Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2012 Apr 29.
Published in final edited form as: Cell Rep. 2012 Mar 29;1(3):208–214. doi: 10.1016/j.celrep.2012.01.004

Functional consequences of subunit diversity in RNA PolymerasesII and V

Ek Han Tan 1,2, Todd Blevins 1, Thomas S Ream 2,3, Craig S Pikaard 1,4,*
PMCID: PMC3339255  NIHMSID: NIHMS368660  PMID: 22550619

Summary

Multisubunit RNA polymerases IV and V(Pol IV and Pol V) evolved as specialized forms of Pol II that mediate RNA-directed DNA methylation (RdDM) and transcriptional silencing of transposons, viruses and endogenous repeats in plants. Among the subunits common to Arabidopsis thaliana Pols II, IV and V are 93% identical alternative ninth subunits, NRP(B/D/E) 9a and NRP(B/D/E) 9b. The 9a and 9b subunit variants are incompletelyredundant with respect to Pol II; whereas double mutants are embryo lethal, single mutants are viable, yet phenotypically distinct. Likewise, 9a or 9bcanassociate with Pols IV or Vbut RNA-directed DNA methylation is impaired only in 9b mutants. Based on genetic and molecular tests, we attribute the defect in RdDM to impaired Pol V function. Collectively, our results reveal a role for the ninth subunit in RNA silencing and demonstrate that subunit diversity generates functionally distinct subtypes of RNA polymerases II and V.

Introduction

Eukaryotes decode their genomes using three essential nuclear DNA-dependent RNA polymerases, RNA Polymerases I, II, and III (abbreviated as Pol I, Pol II and Pol III)(Cramer et al., 2008; Werner and Grohmann, 2011). In plants, two additional multisubunitRNA polymerases, Pol IV and Pol V, are not strictly required for viability but are important for development, transposon taming, anti-viral and anti-bacterial defense, and inter-allelic communications mediating paramutation(Haag and Pikaard, 2011).

Pol IV and Pol V functions are best understood with respect to RNA-directed DNA methylation(Haag and Pikaard, 2011; Herr et al., 2005; Kanno et al., 2005; Onodera et al., 2005; Pontier et al., 2005), a process in which 24nt short interfering RNAs (siRNAs) direct the cytosine methylation, and silencing, of complementary DNA sequences. Pol IVacts early in the pathway, working in partnership with RNA-DEPENDENT RNA POLYMERASE 2 to produce double-stranded RNAs that are diced into siRNAs and loaded (primarily) into ARGONAUTE 4(AGO4) (Law and Jacobsen, 2010). Independent of siRNA biogenesis, Pol V generates RNA transcripts at loci that undergo RdDM(Wierzbicki et al., 2008) and AGO4 binds these Pol V transcripts(Wierzbicki et al., 2009)as well as Pol V itself (El-Shami et al., 2007). Chromatin modifying activities are subsequently recruited, resulting in de novo cytosine methylation and establishment of repressive his tone modifications(Haag and Pikaard, 2011; Law and Jacobsen, 2010).

Arabidopsis thaliana Pols II, IV and Veach have twelvecore subunits(Ream et al., 2009). Pol II, IV and V largest subunits are encoded by unique genes: NRPB1, NRPD1 and NRPE1, respectively (“NRP” denotes “Nuclear RNA Polymerase”; “B, D, and E”, as the second, fourth and fifth letters of the alphabet, denote Pols II, IV or V; the numeral 1 indicates the largest subunit). Pol IV and V second-largest subunits are encoded by the same gene, NRP(D/E)2, which is distinct from the corresponding Pol II subunit gene, NRPB2(Herr et al., 2005; Kanno et al., 2005; Onodera et al., 2005; Pontier et al., 2005). The two largest subunits interact to form the catalytic center for RNA synthesis, with non-catalytic subunits playing structural and regulatory roles for initiation, elongation, termination or RNA processing(Cramer et al., 2008; Werner and Grohmann, 2011). Most of the non-catalytic subunits of Pols II, IV and V are encoded by the same genes (Ream et al., 2009).

In yeast, the twelve Pol II subunits are each encoded by unique genes, ten of which are essential. One of the nonessential genes encodes the ninth-largest subunit, Rpb9. rpb9 deletion strainsare viable, but temperature-sensitive (Woychik et al., 1991). Rpb9 isimplicated in multiple aspects of polymerase II function, including initiation (Hull et al., 1995; Sun et al., 1996), processivity(Awrey et al., 1997; Hemming et al., 2000), transcriptional fidelity, proofreading(Koyama et al., 2007; Nesser et al., 2006; Walmacq et al., 2009)and transcription-coupled DNA repair(Li et al., 2006).

Unlike yeast and metazoans, Arabidopsis thaliana and Populustrichocarpa (poplar) each have two genes orthologous to RBP9, and maize and rice have three (Figure 1; Figure S1). Orthologs of yeast Rpa12 and Rpc11, the Rpb9-like subunits of Pols I and III, respectively, form separate clades (Figure 1). Both Arabidopsis Rpb9orthologsco-purify with affinity-purified RNA polymerases II, IV or V(Law et al., 2011; Ream et al., 2009), such that their comprehensive names are NRP(B/D/E)9a and NRP(B/D/E)9b. Despite the fact that the two proteins differ at only 8 of their 114 amino, we show here that these ninth subunit variants are incompletely redundant for Pol II and non-redundant for Pol V functions.

Figure 1.

Figure 1

Open in a new tab

Phylogenetic relationships among eukaryotic RNA polymerase subunits homologous to yeast Rpb9.

Human, Drosophila, zebrafish, Chlamydomonas, Arabidopsis, poplar, maize or rice proteins homologous to yeast (S. cerevisiae) Rpb9 (Pol II), or its Pol I or Pol III paralogs, were identified by searching the NCBI Reference Sequence (RefSeq) or maizeGBD (in the case of Zea mays GRMZM2G009673) databases using BLASTp. Multiple alignment of the sequenceswas conducted using MUSCLE (see Figure S1) in order to generate the phylogenetic tree. Bootstrap valuesare indicated for each branchpoint.

Results

Subunits 9a and 9b are redundant for viability

Arabidopsis NRP(B/D/E)9a (At3g16980)and NRP(B/D/E)9b (At4g16265) genes have similar intron/exon structures (Figure 2A). T-DNA insertion alleles, designated nrp(b/d/e)9a-1 (Salk_032670) and nrp(b/d/e)9b-1 (Salk_031043), are disrupted within introns 2 or 1, respectively (Figure 2a). Transcripts of the 9a and 9b (abbreviated for brevity) genes are readily detected in wild-type plants (Figure 2b) but notin 9a-1 or9b-1 mutants (Figure 2c). Wild-type (ecotype Col-0) and 9a-1 mutant plants are indistinguishable, but leaves of 9b-1 mutants are more ovate, have shorter petioles and displayless downward edge curling(Figure 2c). Other 9b-1 phenotypes include smaller trichomes on the first true leaves, more prominent leaf midveins, changes in the cuticularwax coating on the leaves, and shorter siliques. These morphological differences presumably result from altered Pol II-dependent gene expression given that null mutations eliminating Pol IV or Pol Vlargest subunits (nrpd1-3 or nrpe1-11, respectively) do not induce similar phenotypes. Moreover, 9b-1 phenotypes are neither suppressed nor enhanced in 9b-1 nrpd1-3or 9b-1 nrpe1-11double mutants.

Figure 2.

Figure 2

Open in a new tab

NRP(B/D/E)9a and 9b are redundant for viability.

(A) Positions of T-DNA insertions within the nrp(b/d/e)9a-1 and nrp(b/d/e)9b-1 alleles are indicated by triangles. Filled boxes represent exons; lines within boxes represent introns. Genes At3g16980 and At4g16265 encode the 9a and 9b protein sequences whose accession numbers (shown in Figures 1 and S1) are NP_188323 and NP_567490, respectively.

(B) RT-PCR amplification of NRP(B/D/E)9a, NRP(B/D/E)9b or actin mRNAs in wild-type (Col-0), Pol V largest subunit null mutant (nrpe1-11), or 9a-1 or 9b-1 mutant plants. Actin RT-PCR reactions in which reverse transcriptase was omitted were also conducted (bottom row) to assess potential DNA contamination of the RNA samples.

(C) Vegetative phenotypes of three-week old wild-type (Col-0), 9a-1 mutant or 9b-1 mutant plants.

(D) Ovules within a silique of a plant homozygous for 9a-1 and heterozygous for 9b-1 (upper image). Opaque ovules (blue arrows) contain fully developed embryos whose primary roots and (folded-over) cotyledons can be observed by differential interference microscopy (image at lower left). By contrast, translucent ovules (red arrows), occurring at the expected frequency of 9a-1 9b-1 double mutants, lack mature embryos (bottom center and bottom right images). The image at bottom right shows a blow-up of the region circled in the bottom center image, revealing an embryo arrested at the globular stage of development.

(E) Homozygous 9a-1 9b-1 double mutants are not recovered among seedling progeny of plants homozygous for 9a-1 or 9b-1 and heterozygous for the other allele. Heterozygote under-representation results from reduced transmission of mutant alleles via both the male and female gametophytes (see supplemental Figure S2).

To test 9a and 9b redundancy, homozygous 9a-1 and 9b-1 mutants were crossed, resulting F1 plants were selfed, and their progenygenotyped. In siliques of F2 plants homozygous for 9a-1 and heterozygous for 9b-1, in which 25% of the F3 seeds are expected to be homozygous 9a-19b-1 double mutants, 30 % (55/181 analyzed) of the seeds arrested in developmentand 70% developed normally(Figure 2d). Similarresults were observed for the progeny of plants homozygous for 9b-1 but heterozygous for 9a-1. In arrested seeds, which are translucent, embryos failed to develop past the globular stage (Figure 2d). Among plants germinated from seeds collected from siliques of plants that were homozygous for either 9a-1 or 9b-1 and heterozygous for the other mutation, no 9a-1 9b-1 double mutants were identified (Figure 2e). Because lethality is a consequence of lost Pol II function(Onodera et al., 2008), but not disrupted Pol IV or Pol V function(Herr et al., 2005; Kanno et al., 2005; Onodera et al., 2005; Pontier et al., 2005; Ream et al., 2009), we conclude that the 9a and 9b subunits are mostly redundant with respect toPol II functions required for viability and development, such that only the double mutant is embryo lethal.

Among the progeny of heterozygotes carryinga recessive allele of an essential gene, heterozygotes should outnumber homozygotes 2:1. However, we observed a nearly 1:1 ratio of heterozygotes to homozygous wild-type plants (Figure 2e), suggesting a defect in male or female (or both) transmission of the mutant alleles. Reciprocal crosses showed reduced transmission of 9a-1 or 9b-1 alleles through both the male and female gametophytes (Figure S2). This allele transmission behavior differs from null mutations eliminating catalytic subunits of Pols I, II or III, which show zero transmission via the egg donor (Onodera et al., 2008).

Subunit 9b is required for RNA silencing

Loci silenced by Pol IV and Pol V include soloLTR and AtSN1 retro elements, whose expression is undetectable in wild-type plants (Col-0) but prevalent in nrpd1-3 (Pol IV largest subunit) or nrpe1-11 (Pol V largest subunit) mutants (Figure 3A). In 9a-1 mutants, soloLTR and AtSN1 silencing is unaffected. However, these retroelements are derepressed in 9b-1 mutants(Figure 3A).

Figure 3.

Figure 3

Open in a new tab

9b-1 mutants are defective for RNA-directed DNA methylation and silencing.

(A) RT-PCR analysis of soloLTR and AtSN1 retroelement expression, comparing Pol IV and Pol V largest subunit null mutants, nrpd1-3 and nrpe1-11, respectively, with 9a-1, 9b-1 andwild-type (Col-0). The loss of silencing in the 9b-1 mutant is restored by a full-length 9b transgene (see Supplemental Figure S3).

(B) Cytosine methylation assay involving PCR amplification of soloLTR and AtSN1 retrotransposons following incubation of genomic DNA with the methylation sensitive restriction endonucleases, HaeIII or AluI. The control locus, At2g19920, lacks HaeIII sites. Diagrams show positions of restriction endonuclease recognition sites within the amplicon.

(C) Southern blot analysis of tandemlyrepeated 5SrRNA genes following digestion of genomic DNA with HaeIII.

(D) RNA blot hybridization analysis of inflorescence small RNAs using 5S rRNA gene (siR1003), soloLTR, and microRNA (miR160) probes. The same blot was stripped and rehybridized sequentially. miR160serves as an RNA loading control.

Retrotransposon silencing correlates with Pol IV and Pol V-dependent RNA-directed DNA methylation (RdDM), rendering methylation-sensitive AluI sites within soloLTR elements and HaeIII sites within AtSN1 elements resistant to AluI or Hae IIIdigestion. Consequently, PCR using primers that flank the restriction sites amplifies the interval in wild-type (Col-0) plants (Figure 3B). However, in nrpd1-3 or nrpe1-11 mutants, loss of RdDM allows AluI and HaeIII to cleave the DNA, and PCRfails (Figure 3B). Methylation is similarly lost in 9b-1 mutants, but not in 9a-1 mutants (Figure 3B).

Tandemly repeated 5S ribosomal RNA genes are also subject to RdDM. Southern blots of genomic DNA digested with HaeIII and hybridized to a 5SrRNAgene probe show a ladder of bands in wild-type Col-0 plants (Figure 3C), with larger bands reflecting increased methylation among adjacent genes. HaeIII methylation is reduced in nrpd1-3, nrpe1-1 and9b-1 mutants, but not in 9a-1 mutants.

A complete NRP(B/D/E)9b transgene, transcribed from its native promoter and containing all its introns, rescues all 9b-1 mutant phenotypes, restoringwild-type leaf morphologies(Figure S3a), NRP(B/D/E)9b mRNA production (Figure S3b), AtSN1 and soloLTR silencing (Figure S3b) and cytosine methylation (Figure S3c). We conclude that 9b-1 mutant phenotypes are due solely to mutation of the NRP(B/D/E)9b gene.

Pol IV function is not impaired in 9b-1 mutants

Pol IV is required for the biogenesis of ∼95 % of all 24 nt siRNAs(Herr et al., 2005; Kanno et al., 2005; Mosher et al., 2008; Onodera et al., 2005; Pontier et al., 2005; Zhang et al., 2007). For instance, 24 nt siRNAs corresponding to 5SrRNA genes and solo LTR retro transposons are severely depleted in nrpd1-3 mutants (Figure 3D)(Onodera et al., 2005). In 9a-1 or 9b-1 mutants, siRNAs are detected at wild-type levels, suggesting that Pol IV activity is not impaired. Interestingly, reductions in siRNA levels observed in nrpe1 mutants are also not apparent in 9a-1 or 9b-1 mutants, suggesting that RNA synthesis by Pol V is also unimpaired.

MRD1 is representative of a small set of Arabidopsis loci at which RdDM and silencing requires Pol IV but not Pol V. Thus, MRD1 is expressed at low levels in Pol V mutants (nrpe1-11), as in wild-type plants, but is substantially derepressed in Pol IV mutants (nrpd1-3), unlike AtSN1 or solo LTR elements that require both Pol IV and Pol V for silencing (Figure 4A). In 9a-1 or 9b-1 mutants, MRD1 is not derepressed, suggesting that Pol IV function is not impaired in either single mutant (Figure 4A, lanes 4 and 5).

Figure 4.

Figure 4

Open in a new tab

NRPB9b is not required for Pol V-dependent transcription or Pol IV-mediated silencing.

(A) Pol IV-dependent, but Pol V-independent, silencing of locus MRD1. RNA isolated from wild-type (Col-0), nrpd1-3, nrpe1-11, 9a-1 or 9b-1 mutants was subjected to RT-PCR using primers specific for MRD1, soloLTR or AtSN1.

(B) Detection of Pol V transcripts at IGN5using RT-PCR. Col-0, nrpd1-3, 9a-1, 9b-1 and nrpe1-11 are compared.

(C) Amino acid sequence alignment of yeast Rpb9 with Arabidopsis NRP(B/D/E)9a and NRP(B/D/E)9b. Amino acids that differ in the 9a and 9b subunits are highlighted. Numbers correspond to amino acid positions of the Arabidopsis 9a and 9b proteins, and not (necessarily) to yeast Rpb9.

(D) Locations of the eight amino acids that are polymorphic in the Arabidopsis 9a and 9b subunits, mapped (in red) onto a space-filling rendering of yeast Rpb9 (green) within a Pol II elongation complex (PDB:1Y1W). Rpb1 is colored grey, Rpb2 is blue, Rpb5 is gold and the DNA is pink. The image on the right is rotated clockwise relative to the image on the left to show the position of the DNA duplex. Rpb9 amino acids colored red correspond to the amino acids that align with the polymorphic amino acids of the Arabidopsis 9a and 9b subunits, and are numbered based on the Arabidopsis sequences.

Pol V transcripts are produced in 9b mutants

Pol V transcripts can be detected at specific intergenic loci such as IGN5(Law et al., 2010; Wierzbicki et al., 2008; Wierzbicki et al., 2009), therefore we examined whether 9b-1 mutants are impaired for Pol V transcription. IGN5 transcripts are readily detected in wild-type plants or Pol IV mutants (nrpd1) but are substantially reduced in nrpe1 mutants (Figure 4B). IGN5 transcript abundance is not affected in the 9b-1 mutant(Figure 4B), suggesting that Pol V's ability to synthesize RNA is not impaired and that a step downstream of RNA synthesis might be impaired, instead.

Discussion

In mutants lacking the 9b subunit, Pol IV-dependent siRNA biogenesis is not impaired, nor is silencing of MRD1, a locus whose RdDM and repression is dependent on Pol IV but not Pol V. However, loci that require both Pol IV and Pol V for silencing are derepressed in 9b-1 mutants. Based on these observations, we deduce that loss of silencing in 9b-1 mutants is due to a defect in Pol V function. Interestingly, Pol V transcription does not appear to be impaired in 9b-1 mutants, based on IGN5 transcript production and siRNA abundance at loci where siRNA levels depend, in part, on Pol V activity. Therefore, we reason that the impairment of Pol V function in 9b mutants is not due to a decreased ability of Pol V to synthesize RNA, but an impairment of a regulatory function, possibly mediated by interactions with other proteins. Consistent with this hypothesis, the eight amino acids that are different in the 9a and 9b subunits are predicted to be exposed on the surface of the proteins, based on their homology to yeast Rpb9 (Figure 4C), whose structure is known. Figure 4D shows a space filling model in which the predicted positions of the polymorphic amino acids of 9a and 9b are mapped onto the corresponding amino acid positions of Rpb9 within a yeast Pol II elongation complex (PDB:1Y1W) (Kettenberger et al., 2004).

Rpb9 has two zinc finger domains, Zn1 and Zn2, which are located near the N- and C-termini of the protein. The Zn2 domain shares homology with the elongation/transcript cleavage factor, TFIIS and is thought to catalyzetranscript cleavage eventsin partnership with TFIIS. Transcript cleavage is important for RNA 3′-end processing, transcription termination, and polymerase backtracking that allows for correction of misincorporated nucleotides, escape from an arrested state, or DNA repair at damaged sites (Awrey et al., 1997; Hemming et al., 2000; Koyama et al., 2007; Nesser et al., 2006; Walmacq et al., 2009). The Rpb9-paralogous subunits of Pols I and III, Rpa12 and Rpc11, also possess transcript cleavage activity and are stronger endonucleases than Rpb9, suggesting that Rpb9 has evolved to be regulated by TFIIS or other factors (Ruan et al., 2011). Several of the amino acid differences between NRP(B/D/E) 9a and NRP(B/D/E)9b occur within the Zn2 domain (amino acids 77, 82 and 109). Arabidopsis has multiple genes encoding TFIIS-like proteins, leading us to speculate that the eight amino acids that differ between the 9a or 9b proteins might specify interactions with different TFIIS-like proteins, or with proteins that mediate chromatin modifications at Pol V-transcribed loci.

The single multisubunit RNA polymerases used by archaeaclosely resembleeukaryotic RNA Polymerase IIexcept that they lack an Rpb9-like subunit (Werner and Grohmann, 2011); likewise, yeast strains deleted for the RPB9 geneare viable (Woychik et al., 1991). These observations have suggested that Rpb9 is an important, but non-essential, regulatory subunit in eukaryotes. However, our results show thatNRPB9 function is essentialin Arabidopsis. Either NRPB9a or NRPB9b (the subunitsnamed in the context of Pol II) is sufficient for viability, butembryogenesis cannot be completed in nrpb9a nrpb9b double mutants.

It is noteworthy that nrpb9a nrpb9b mutants develop further than do null mutants for catalytic subunits of Pols I, II and III, in which female gametophytes fail to develop and are never fertilized, such that no embryogenesis takes place (Onodera et al., 2008). Therefore, NRPB9-mediated functions may be partially dispensable in plants, as in yeast and archaea, specifically at the haploid gametophytic stage of the plant life cycle. However, NRPB9 functionis essential during the diploid sporophyte stage of the plant life cycle, at one or more steps required for embryo development, beginning at the globular embryo stage. NRPB9 functions must also affect later vegetative development in order to explain the distinct phenotypes of nrpb9b mutants.

Our data suggest that Pol IV functions are not impaired in 9a-1 or 9b-1 mutants. One possibility is that the ninth subunit is dispensable for Pol IV function. Alternatively, the 9a and 9b subunits might be redundant in the context of Pol IV, as they are for most Pol II functions. Unfortunately, the lethality of the 9a-1 or 9b-1 double mutant precludes an easy test of whether a functional ninth subunit is required for Pol IV activity.

Spectral counts of peptides detected upon mass spectrometric analyses of affinity purified Pol V suggest that the NRPE9a and NRPE9b-containing Pol V subtypes coexist in similar abundance. Our study elucidates a functional requirement for the NRPE9b-containing Pol V subtype (Pol V9b), but not the NRPE9a-containing form of Pol V (Pol V9a). Interestingly, affinity purification of the DDR complex (DRD1, DMS3 and RDM1), which is required for Pol V transcription at IGN5 and other loci(Law et al., 2010; Wierzbicki et al., 2009), resulted in co-purification of Pol V subunits that included NRPE9a (Law et al., 2010). One possibility is that Pol V9a functions only at specific loci. Alternatively, Pol V9a and Pol V9b may both be engaged atmost, or all loci subjected to RdDM. If so, the genetics indicate that Pol V9bis comprehensive in its functions, explaining the dispensability of the 9a gene (and Pol V9a), whereas Pol V9a has more limited functionality. By the same logic, Pol II9b must have broader functionality than Pol II9a in order to explain the mutant vegetative phenotypes of 9b-1 mutants, the wild-type phenotypes of 9a-1 mutants, but the lethality of the double mutant.

Materials and Methods

Plant material

nrp(b/d/e)9a-1 (Salk_032670) and nrp(b/d/e)9b-1 (Salk_031043) seeds were obtained from the Arabidopsis Biological Resource Center. Plants were grown on soil using an 18 hour light, 6 hour dark cycle. Genotyping PCR primers flanking the T-DNA insertions (Salk032670_LP: 5′cagacaaagaacagtgtcattcc, Salk032670_RP: 5′ttctggaattgcacctctctg, Salk031043_LP: 5′gatataaaggtgcatggggatatgc, Salk031043_RP: 5′taaactcattaaattatcattccttgg) were used in conjunction with a T-DNA left border primer (LBa1: tggttcacgtagtgggccatcg).

RT-PCR assays

Total RNA was purified from leaves of 3-week old plant using Trizol reagent (Invitrogen). 100 ng of RQ1 DNAse (Promega)-treated RNA was reverse transcribed using SuperScriptIII (Invitrogen) and gene specific primers. PCR of resulting cDNA was performed using Hot Start Taq (Fermentas). Primers for soloLTR, ATSN1 and Actin were previously described (Wierzbicki et al., 2008). Primers for NRPB9a and NRPB9b transcripts amplified 5′ untranslated regions: 9a_5′UTR: gtgattcagttttggttttggaacctaa, 9b_5′UTR: gtgaaatcaaagaagcattcaaaagctc, 9aRev: ttctctccagcgatgaccac and 9bRev: ttctctccaacggtgactacagtt.

DNA methylation assays

DNA was extracted using a Nucleon PhytoPure Genomic DNA Extraction Kit (GE Healthcare). 1ug DNA was subjected to restriction endonuclease digestion, agarose gel electrophoresis and Southern blot hybridization using a 5S rRNA gene probe as described in (Blevins et al., 2009). For methylation-sensitive PCR assays, 1 ug of DNA was digested overnight with the appropriate restriction enzyme (New England Biolabs) and 50 ng of DNA was subjected to PCR using GoTaq Green polymerase (Promega) and flanking primers (Wierzbicki et al., 2008).

Small RNA blots

RNA was purified from inflorescence tissue using an RNeasy Kit (Qiagen). 4 ug of low molecular weight RNA was subjected to electrophoresis on a 12% denaturing polyacrylamide gel and transferred to Hybond membranes (GE Healthcare). Prehybridization and hybridization in Perfect Hyb buffer (Sigma) was performed at 37°C. DNA oligonucleotide probes were 32P end-labeled using T4 Polynucleotide Kinase: siR1003: atgccaagtttggcctcacggtct, soloLTR: tgtcattatccatcattcatctctatccataag and miR160: tggcatacagggagccaggca.

Cloning and complementation

A genomic clone of NRP(B/D/E)9b was obtained by PCR amplification of A. thaliana genomic DNA using PFU Ultra DNA polymerase (Stratagene) and primers: 9bPromF: caccgcacttcaacaacccaattaca and 9bRev: ttctctccaacggtgactacagtt. PCR products captured in pENTR D/TOPO (Invitrogen) were recombined into pEARLEYGATE 302 (Earley et al., 2006)using LR CLonase II (Invitrogen) and transformed into nrp(b/d/e)9b-1 homozygous mutants using the floral dip method for Agrobacterium-mediated gene transfer (Clough and Bent, 1998)

Supplementary Material

01

Acknowledgments

This work was supported by grant GM07759 to C.S.P from the National Institutes of Health. T.B. was supported by a Ruth L. Kirschstein National Research Service Award. C.S.P. is an Investigator of the Howard Hughes Medical Institute and the Gordon and Betty Moore Foundation.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Contributor Information

Ek Han Tan, Email: ehtan@wustl.edu.

Todd Blevins, Email: toddblev@indiana.edu.

Thomas S. Ream, Email: tream@wisc.edu.

Craig S. Pikaard, Email: pikaard@indiana.edu.

References

  1. Awrey DE, Weilbaecher RG, Hemming SA, Orlicky SM, Kane CM, Edwards AM. Transcription elongation through DNA arrest sites. A multistep process involving both RNA polymerase II subunit RPB9 and TFIIS. J Biol Chem. 1997;272:14747–14754. doi: 10.1074/jbc.272.23.14747. [DOI] [PubMed] [Google Scholar]
  2. Blevins T, Pontes O, Pikaard CS, Meins F., Jr Heterochromatic siRNAs and DDM1 independently silence aberrant 5S rDNA transcripts in Arabidopsis. PLoS One. 2009;4:e5932. doi: 10.1371/journal.pone.0005932. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Clough SJ, Bent AF. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 1998;16:735–743. doi: 10.1046/j.1365-313x.1998.00343.x. [DOI] [PubMed] [Google Scholar]
  4. Cramer P, Armache KJ, Baumli S, Benkert S, Brueckner F, Buchen C, Damsma GE, Dengl S, Geiger SR, Jasiak AJ, et al. Structure of eukaryotic RNA polymerases. Annu Rev Biophys. 2008;37:337–352. doi: 10.1146/annurev.biophys.37.032807.130008. [DOI] [PubMed] [Google Scholar]
  5. Earley KW, Haag JR, Pontes O, Opper K, Juehne T, Song K, Pikaard CS. Gateway-compatible vectors for plant functional genomics and proteomics. Plant J. 2006;45:616–629. doi: 10.1111/j.1365-313X.2005.02617.x. [DOI] [PubMed] [Google Scholar]
  6. El-Shami M, Pontier D, Lahmy S, Braun L, Picart C, Vega D, Hakimi MA, Jacobsen SE, Cooke R, Lagrange T. Reiterated WG/GW motifs form functionally and evolutionarily conserved ARGONAUTE-binding platforms in RNAi-related components. Genes Dev. 2007;21:2539–2544. doi: 10.1101/gad.451207. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Haag JR, Pikaard CS. Multisubunit RNA polymerases IV and V: purveyors of non-coding RNA for plant gene silencing. Nature Rev Mol Cell Biol. 2011;12:483–492. doi: 10.1038/nrm3152. [DOI] [PubMed] [Google Scholar]
  8. Hemming SA, Jansma DB, Macgregor PF, Goryachev A, Friesen JD, Edwards AM. RNA polymerase II subunit Rpb9 regulates transcription elongation in vivo. J Biol Chem. 2000;275:35506–35511. doi: 10.1074/jbc.M004721200. [DOI] [PubMed] [Google Scholar]
  9. Herr AJ, Jensen MB, Dalmay T, Baulcombe DC. RNA polymerase IV directs silencing of endogenous DNA. Science. 2005;308:118–120. doi: 10.1126/science.1106910. [DOI] [PubMed] [Google Scholar]
  10. Hull MW, McKune K, Woychik NA. RNA polymerase II subunit RPB9 is required for accurate start site selection. Genes Dev. 1995;9:481–490. doi: 10.1101/gad.9.4.481. [DOI] [PubMed] [Google Scholar]
  11. Kanno T, Huettel B, Mette MF, Aufsatz W, Jaligot E, Daxinger L, Kreil DP, Matzke M, Matzke AJ. Atypical RNA polymerase subunits required for RNA-directed DNA methylation. Nat Genet. 2005;37:761–765. doi: 10.1038/ng1580. [DOI] [PubMed] [Google Scholar]
  12. Kettenberger H, Armache KJ, Cramer P. Complete RNA polymerase II elongation complex structure and its interactions with NTP and TFIIS. Mol Cell. 2004;16:955–965. doi: 10.1016/j.molcel.2004.11.040. [DOI] [PubMed] [Google Scholar]
  13. Koyama H, Ito T, Nakanishi T, Sekimizu K. Stimulation of RNA polymerase II transcript cleavage activity contributes to maintain transcriptional fidelity in yeast. Genes Cells. 2007;12:547–559. doi: 10.1111/j.1365-2443.2007.01072.x. [DOI] [PubMed] [Google Scholar]
  14. Law JA, Ausin I, Johnson LM, Vashisht AA, Zhu JK, Wohlschlegel JA, Jacobsen SE. A protein complex required for polymerase V transcripts and RNA- directed DNA methylation in Arabidopsis. Curr Biol. 2010;20:951–956. doi: 10.1016/j.cub.2010.03.062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Law JA, Jacobsen SE. Establishing, maintaining and modifying DNA methylation patterns in plants and animals. Nat Rev Genet. 2010;11:204–220. doi: 10.1038/nrg2719. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Law JA, Vashisht AA, Wohlschlegel JA, Jacobsen SE. SHH1, a homeodomain protein required for DNA methylation, as well as RDR2, RDM4, and chromatin remodeling factors, associate with RNA Polymerase IV. PLoS Gen. 2011;7:e1002195. doi: 10.1371/journal.pgen.1002195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Li S, Ding B, Chen R, Ruggiero C, Chen X. Evidence that the transcription elongation function of Rpb9 is involved in transcription-coupled DNA repair in Saccharomyces cerevisiae. Mol Cell Biol. 2006;26:9430–9441. doi: 10.1128/MCB.01656-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Mosher RA, Schwach F, Studholme D, Baulcombe DC. PolIVb influences RNA-directed DNA methylation independently of its role in siRNA biogenesis. Proc Natl Acad Sci U S A. 2008 doi: 10.1073/pnas.0709632105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Nesser NK, Peterson DO, Hawley DK. RNA polymerase II subunit Rpb9 is important for transcriptional fidelity in vivo. Proc Natl Acad Sci USA. 2006;103:3268–3273. doi: 10.1073/pnas.0511330103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Onodera Y, Haag JR, Ream T, Nunes PC, Pontes O, Pikaard CS. Plant nuclear RNA polymerase IV mediates siRNA and DNA methylation-dependent heterochromatin formation. Cell. 2005;120:613–622. doi: 10.1016/j.cell.2005.02.007. [DOI] [PubMed] [Google Scholar]
  21. Onodera Y, Nakagawa K, Haag JR, Pikaard D, Mikami T, Ream T, Ito Y, Pikaard CS. Sex-biased lethality or transmission of defective transcription machinery in Arabidopsis. Genetics. 2008;180:207–218. doi: 10.1534/genetics.108.090621. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Pontier D, Yahubyan G, Vega D, Bulski A, Saez-Vasquez J, Hakimi MA, Lerbs-Mache S, Colot V, Lagrange T. Reinforcement of silencing at transposons and highly repeated sequences requires the concerted action of two distinct RNA polymerases IV in Arabidopsis. Genes Dev. 2005;19:2030–2040. doi: 10.1101/gad.348405. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Ream TS, Haag JR, Wierzbicki AT, Nicora CD, Norbeck AD, Zhu JK, Hagen G, Guilfoyle TJ, Pasa-Tolic L, Pikaard CS. Subunit compositions of the RNA-silencing enzymes Pol IV and Pol V reveal their origins as specialized forms of RNA polymerase II. Mol Cell. 2009;33:192–203. doi: 10.1016/j.molcel.2008.12.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Ruan W, Lehmann E, Thomm M, Kostrewa D, Cramer P. Evolution of two modes of intrinsic RNA polymerase transcript cleavage. J Biol Chem. 2011;286:18701–18707. doi: 10.1074/jbc.M111.222273. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Sun ZW, Tessmer A, Hampsey M. Functional interaction between TFIIB and the Rpb9 (Ssu73) subunit of RNA polymerase II in Saccharomyces cerevisiae. Nucleic Acids Res. 1996;24:2560–2566. doi: 10.1093/nar/24.13.2560. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Walmacq C, Kireeva ML, Irvin J, Nedialkov Y, Lubkowska L, Malagon F, Strathern JN, Kashlev M. Rpb9 subunit controls transcription fidelity by delaying NTP sequestration in RNA polymerase II. J Biol Chem. 2009;284:19601–19612. doi: 10.1074/jbc.M109.006908. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Werner F, Grohmann D. Evolution of multisubunit RNA polymerases in the three domains of life. Nat Rev Microbiol. 2011;9:85–98. doi: 10.1038/nrmicro2507. [DOI] [PubMed] [Google Scholar]
  28. Wierzbicki AT, Haag JR, Pikaard CS. Noncoding transcription by RNA polymerase Pol IVb/Pol V mediates transcriptional silencing of overlapping and adjacent genes. Cell. 2008;135:635–648. doi: 10.1016/j.cell.2008.09.035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Wierzbicki AT, Ream TS, Haag JR, Pikaard CS. RNA polymerase V transcription guides ARGONAUTE4 to chromatin. Nat Genetics. 2009;41:630–634. doi: 10.1038/ng.365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Woychik NA, Lane WS, Young RA. Yeast RNA polymerase II subunit RPB9 is essential for growth at temperature extremes. J Biol Chem. 1991;266:19053–19055. [PubMed] [Google Scholar]
  31. Zhang X, Henderson IR, Lu C, Green PJ, Jacobsen SE. Role of RNA polymerase IV in plant small RNA metabolism. Proc Natl Acad Sci U S A. 2007;104:4536–4541. doi: 10.1073/pnas.0611456104. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

01
NIHMS368660-supplement-01.pdf (2.1MB, pdf)

RESOURCES