Skip to main content
3 Biotech logoLink to 3 Biotech
. 2011 Jun 18;1(4):193–198. doi: 10.1007/s13205-011-0012-x

Isolation of a novel thermostable dehydrochlorinase (LinA) from a soil metagenome

Ankit S Macwan 1, Saleem Javed 2, Ashwani Kumar 1,
PMCID: PMC3339611  PMID: 22558537

Abstract

Hexachlorocyclohexane dehydrochlorinase (LinA) mediates first step of aerobic degradation of a chlorinated insecticide γ-hexachlorocyclohexane (γ-HCH). In this study, we describe characterization of a novel variant (LinA-type2) that is distinct from reported LinAs and is substantially more thermostable than archetypal LinA-UT26. LinA-type2 remains active even after 8 h of incubation at 45 °C, when nearly 50% activity of LinA-UT26 is lost after incubation for 60 min at the same temperature. Circular dichroism analysis revealed that secondary structures of LinA-UT26 and LinA-type2 are similar, but their Tm was 45 and 65 °C, respectively. Thermostability of LinA-type2 makes it suitable for bioreactors where allowance for higher temperatures can be of advantage.

Keywords: Hexachlorocyclohexane, Thermostability, Dehydrochlorinase, LinA, Metagenome

Introduction

Chlorinated insecticide technical-hexachlorocyclohexane (t-HCH) consists of four major isomers; α- (60–70%), β- (5–12%), γ- (10–15%) and δ-HCH (6–10%), which differ in spatial distribution of chlorine atoms on cyclohexane ring (Willett et al. 1998). Sites contaminated by these isomers are present all around the world and are potential sources of toxicity (Willett et al. 1998; Lal et al. 2010). Several HCH-degrading microorganisms have been characterized from different parts of world (Lal et al. 2010). Pathway for the degradation γ-HCH has been worked out in considerable detail, and some information is also available about the degradation of other isomers. Briefly, enzyme ‘HCH-dehydrochlorinase LinA’ mediates first step in the biodegradative pathway of α-, γ- and δ-HCH i.e., their dehydrochlorination to 1,3,4,6-tetrachloro-1,4-cyclohexadiene via the corresponding pentachlorocyclohexene (Fig. 1). The formed product is further metabolized by sequential activity of other Lin enzymes of the pathway into readily utilizable products (Imai et al. 1991; Nagata et al. 2007; Lal et al. 2010). When LinA activity is tested in isolation, the formed 1,3,4,6-tetrachloro-1,4-cyclohexadiene is converted non enzymatically to 1,2,4-trichlorobenzene (Imai et al. 1991).

Fig. 1.

Fig. 1

Reaction of HCH-dehydrochlorinase (LinA) with γ-HCH (formation of compounds 2, 3 and 4), and pathway followed in HCH-degradative bacteria. Compounds: 1 γ-Hexachlorocyclohexane (γ-HCH), 2 pentachlorocyclohexene (γ-PCCH), 3 1,3,4,6-tetrachloro-1,4-cyclohexadiene (1,4-TCDN) and 4 1,2,4-trichlorobenzene (1,2,4-TCB)

The archetypal LinA-UT26 was first reported from a strain Sphingobium japonicum UT26 (Imai et al. 1991), consists of 156 amino acids (Fig. 2), and its crystal structure has recently been described (Okai et al. 2010). Its activity is optimal at 35 °C and requires no additional cofactors for the activity. Several variant forms that are >85% identical to it have been described from various HCH-degrading organisms (Lal et al. 2010). LinA has potential for bioremediation of HCH-contaminated habitats, and its variants with improved properties are therefore desired (Mencia et al. 2006). Here, we report characterization of a thermostable LinA whose gene was obtained from metagenome of a HCH-contaminated site.

Fig. 2.

Fig. 2

Amino acid sequence of LinA-UT26, LinA1-B90 and LinA-type2. Residues of LinA-UT26 and those differ in LinA1-B90 and LinA-type2 are shown

Materials and methods

Isolation of metagenomic DNA, and PCR amplification of linA

Soil samples, contaminated with HCH-isomers, were collected from the vicinity of a HCH-manufacturing unit near Lucknow, India. Metagenomic DNA was isolated from it by using ‘Fast DNA Spin Kit for soil’ (Qbiogene, Heidelberg, Germany). Amplification of linA was done by using primer F1 (1–25 bp from start codon of linΑ-UT26) and R1 (99–120 bp downstream from the stop codon of linΑ-UT26; Table 1). Temperature program for the amplification reactions was, initial denaturation at 95 °C for 5 min followed by 30 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s and extension at 72 °C for 3 min and a final extension at 72 °C for 10 min. Enzyme used for amplification was Pfu thermostable DNA Polymerase (Fermentas, Hanover, MD, USA) with 3′–5′ proofreading activity.

Table 1.

Primers used in this study

Primer Sequence Restriction site Characteristics Accession no.
F1 CATATGAGTGATCTAGACAGACTTGCAA NdeI 1–25 bp of linΑ-UT26 D90355
R1 CCCGGCGTGACTCATCTCCAAT Nil 99–120 bp downstream from the stop codon of linΑ-UT26 D90355
R3 CTCGAGTGCGCCGGACGGTGCGA XhoI 448–468 bp of linΑ-UT26 (does not have stop codon TAA) D90355

Molecular cloning and nucleotide sequencing

The amplified products were purified from an agarose gel by using ‘GenEluteTM Gel Extraction Kit’ (Sigma–Aldrich, St. Louis, MO, USA), and nucleotide ‘A’ was added at their 3′ end by ‘Single dATM tailing kit’ (Novagen, Darmstadt, Germany). The dΑ-tailed products were ligated with TΑ-cloning vector (pCR4-TOPO, TOPO TA Cloning® Kit for sequencing, Invitrogen, Carlsbad, CA, USA). These were transformed into One Shot® TOP10 ElectrocompTME. coli by electroporation, using Gene Pulser XcellTM (Bio-Rad, Hercules, CA, USA). Both strands of inserts from the clones were sequenced on ABI PRISM-3100 (Applied Biosystems, Foster city, CA, USA) sequencer by using universal forward and reverse M13 primers. Sequences obtained were aligned by Clustal W algorithm (DNAStar Inc. WI, USA). Accession numbers for linΑ-type1, -type2, are EU863865, EU863871, respectively.

Expression of LinA proteins

Genes of LinA-type1 and -type2 were expressed in E. coli for further characterization. Briefly, these were amplified again by using primer F1 and R3 (Table 1) and TA cloned, as above. Plasmids from the sequence verified clones were digested with NdeI and XhoI, ligated with pET-26b (+) vector (Novagen, Darmstadt, Germany) and cloned first in E. coli DH5α cells and subsequently in E. coli BL21 (DE3) cells. These upon expression enabled the formation of C-terminal his-tagged products. The clones for each linA, after reconfirming their sequence, were grown in LB medium till the optical density 0.6 was achieved, and then were induced by 0.1 mM IPTG for 4 h. The cells were harvested, washed and resuspended in 50 mM sodium phosphate buffer (pH 8.0), and lysed by sonication (Ultrasonic processor UP100H, Hielscher, Stuttgart, Germany). Contents were centrifuged at 20,000g for 30 min, and the expressed proteins present in the clear supernatant were purified by Ni–NTA Superflow (QIAGEN, Hilden, Germany) columns at 4 °C. Size exclusion chromatography was done on AKTA FPLC (GE Healthcare, Piscataway, NJ, USA), using SuperdexTM 200, 10/300 GL column and 50 mM potassium phosphate buffer (pH 8.0) as both pre-equilibration and run buffer. Protein estimation was done by ‘Bio-Rad Protein Assay Reagent’ (Bio-Rad, Hercules, CA, USA) using bovine serum albumin (Sigma, USA) as standard. The purified proteins were diluted to 1.0 mg ml−1 in 50 mM sodium phosphate buffer (pH 8.0) containing 15% glycerol, and stored at −20 °C in aliquots.

HCH-dehydrochlorinase activity

Activity of LinAs were determined by following the disappearance of substrate, as described earlier (Wu et al. 2007). Briefly, the reaction medium (1 ml) contained 50 mM Tris HCl; pH 8.0, 170 μM HCH-isomer (stock solution 1 mg ml−1 in DMSO), 10% glycerol and 10 μg of LinΑ proteins for α-, and γ-HCH, but 100 μg for δ-HCH. Reaction vials in triplicates were set up for each time point, which were withdrawn after incubation at 30 °C for different time intervals. The reaction was stopped by acidification to pH < 2. Residual HCH, along with formed metabolites, was extracted with 1 ml n-hexane and analyzed by gas chromatography (Kumar et al. 2005). Optimal temperature for activity was determined by setting the reaction at different temperatures, using α-HCH as substrate.

Thermostability of LinAs

For determination of thermostability of LinAs, the reaction medium (1 ml) that contained 50 mM Tris HCl; pH 8.0, 10% glycerol and 10 μg of either LinΑ was pre-incubated at 45 or 70 °C for different time intervals. Afterwards, the reaction was initiated by addition of 10 μg α-HCH. After 10 min incubation at same temperature, the reaction was terminated and analyzed as above. For measurement of thermo tolerance, LinAs were incubated at different temperatures for 1 h, followed with their cooling by incubation at 30 °C for 30 min. Thereafter, the enzyme activities were measured as described above, using α-HCH as substrate.

Circular Dichroism measurements

Circular Dichroism measurements were made on ChirascanTM Spectrometer (Applied Photophysics, Surrey, United Kingdom) that was calibrated with ammonium (+)-10-camphorsulfonate at 25 °C with cell of 1 mm path length. The values were obtained by using 10 μM protein in 50 mM potassium phosphate buffer (pH 8.0), and normalized by subtracting the baseline recorded for the buffer under similar conditions. For evaluating their temperature-induced melting, molar ellipticity (222 nm) was monitored at different temperatures that were increased at a constant rate of 1 °C min−1 to 90 °C.

Results

Isolation of linAs from the soil metagenome

Analysis of 100 linAs that were amplified from soil metagenome revealed presence of two major linA variants, linA-type1 and -type2, whose relative abundance was 11 and 18%, respectively. While sequence of LinA-type1 was 100% identical to LinΑ-UT26, LinA-type2 was novel and differed from LinA-type1 by ten amino acids (Fig. 2). It also differs by nine amino acids from another reported variant LinA1-B90 (Kumari et al. 2002). Since LinA-type1 and LinA-UT26 are identical, only the term LinA-type1 is used in this manuscript for brevity and also to highlight its comparison with LinA-type2. Besides these variants, several other linAs (accession numbers EU863846–EU863896) that are >98% identical to either of these, and whose relative abundance was 1–6%, were also present in the metagenomic DNA.

HCH-dehydrochlorinase activity

LinA-type1, -type2 and LinA1-B90 exhibited dehydrochlorinase activity with α-, γ- and δ-HCH, but not β-HCH (Table 2), and formation of reported metabolites (Nagata et al. 2007) was observed by gas chromatography and mass spectrometry (data not shown). Their activities differed substantially for various isomers (Table 2). Thus, activity for γ- and δ-HCH was highest by LinΑ-type1 that was followed with -type2 and LinA1-B90. Activities towards α-HCH, however, were comparable by all three LinAs (Table 2).

Table 2.

Dehydrochlorinase activity of various LinA proteins with different HCH-isomers. Activities were determined at 30 °C

HCH-isomer aDehydrochlorinase activity (nmol min−1 mg−1 protein)
-type 1 -type 2 A1-B90
α 640 625 620
β NDb ND ND
γ 3460 380 310
δ 140 42 40

aValues given are mean of triplicates and standard deviation was less than 10%

bND not detectable

Thermostability of LinAs

Temperature optima for the activity of LinA-type1 and -type2 were 35 and 70 °C, respectively (Fig. 3). While no significant loss was observed in the activity of LinΑ-type2 after 8 h pre-incubation at 45 °C, >50% activity of LinΑ-type1 was lost after its incubation for 60 min at the same temperature (Fig. 4a). Further thermostability measurements revealed that after pre-incubation at 70 °C for different time periods, LinA-type2 is stable for 10 min but the activity declined gradually afterwards and only ~30% activity was observed after 30 min incubation (Fig. 4b). Similar decline in activity was also observed for LinA1-B90 at 70 °C.

Fig. 3.

Fig. 3

a Temperature optima of HCH-dehydrochlorinase activity of LinA-type1 (triangle), and b -type2 (circle) and LinA1-B90 (square). Activities at 30 °C (table 2) were taken as 100%

Fig. 4.

Fig. 4

Thermostability of LinA proteins. Residual α-HCH dehydrochlorinase activity was measured after pre-incubation of LinA-type1 (triangle), -type2 (circle) and LinA1-B90 (square) at 45 °C (a) and of LinA-type2 and LinA1-B90 at 70 °C (b). Activities prior to pre-incubation (Table 2) were taken as 100%

Thermo tolerance of LinAs was evaluated by their pre-incubation at different temperatures for 1 h at 30–70 °C, followed by their cooling and recovery by incubation at 30 °C for 1/2 h. Under these conditions, 100% activity of all three LinAs was retained after pre-incubation at 30 and 40 °C (Fig. 5). At 50 °C, however, only LinA-type2 and LinA1-B90 retained full activity but 50% activity of LinA-type1 was lost. At 60 and 70 °C, loss of activity was observed for all three LinAs, which was highest for LinA-type1, followed by LinA1-B90 and LinA-type2, respectively.

Fig. 5.

Fig. 5

Thermotolerance of LinAs at different temperatures. LinA-type1 (triangle), -type2 (circle) and LinA1-B90 (square) were incubated for 1 h at different temperatures, air cooled by incubation at 30 °C for 30 min, and then α-HCH dehydrochlorinase activity was determined. Activities of different LinAs after pre-incubation at 30 °C were taken as 100%

Circular dichroism spectra of LinA-type1 and -type2 were very similar (Fig. 6a), suggesting them to have similar secondary structures. Their thermal denaturation profiling (Fig. 6b), however, revealed that Tm for -type2 was substantially higher (65 °C), compared to that of -type1 (45 °C).

Fig. 6.

Fig. 6

Circular dichroism spectroscopy plots of LinA-type1 (open circle) and -type2 (closed circle). a Far-UV spectra and b temperature-induced unfolding. Vertical lines in b represent temperatures where the proteins are half unwound

Discussion

The study was designed to evaluate diversity of linA variants in metagenome of a t-HCH contaminated soil, and identify the ones with improved properties for the degradation of HCH-isomers. We describe characterization of a novel variant, LinA-type2, which is distinct from the reported LinAs and is highly thermostable. The thermostability was reflected in its (i) temperature optima at 70 °C, (ii) 100% retention of enzyme activity after 10 min incubation at 70 °C, and (iii) Tm of 65 °C by Circular Dichroism spectroscopy. LinA-type2 differs from archetypal LinA-UT26 by ten residues i.e., K20Q, A23G, F68Y, C71T, L96C, F113Y, D115 N, R129L, A131G and T133 M (Fig. 2), and any or more of these residues might be responsible for its higher thermostability. These ten changes, along with other residues e.g. ALLQK in place of IHFAP near its C-terminus, are present in LinA1-B90 (Fig. 2) and confer higher thermostability to it, which is being reported here for the first time.

Salt bridges have been identified as major contributory factor to thermostability of various proteins (Kumar et al. 2000). Crystal structure of LinA-UT26 revealed that the enzyme exists as a homotrimer, and each protomer forms a cone-shaped α + β barrel fold (Okai et al. 2010). Two inter-subunit salt bridges K26-D93′ and D19-R79′, where prime sign indicates a different subunit, have been identified in it (Okai et al. 2010). While these residues are conserved in LinA-type2, if any additional intra- or inter-subunit salt bridge(s) are formed, remains to be seen.

Ecological significance of the presence of several linA variants in soil metagenome is not immediately clear. Presence of LinA-type1 and -type2 are expected to be helpful in utilization of two α-HCH enantiomers, as described before (Suar et al. 2005). LinA genes have been suggested to be evolving rapidly (Nagata et al. 2007; Lal et al. 2010), and presence of other variants in the metagenome that are >98% identical to either of these might be reflecting this process. Higher thermal stability of LinΑ-type2, however, makes this enzyme suitable for use in bioreactors where allowance for higher temperatures is an advantage. The study paves way for designing better enzymes for improved degradation of HCH-isomers.

Acknowledgments

This work was supported by a grant from the Department of Biotechnology, Government of India. We thank Prof. Rup Lal of Delhi University for providing the linA1-B90 clone, Advanced Instrumentation Research Facility, Jawaharlal Nehru University, New Delhi, for help with CD experiments, and Dr. Preeti Srivastava of IITR, Lucknow, for comments on the manuscript. Ankit Macwan thanks the Council of Scientific and Industrial Research, India, for fellowship support.

Open Access

This article is distributed under the terms of the Creative Commons Attribution License which permits any use, distribution and reproduction in any medium, provided the original author(s) and source are credited.

References

  1. Imai R, Nagata Y, Fukuda M, Takagi M, Yano K. Molecular cloning of a Pseudomonas paucimobilis gene encoding a 17-kilodalton polypeptide that eliminates HCl molecules from gamma-hexachlorocyclohexane. J Bacteriol. 1991;173:6811–6819. doi: 10.1128/jb.173.21.6811-6819.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Kumar S, Tsai CJ, Nussinov R. Factors enhancing protein thermostability. Protein Eng. 2000;13:179–191. doi: 10.1093/protein/13.3.179. [DOI] [PubMed] [Google Scholar]
  3. Kumar M, et al. Enhanced biodegradation of beta- and delta-hexachlorocyclohexane in the presence of alpha- and gamma-isomers in contaminated soils. Environ Sci Technol. 2005;39:4005–4011. doi: 10.1021/es048497q. [DOI] [PubMed] [Google Scholar]
  4. Kumari R, et al. Cloning and characterization of lin genes responsible for the degradation of Hexachlorocyclohexane isomers by Sphingomonas paucimobilis strain B90. Appl Environ Microbiol. 2002;68:6021–6028. doi: 10.1128/AEM.68.12.6021-6028.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Lal R, et al. Biochemistry of microbial degradation of hexachlorocyclohexane and prospects for bioremediation. Microbiol Mol Biol Rev. 2010;74:58–80. doi: 10.1128/MMBR.00029-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Mencia M, et al. Identification of a γ-hexachlorocyclohexane dehydrochlorinase (LinA) variant with improved expression and solubility properties. Biocatal Biotransform. 2006;24:223–230. doi: 10.1080/10242420600667809. [DOI] [Google Scholar]
  7. Nagata Y, Endo R, Ito M, Ohtsubo Y, Tsuda M. Aerobic degradation of lindane (gamma-hexachlorocyclohexane) in bacteria and its biochemical and molecular basis. Appl Microbiol Biotechnol. 2007;76:741–752. doi: 10.1007/s00253-007-1066-x. [DOI] [PubMed] [Google Scholar]
  8. Okai M, Kubota K, Fukuda M, Nagata Y, Nagata K, Tanokura M. Crystal structure of gamma-hexachlorocyclohexane Dehydrochlorinase LinA from Sphingobium japonicum UT26. J Mol Biol. 2010;403:10. doi: 10.1016/j.jmb.2010.08.043. [DOI] [PubMed] [Google Scholar]
  9. Suar M, et al. Enantioselective transformation of alpha-hexachlorocyclohexane by the dehydrochlorinases LinA1 and LinA2 from the soil bacterium Sphingomonas paucimobilis B90A. Appl Environ Microbiol. 2005;71:8514–8518. doi: 10.1128/AEM.71.12.8514-8518.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Willett KL, Ulrich EM, Hites RA. Differential toxicity and environmental fates of hexachlorocyclohexane isomers. Environ Sci Technol. 1998;32:2197–2207. doi: 10.1021/es9708530. [DOI] [Google Scholar]
  11. Wu J, Hong Q, Sun Y, Hong Y, Yan Q, Li S. Analysis of the role of LinA and LinB in biodegradation of delta-hexachlorocyclohexane. Environ Microbiol. 2007;9:2331–2340. doi: 10.1111/j.1462-2920.2007.01350.x. [DOI] [PubMed] [Google Scholar]

Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES