Abstract
Background
Mutations in the α-synuclein gene (SNCA) cause autosomal dominant forms of Parkinson’s disease, but the substantial risk conferred by this locus to the common sporadic disease has only recently emerged from genome-wide association studies.
Methods
Here we genotyped a prioritized non-coding variant in SNCA intron-4 in 344 patients with Parkinson’s and 275 controls from the longitudinal Harvard NeuroDiscovery Center Biomarker Study.
Results
The common minor allele of rs2736990 was associated with elevated disease susceptibility (odds ratio = 1.40, P value = 0.0032).
Conclusions
This result increases confidence in the notion that in many clinically well-characterized patients genetic variation in SNCA contributes to “sporadic” disease.
Keywords: Parkinson’s disease, α-synuclein, GATA transcription factors, biomarker, genome-wide association study
INTRODUCTION
Parkinson’s disease (PD) is an aging-dependent, progressive neurodegenerative disease that poses an increasing threat to public health as life expectancy is improving worldwide. α-Synuclein has been correlated with sporadic PD since its discovery as a core constituent of Lewy bodies, but a considerable genetic contribution of non-coding SNCA variants to the sporadic disease has only recently emerged from genome-wide association studies. Here we successfully replicated an association between the rs2736990 variant in SNCA intron-4 and PD highlighted by Simon-Sanchez et al. 2009 in the Harvard NeuroDiscovery Center Biomarker Study (HBS).
METHODS
Study population
HBS is a Harvard-wide, longitudinal, case-control study designed to accelerate the discovery and validation of molecular diagnostics that track or predict progression of early-stage PD and Alzheimer’s disease (AD). Inclusion criteria for cases with PD are age ≥ 21, diagnosis of PD according to UK PD Society Brain Bank (UKPDSBB) criteria or according to movement disorders specialist assessment [1], MMSE score > 21 or next of kin present to provide informed consent, and ability to provide informed consent. Two modifications to UKPDSBB clinical diagnostic criteria were made to allow for more than one affected relative and response to dopamine replacement therapy. Exclusion criteria for cases with PD in HBS: diagnosis of a blood or bleeding disorder, known hematocrit < 30, or known active ulcer or active colitis. Inclusion criteria for healthy controls were non-blood relatives (generally spouses) of cases with PD or patients with AD enrolled in HBS, no current diagnosis or history of a neurological disease, ability to provide informed consent, and age ≥ 21 (≥ 30 for spouses of AD patients). Using this definition, the controls are comparable to the PD cases in that they are drawn from the same source population and could be identified as a case, if they had disease. Exclusion criteria for non-blood relatives of patients with PD: same as for cases. For the current genetic case-control association study nested in HBS, all cases with PD and healthy controls enrolled in HBS at the time of analysis (February 2010) with available DNA specimens were included yielding a total of 375 cases with PD and 275 controls. The Institutional Review Boards of Brigham and Women’s Hospital and Massachusetts General Hospital approved all studies.
Genetic association study
Genotyping was performed by TaqMan SNP assay on an ABI7900HT Sequence Detection System (Applied Biosystems, Foster City, CA) for SNP rs2736990 (ACCTTATGAGCTGTTTAGGAAGAAG[A/G]TGTATATGTGTGTAACAGGGAGCAA). The genotyping completion rate was 98% and the concordance rate was 100% for replicate assays included for 10% of randomly selected samples. Genotype frequencies were examined for deviation from Hardy-Weinberg equilibrium using χ2 tests. Logistic regression was used to estimate statistical significance, odds ratios (ORs), 95% confidence intervals (CIs) under allelic, dominant, and recessive models, while adjusting for age and sex, using SAS software 9.2 for Windows (SAS Institute, Cary, NC, USA). The Cochran-Armitage trend test was used to examine allelic additive effects. The primary analysis included cases meeting UKPDSBB diagnostic criteria. The secondary analysis included all cases based on diagnosis of PD by movement disorders specialist. A P value less than 0.05 was considered statistically significant.
RESULTS
344 of 375 patients (91.73%) diagnosed with PD by a neurology board-certified, movement disorders fellowship-trained neurologist met modified UKPDSBB criteria. An overview of baseline clinical characteristics is shown in Table 1. Allele frequency distribution of the rs2736990 polymorphism in SNCA is shown in Table 2. Hardy-Weinberg equilibrium was not violated in controls. This SNP was highly present in the general population with a minor allele frequency (G) of 45.9% in controls and 54.5% in cases with PD. We found a significant association between the rs2736990 variant and PD in the HBS population (Table 2). For cases meeting UKPDSBB criteria significant associations were obtained under dominant (OR = 1.60, 95% CI: 1.08–2.36), recessive (OR = 1.54, 95% CI: 1.04–2.28) and allelic models (OR = 1.41, 95% CI: 1.11–1.78) (Table 2). For each minor allele, there was a 40% increase in risk of PD (OR=1.40, 95% CI: 1.12–1.76, P = 0.0032) in the carriers. A secondary analysis that included all 375 cases based on diagnosis of PD by movement disorders specialist produced virtually identical results (Table 2). Exploratory analyses of clinical phenotypes of cases with PD carrying two (GG), one (AG), or no risk allele (AA) are shown on the right side of Table 1. Considering the many clinical characteristics explored, none would reach compelling statistical significance after adjustment for multiple testing (although trends observed may justify further exploration in a much larger cohort).
Table 1.
Clinical characteristics of study participants
| Disease status | PD | Control | PD | ||||
|---|---|---|---|---|---|---|---|
| Genotype | AA¶ | AG¶ | GG¶ | ||||
| N | 375 | 275 | P# | 80 | 181 | 114 | P* |
| Age (Mean ± SD) | 66.42 ± 10.83 | 68.57 ± 10.42 | 0.0114 | 67.23 ± 13.89 | 66.18 ± 9.97 | 66.24 ± 9.73 | 0.4942 |
| Male | 244 (65.07%) | 94 (34.18%) | <0.0001 | 56 (70.00%)† | 118 (65.19%) | 70 (61.40%) | 0.4651 |
| Age of onset | 61.00 ± 11.51 | 61.56 ± 14.43 | 61.07 ± 10.37 | 60.44 ± 10.88 | 0.8136 | ||
| Clinical findings (%) | |||||||
| Bradykinesia | 374 (99.73) | 80 (100.00) | 181 (100.00) | 113 (99.12) | 1.0000 | ||
| Resting tremor | 265 (70.67) | 61 (76.25) | 130 (71.82) | 74 (64.91) | 0.2006 | ||
| Rigidity | 366 (97.60) | 79 (98.75) | 176 (97.24) | 111 (97.37) | 0.7006 | ||
| Asymmetric onset | 283 (75.47) | 59 (73.75) | 137 (75.69) | 87 (76.32) | 0.8749 | ||
| Postural instability | 191 (50.93) | 41 (51.25) | 84 (46.41) | 66 (57.89) | 0.1335 | ||
| UPDRS total (Mean ± SD) | 32.78 ± 15.70 | 33.12 ± 15.10 | 31.51 ± 15.06 | 34.47 ± 16.96 | 0.2322 | ||
| UPDRS subscale 1 | 1.83 ± 1.70 | 1.93 ± 1.68 | 1.70 ± 1.58 | 1.98 ± 1.89 | 0.3412 | ||
| UPDRS subscale 2 | 9.50 ± 5.84 | 9.98 ± 6.43 | 9.20 ± 5.49 | 9.66 ± 5.96 | 0.5830 | ||
| UPDRS subscale 3 | 19.32 ± 10.09 | 19.71 ± 9.47 | 18.31 ± 9.67 | 20.58 ± 11.01 | 0.1628 | ||
| UPDRS subscale 4 | 2.35 ± 2.18 | 2.13 ± 2.04 | 2.46 ± 2.32 | 2.33 ± 2.03 | 0.5361 | ||
| Hoehn and Yahr | 2.16 ± 0.75 | 2.30 ± 0.84 | 2.06 ± 0.66 | 2.21 ± 0.81 | 0.0459 | ||
| MMSE | 28.19 ± 2.46 | 29.27 ± 1.10 | <0.0001 | 28.00 ± 2.82 | 28.36 ± 2.24 | 28.03 ± 2.53 | 0.2094 |
| Medications (%) | |||||||
| De novo | 50 (13.33) | 9 (11.25) | 28 (15.47) | 13 (11.40) | 0.5009 | ||
| Carbidopa+levodopa | 250 (66.67) | 53 (66.25) | 118 (65.19) | 79 (69.30) | 0.6640 | ||
| Ropinirole | 53 (14.13) | 12 (15.00) | 26 (14.36) | 15 (13.16) | 0.9466 | ||
| Pramipexole | 106 (28.27) | 22 (27.50) | 48 (26.52) | 36 (31.58) | 0.5869 | ||
| Amantadine | 37 (9.87) | 5 (6.25) | 19 (10.50) | 13 (11.40) | 0.4405 | ||
| Entacapone | 52 (13.87) | 9 (11.25) | 27 (14.92) | 16 (14.04) | 0.7188 | ||
| Trihexyphenidyl | 15 (4.00) | 2 (2.50) | 5 (2.76) | 8 (7.02) | 0.1341 | ||
| Carbidopa+levodopa+entacapone | 39 (10.40) | 9 (11.25) | 17 (9.39) | 13 (11.40) | 0.8155 | ||
| Selegiline | 25 (6.67) | 3 (3.75) | 15 (8.29) | 7 (6.14) | 0.3843 | ||
| Rasagiline | 32 (8.53) | 8 (10.00) | 15 (8.29) | 9 (7.89) | 0.8735 | ||
| Other PD meds | 36 (9.60) | 6 (7.50) | 21 (11.60) | 9 (7.89) | 0.4790 | ||
T-test or χ2 test was used to estimate the significance between cases and controls for numerical or nominal variables, respectively.
The right side of the table shows clinical characteristics of cases with PD carrying two (GG), one (AG), or no risk allele (AA).
In columns 5, 6, and 7, % of cases per genotype are shown in parenthesis.
ANOVA or χ2 test was used to explore differences in clinical characteristics within PD cases of distinct genotypes; note that P values shown were not adjusted for the multiple clinical characteristics explored.
Table 2.
Association between the intron-4 SNCA polymorphism rs2736990 and risk of PD
| Diagnostic Criteria | N | MAF† (%) | Additive* | Dominant | Recessive | Allelic | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| PD | Control | PD | Control | OR (95% CI) | P | OR (95% CI) | P | OR (95% CI) | P | OR (95% CI) | P | |
| UKPDSBB | 344 | 275 | 54.51 | 45.94 | 1.40 (1.12–1.76) | 0.0032 | 1.60 (1.08–2.36) | 0.0183 | 1.54 (1.04–2.28) | 0.0297 | 1.41 (1.11–1.78) | 0.0052 |
| PD Specialist | 375 | 275 | 54.53 | 45.94 | 1.40 (1.12–1.75) | 0.0026 | 1.59 (1.09–2.34) | 0.0173 | 1.55 (1.06–2.28) | 0.0245 | 1.41 (1.14–1.78) | 0.0043 |
Odds ratio (OR) and 95% confidence interval (CI) were calculated for minor allele, adjusted for age and sex.
Minor allele frequency.
Linear trend for zero, one or two minor alleles.
DISCUSSION
α-Synuclein is central to the pathobiology of PD. Simply genetically increasing the expression of the α-synuclein gene (SNCA) by 50–100% through locus multiplication unequivocally causes autosomal dominant Parkinson’s [2]. Although small, over years these increases in wild-type SNCA expression are sufficient to bring death to a majority of vulnerable dopamine neurons. Whereas mutations in SNCA have long been linked to rare autosomal dominant forms of PD, a substantial genetic contribution of this gene to sporadic PD has only recently been appreciated [3]. A recent genome-wide association study highlighted an association between the rs2736990 variant in SNCA intron-4 and common, sporadic PD [3]. Here we confirmed this association in an independent, clinically well-characterized population. This intronic variant, together with the REP1 SNCA promoter polymorphism [4] and other implicated 5′ and 3′ variants [3,5], suggests a genetic role for non-coding variants in SNCA in conferring susceptibility to some forms of the common “sporadic” disease. How such polymorphisms enhance susceptibility to PD is unclear. It is possible that rs2736990 or an as yet unidentified linked causal sequence variant may regulate transcription of SNCA either directly through a cis-acting mechanism or indirectly through interaction with transcriptional enhancers [6] and repressors. Pinpointing the true PD-associated variants in SNCA and their mechanism and clarifying the relation to early mitochondrial dysfunction [7] will be important challenges for future research.
Acknowledgments
Funding sources: This study was funded by NIH grants R01 NS064155 (C.R.S.), R21 NS060227 (C.R.S.), K24 NS060991 (M.A.S.), the Harvard NeuroDiscovery Center (to C.R.S. and B.T.H.), the Michael J. Fox Foundation (grants to C.R.S., M.G.S., and J.H.G., respectively), the M.E.M.O. Hoffman Foundation (C.R.S.), and the RJG Foundation (C.R.S.).
We thank all our patients and their families and friends for their support and participation.
HARVARD NEURODISCOVERY CENTER BIOMARKER STUDY
Co-Directors: Harvard NeuroDiscovery Center: Clemens R. Scherzer, Bradley T. Hyman, Adrian J. Ivinson; Investigators and study coordinators: Harvard NeuroDiscovery Center: Nancy E. Maher, Alison K. Sarokhan, Kaitlin C. Lockhart, Andrea Santarlasci; Brigham and Women’s Hospital: Lewis R. Sudarsky, Michael T. Hayes, Reisa Sperling, Elizabeth Hart; Massachusetts General Hospital: John H. Growdon, Michael A. Schwarzschild, Albert Y. Hung, Alice W. Flaherty, Deborah Blacker, Anne-Marie Wills, U. Shivraj Sohur, Vivek K. Unni, Nicte I. Mejia, Anand Viswanathan, Stephen N. Gomperts, Mark W. Albers, Kyleen E. Swords, Rebecca K. Rudel, Jon T. Hirschberger; University of Ottawa: Michael G. Schlossmacher; Scientific Advisory Board: Massachusetts General Hospital: John H. Growdon, Brigham and Women’s Hospital: Lewis R. Sudarsky, Dennis J. Selkoe, Reisa Sperling; Harvard School of Public Health: Alberto Ascherio; Biogen Idec: Bernard M. Ravina; Data coordination: Harvard NeuroDiscovery Center: Binish Khadka, Oscar A. Padilla, Bin Zheng; Massachusetts General Hospital: Joseph J. Locascio; Biobank management staff: Harvard NeuroDiscovery Center: Sarah S. Roderick, Caroline G. Kan, Sunny Chang, Zhixiang Liao.
Author Roles: HD: Research project (conception, organization, and execution), statistical analysis (design and execution), manuscript (writing of the first draft); AKS: research project (organization and execution), manuscript (review and critique); SSR: research project (organization and execution), manuscript (review and critique); RB: research project (execution), manuscript (review and critique); NEM: research project (conception, organization, and execution), manuscript (review and critique); PA: research project (execution), manuscript (review and critique); CGK: research project (organization and execution), manuscript (review and critique); SC: research project (organization and execution), manuscript (review and critique); AS: research project (organization and execution), manuscript (review and critique); KS: research project (organization and execution), manuscript (review and critique); BR: research project (conception and organization), statistical analysis (review and critique), manuscript (review and critique). MTH: research project (execution), manuscript (review and critique); USS: research project (execution), manuscript (review and critique); AW: research project (execution), manuscript (review and critique); AWF: research project (execution), manuscript (review and critique); VKU: research project (execution), manuscript (review and critique); AYH: research project (execution), manuscript (review and critique); DJS: research project (organization and execution), manuscript (review and critique); MAS: research project (execution), manuscript (review and critique); MGS: research project (conception, organization, and execution), manuscript (review and critique); LRS: research project (execution), manuscript (review and critique); JHG: research project (conception, organization, and execution), manuscript (review and critique); AJI: research project (conception and organization), manuscript (review and critique); BTH: research project (conception, organization, and execution), manuscript (review and critique); CRS: research project (conception, organization, and execution), statistical analysis (design, execution, and review and critique), manuscript (writing of the first draft and review and critique).
Footnotes
Financial Disclosures: Hongliu Ding—Employment: Harvard Medical School, Brigham and Women’s Hospital, and FDA; Alison K. Sarokhan—Employment: Brigham and Women’s Hospital; Sarah S. Roderick—Employment: Brigham and Women’s Hospital; Rachit Bakshi—Employment: Harvard Medical School and Brigham and Women’s Hospital; Nancy E. Maher—Employment: Brigham and Women’s Hospital; Paymon Ashourian—Employment: Brigham and Women’s Hospital and Massachusetts Institute of Technology; Caroline G. Kan—Employment: Brigham and Women’s Hospital; Sunny Chang—Employment: Brigham and Women’s Hospital; Andrea Santarlasci—Employment: Massachusetts General Hospital; Kyleen E. Swords—Employment: Massachusetts General Hospital; Bernard M. Ravina—Employment: Biogen Idec, Inc.; Michael T. Hayes—Employment: Brigham and Women’s Hospital; U. Shivraj Sohur—Massachusetts General Hospital; Anne-Marie Wills—Employment: Massachusetts General Hospital; Alice W. Flaherty—Employment: Massachusetts General Hospital, Contracts: Neurologix, Inc.; Vivek K. Unni—Employment: Massachusetts General Hospital; Albert Y. Hung—Employment: Massachusetts General Hospital and Brigham and Women’s Hospital; Dennis J. Selkoe—Employment: Harvard Medical School and Brigham and Women’s Hospital; Michael A. Schwarzschild—Employment: Massachusetts General Hospital, Grants: NIH; Michael G. Schlossmacher—Employment: University of Ottawa, Grants: Michael J. Fox Foundation; Lewis R. Sudarsky—Employment: Brigham and Women’s Hospital; John H. Growdon—Employment: Massachusetts General Hospital, Grants: Michael J. Fox Foundation; Adrian J. Ivinson—Employment: Harvard Medical School; Bradley T. Hyman—Employment: Harvard Medical School and Massachusetts General Hospital, Grants: Harvard NeuroDiscovery Center; Clemens R. Scherzer—Employment: Harvard Medical School, Brigham and Women’s Hospital, and Massachusetts General Hospital, Consultancies: Link Medicine Corp and Michael J. Fox Foundation, Partnerships: DiaGenic and Pfizer, Grants: NIH, Harvard NeuroDiscovery Center, Michael J. Fox Foundation, M.E.M.O. Hoffman Foundation, and the RJG Foundation.
References
- 1.Hughes AJ, Daniel SE, Ben-Shlomo Y, Lees AJ. The accuracy of diagnosis of parkinsonian syndromes in a specialist movement disorder service. Brain. 2002;125:861–70. doi: 10.1093/brain/awf080. [DOI] [PubMed] [Google Scholar]
- 2.Singleton AB, Farrer M, Johnson J, et al. Alpha-Synuclein locus triplication causes Parkinson’s disease. Science. 2003;302:841. doi: 10.1126/science.1090278. [DOI] [PubMed] [Google Scholar]
- 3.Simon-Sanchez J, Schulte C, Bras JM, et al. Genome-wide association study reveals genetic risk underlying Parkinson’s disease. Nat Genet. 2009;41:1308–12. doi: 10.1038/ng.487. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Chiba-Falek O, Nussbaum RL. Effect of allelic variation at the NACP-Rep1 repeat upstream of the alpha-synuclein gene (SNCA) on transcription in a cell culture luciferase reporter system. Hum Mol Genet. 2001;10:3101–9. doi: 10.1093/hmg/10.26.3101. [DOI] [PubMed] [Google Scholar]
- 5.Mueller JC, Fuchs J, Hofer A, et al. Multiple regions of alpha-synuclein are associated with Parkinson’s disease. Ann Neurol. 2005;57:535–41. doi: 10.1002/ana.20438. [DOI] [PubMed] [Google Scholar]
- 6.Scherzer CR, Grass JA, Liao Z, et al. GATA transcription factors directly regulate the Parkinson’s disease-linked gene alpha-synuclein. Proc Natl Acad Sci U S A. 2008;105:10907–12. doi: 10.1073/pnas.0802437105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Zheng B, Liao Z, Locascio JJ, et al. PGC-1α, a potential therapeutic target for early intervention in Parkinson’s disease. Sci Transl Med. 2010;2:52ra73. doi: 10.1126/scitranslmed.3001059. [DOI] [PMC free article] [PubMed] [Google Scholar]