allele (allele T) and the B6 allele (allele C) from crude DNA preps did not change significantly as compared to purified DNA samples (Figure 3a-b, left). The ratio of allelic intensities for the 129 allele (allele T) and the B6 allele (allele C) for diluted crude DNA preps were also similar to that of purified and crude preps (Figure 3c, left). However, dilution of the lower purity crude tail genomic DNA resulted in more cohesive clustering of sample reads on the allelic discrimination plot and individual allele signal intensities that were above the threshold of detection (Figure 3c, right). This trend more closely resembled sample clustering from purified genomic DNA (Figure 3a, right). Collectively, these results show that irrespective of the clustering pattern of the allelic discrimination plots associated with varying degrees of DNA purity, the 129 to B6 allele ratios showed consistent and expected values. However, crude DNA preps had a tendency to display individual allele signal intensities at or slightly below the acceptable threshold of detection. Similar results were seen with the Acadl SNP 1 assay.
3.3 The Acadl SNP genotyping assays are reliable under conditions of low DNA quantity
In addition, the effect of DNA quantity on assay performance was assessed using two-fold serial dilutions of liver purified DNA template (140 ng/μl to 2.18 ng/μl quantities; 260/280~1.8-2.0) from B6.LCAD+/+, B6.LCAD+/-, and B6.LCAD-/- mice. SNP genotyping with Acadl SNP 2 assay using a range of DNA quantities showed little effect on the ratio of 129 to B6 allele intensities and modest decreases in signal intensities for each allele (Figure 4a). Individual signal intensities even at the lowest concentration (2.18 ng/μl) of template DNA were still well above the detectable threshold for the B6 allele in B6.LCAD+/+ and B6.LCAD+/- genomic samples and for the 129 allele in B6.LCAD+/- and B6.LCAD-/- genomic samples (Figure 4b, c). This indicates that the Acadl SNP 2 assay is a robust genotyping approach under a broad range of template DNA quantities. Similar results were shown for Acadl SNP 1 assay. We also observed that detection of both B6 and 129 alleles in B6.LCAD-/- and B6.LCAD+/+ samples, respectively, showed a small degree of residual signal (Figure 4b and 4c, respectively). This in part can be explained by a minimal signal produced in NTC (No Template Control) samples; ΔRn = 0.0956 ± 0.006 for the 129 allele and ΔRn = 0.105 ± 0.005 for the B6 allele). An obvious explanation for this phenomenon is due to trace amounts of non-specific DNA contamination. Another possible explanation may be due to a baseline level of spontaneous quencher-reporter dye dissociation from each probe and further detection of this signal. However, the degree of signal arising in NTC samples accounts for only a small portion of the residual signal. The additional residual signal observed may result from the generation of cross-amplifying signals where a primer/probe set for a specific SNP allele will cross-amplify the non-specific allele, an inherent caveat associated with SNP-based genotyping. This likelihood is a result of non-specific annealing of probes that differ by only one nucleotide within SNP genotyping assays. Despite the residual signals imparted by the Acadl SNP genotyping assays, the individual allelic signal intensities for the respective dominant alleles are well above the threshold of detection while residual signal intensities from non-specific cross-amplification remain below this threshold of detection.
Figure 4. Affect of DNA Quantity on Acadl Assay Allelic Detection.
Affect of DNA quantity on the (A) ratio of signal intensity of the 129 and B6 alleles, (B) the signal intensity (ΔRn) of the B6 allele alone, and (C) the signal intensity (ΔRn) of the 129 allele alone for purified genomic DNA isolated from B6.LCAD+/+, B6.LCAD+/-, and B6.LCAD-/- mice subject to Acadl SNP 2 assay. Two-fold dilutions of genomic DNA quantity were used (140 ng/μl-2.18 ng/μl) in addition to no template controls (NTC). Statistical differences were seen between all three genotypes at each dilution, p < 0.001. Data are representative of 5 different mouse genomic samples for each genotype and each sample was assayed with 3 technical replicates.
4. Discussion
The gene targeting method used to generate the LCAD-deficient mouse model led to an insertion duplication of exons 3 through 4 within the Acadl gene locus making traditional genotyping methods impractical. We describe here the development and validation of an effective SNP genotyping method for LCAD-deficient mice on a B6 background that reproducibly discriminates between heterozygous and homozygous genotypes by specifically detecting the 129-based sequence of the mutant Acadl locus or the B6-based sequence of the wild-type Acadl locus.
One of the limitations of this SNP genotyping assay is that its utility is only useful for distinguishing genotypes of LCAD-deficient mice on a B6 background. Since the assay is based on detection of 129 versus B6 alleles, genotyping would not be effective for LCAD-deficient mice on a congenic background that is of 129 origin or shows high conservation to 129 sequence at the Acadl locus (i.e. BTBR). Validation of the Acadl SNP genotyping assays for mouse strains on a mixed genetic background of 129 and B6, as is the case for the originally described LCAD-deficient mice [1, 6], would depend on the percentage of B6 genomic contribution. Due to lack of availability, the Acadl SNP genotyping methods have not yet been evaluated on the previous LCAD-deficient and corresponding LCAD wild-type models which were maintained as non-congenic mice at generation 2-3 on a mixed 129/B6 genetic background. The primary complication is possibly that the corresponding wild-type control may not harbor enough B6 sequence at the Acadl locus to effectively discriminate between targeted and wild-type Acadl alleles using this SNP assay. However, in additional studies, we have found that a minimum of two backcrosses of a NIH Swiss Black mouse strain, which shows detection of the 129 Acadl allele, to the C57BL/6 genetic background was sufficient to impart predominantly B6 Acadl allele detection using the Acadl SNP genotyping assays. This suggests that the Acadl SNP genotyping assays may be valid even for the original LCAD-deficient mouse model on generation 2-3 of the mixed 129/B6 genetic background.
In cases where standard endpoint PCR have been impractical, other alternatives have been used to distinguish genotypes which include copy number analysis of inserted neomycin resistance genes using quantitative PCR approaches. These methods have been reported to distinguish between heterozygous and homozygous mutant mice [7]. This approach would be ideal especially for LCAD-deficient mice on a 129 (or related) genetic background where the Acadl SNP assays would fail to discriminate mutant and wild-type Acadl alleles. However, genotyping mouse models containing disruptions at multiple gene loci all of which contain a neomycin-resistance cassette limit the utility of the QPCR method. In addition, this analysis relies on a single cycle threshold difference, which may not have the sensitivity and reliability necessary for routine genotyping and consistent maintenance of mutant mouse strains. In cases where the targeted Acadl allele contains discriminating SNPs compared to the corresponding wild-type genetic background, our studies suggest that the Acadl SNP genotyping approach has greater sensitivity due to the specificity for targeted and wild-type alleles. In addition, the Acadl SNP assay is highly reproducible and reliable under a wide range of DNA purities and quantities adding to its superiority over the QPCR approach.
This study is a demonstration of alternate methods in genotyping that may have broad application for many other mouse strains where traditional methods are also not practical. As an example, medium chain acyl-CoA dehydrogenase (MCAD) deficient mice were also generated with a targeting method that resulted in an insertion duplication of exons 8 through 10 [8]. As a result, an earlier genotyping method (Shawn E. McCandless, data not published) used for this strain involved a multi-step process of PCR reactions followed by a restriction digest for differentiation of PCR products that are 147 and 235 base pairs in size to distinguish the B6 allele from the 129 allele. Efficiency and sensitivity of genotyping in MCAD-deficient mice on a B6 genetic background would be greatly improved with a SNP genotyping method as described for the B6.LCAD mutant line. In addition to mouse strains that are targeted at a single locus, studies evaluating phenotypes as a result of gene-gene interactions employ mouse strains that have been cross-bred to contain multiple gene loci that have undergone targeted disruption or replacement. Generation and maintenance of these novel multi-gene mutant models requires genotyping methods that are highly gene-locus specific, an essential feature where in many cases traditional PCR methods and especially simple neomycin-resistance cassette detection are inadequate. Taken together, the Acadl SNP assay reflects a viable approach that can serve to streamline rapid and specific genotyping for mouse strains that previously involved impractical techniques.
Highlights.
To date, genotyping of Acadl targeted alleles in heterozygous and homozygous LCAD-deficient mice has been impractical.
We have developed two Acadl SNP genotyping assays that distinguish between heterozygous and homozygous Acadl targeted alleles.
The Acadl SNP genotyping assays are effective at both low DNA purity and quantity.
Acknowledgements
We thank Caron Stonebrook for mouse colony assistance for this project and Shawn E. McCandless for helpful discussion. This work was supported by National Institutes of Health (NIH) grant R01-RR02599, and its contents are solely the responsibility of the authors and do not necessarily represent the official views of the National Center for Research Resources, or the NIH.
Abbreviations
- Acadl
acyl-coenzyme A dehydrogenase, long-chain
- LCAD
long-chain acyl-CoA dehydrogenase
Footnotes
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Conflicts of Interest
The authors have no conflicts of interest to report.
References
- 1.Kurtz DM, Rinaldo P, Rhead WJ, Tian L, Millington DS, Vockley J, Hamm DA, Brix AE, Lindsey JR, Pinkert CA, O'Brien WE, Wood PA. Targeted disruption of mouse long-chain acyl-CoA dehydrogenase gene reveals crucial roles for fatty acid oxidation. Proc Natl Acad Sci U S A. 1998;95:15592–15597. doi: 10.1073/pnas.95.26.15592. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Cox KB, Liu J, Tian L, Barnes S, Yang Q, Wood PA. Cardiac hypertrophy in mice with long-chain acyl-CoA dehydrogenase or very long-chain acyl-CoA dehydrogenase deficiency. Lab Invest. 2009;89:1348–1354. doi: 10.1038/labinvest.2009.86. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Cox KB, Hamm DA, Millington DS, Matern D, Vockley J, Rinaldo P, Pinkert CA, Rhead WJ, Lindsey JR, Wood PA. Gestational, pathologic and biochemical differences between very long-chain acyl-CoA dehydrogenase deficiency and long-chain acyl-CoA dehydrogenase deficiency in the mouse. Hum Mol Genet. 2001;10:2069–2077. doi: 10.1093/hmg/10.19.2069. [DOI] [PubMed] [Google Scholar]
- 4.Chegary M, Brinke H, Ruiter JP, Wijburg FA, Stoll MS, Minkler PE, van Weeghel M, Schulz H, Hoppel CL, Wanders RJ, Houten SM. Mitochondrial long chain fatty acid beta-oxidation in man and mouse. Biochim Biophys Acta. 2009;1791:806–815. doi: 10.1016/j.bbalip.2009.05.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Houten SM WR. A general introduction to the biochemistry of mitochondrial fatty acid beta-oxidation. J Inherit Metab Dis. 2010;33:479–494. doi: 10.1007/s10545-010-9061-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Zhang D, Liu ZX, Choi CS, Tian L, Kibbey R, Dong J, Cline GW, Wood PA, Shulman GI. Mitochondrial dysfunction due to long-chain Acyl-CoA dehydrogenase deficiency causes hepatic steatosis and hepatic insulin resistance. Proc Natl Acad Sci U S A. 2007;104:17075–17080. doi: 10.1073/pnas.0707060104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Gelinas R, Thompson-Legault J, Bouchard B, Daneault C, Mansour A, Gillis MA, Charron G, Gavino V, Labarthe F, Des Rosiers C. Prolonged QT interval and lipid alterations beyond beta-oxidation in very long-chain acyl-CoA dehydrogenase null mouse hearts. Am J Physiol Heart Circ Physiol. 2011;301:H813–823. doi: 10.1152/ajpheart.01275.2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Tolwani RJ, Hamm DA, Tian L, Sharer JD, Vockley J, Rinaldo P, Matern D, Schoeb TR, Wood PA. Medium-chain acyl-CoA dehydrogenase deficiency in gene-targeted mice. PLoS Genet. 2005;1:e23. doi: 10.1371/journal.pgen.0010023. [DOI] [PMC free article] [PubMed] [Google Scholar]