Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2013 Apr 10.
Published in final edited form as: Biochemistry. 2012 Mar 30;51(14):3079–3091. doi: 10.1021/bi201705q

INSIGHT INTO THE MOLECULAR BASIS OF AROMATIC POLYKETIDE CYCLIZATION: CRYSTAL STRUCTURE AND IN VITRO CHARACTERIZATION OF WHIE-ORFVI†

Ming-Yue Lee 1, Brian D Ames 1, Shiou-Chuan Tsai 1,2,3
PMCID: PMC3339804  NIHMSID: NIHMS367965  PMID: 22432862

Abstract

Aromatic polyketides are biologically active natural products. Many important pharmaceuticals are derived from aromatic polyketides. Especially important in aromatic polyketide biosynthesis is the regiospecific cyclization of a linear, pre-assembled polyketide chain catalyzed by the aromatase/cyclase (ARO/CYC), which serves as a key control point in aromatic ring formation. How different ARO/CYCs promote different cyclization patterns is not well understood. The whiE locus of Streptomyces coelicolor A3(2) is responsible for the biosynthesis of an aromatic polyketide precursor to the grey spore pigment. The WhiE ARO/CYC catalyzes the regiospecific C9-C14 and C7-C16 cyclization and aromatization of a 24-carbon polyketide chain. WhiE ARO/CYC shares a high degree of similarity to another non-reducing PKS ARO/CYC, TcmN ARO/CYC. Here, we present the apo crystal structure of WhiE ARO/CYC, and co-crystal structures of WhiE and TcmN ARO/CYCs bound with polycyclic aromatic compounds that mimic the respective ARO/CYC products. Site-directed mutagenesis coupled with in vitro PKS reconstitution assays were used to characterize the interior pocket residues of WhiE ARO/CYC. The results confirmed that the interior pocket of ARO/CYCs is a critical determinant of polyketide cyclization specificity. A unified ARO/CYC-mediated cyclization mechanism is proposed based on these structural and functional results.

Introduction

The Gram-positive soil bacteria of genus Streptomyces utilize the dissociated type II polyketide synthases (PKSs) to produce aromatic polyketides (1). Type II PKSs are comprised of a core set of enzymes termed the “minimal PKS” (MinPKS): the ketosynthase-chain length factor (KS-CLF) heterodimer is responsible for iterative decarboxylative condensations to generate a poly-β-ketone chain while the acyl carrier protein (ACP) (2, 3) shuttles both malonyl-CoA units to KS-CLF and subsequent polyketide intermediates to chain-modifying enzymes. The highly reactive linear poly-β-ketone intermediate is then modified by the ketoreductase (KR) with aromatase/cyclase (ARO/CYC) to the eventual formation of the aromatic core. Though the aromatic core is critical for the bioactivities of the aromatic polyketides, little is known regarding the molecular mechanisms controlling aromatic ring formation. The crystal structures of TcmN ARO/CYC from the tetracenomycin (tcm) C pathway of S. glaucescens (4) and ZhuI ARO/CYC from S. sp. R1128 (5) have recently been published and allow insight into the ARO/CYC mechanism. The structure and functional analysis of TcmN ARO/CYC has provided the first insight in suggesting that the interior pocket of ARO/CYC plays a direct role in binding, folding, and directing the regiospecific cyclization of an unreduced polyketide chain. Subsequently, the ZhuI ARO/CYC crystal structure provided rationalization of first-ring cyclization specificity and support for the role of the interior pocket in catalysis. However, much is still unknown about ARO/CYC, in particular if the size of the interior pocket also controls the chain length of a given polyketide substrate.

The whiE gene cluster in Streptomyces coelicolor A3(2) is required for the developmentally regulated biosynthesis of a yet uncharacterized polyketide-derived grey spore pigment (6, 7). The whiE gene cluster contains genes homologous to other type II spore pigment PKSs (8) such as sch from S. halstedii (9) and cur from S. curacoi (10). whiE genes also share homology with type II PKSs responsible for aromatic polyketide antibiotic production such as tetracenomycin C (11), granaticin (12), and actinorhodin (13). Heterologous expression and genetic studies involving the whiE minimal PKS in the presence or absence of whiE-ORFVI (WhiE ARO/CYC) has identified the putative ARO/CYC substrate as a 24-carbon unreduced polyketide chain (Figure 1) (14, 15). Expression of the WhiE MinPKS (KS-CLF and ACP) alone in vivo results in the production of over 30 polyketides, with eight structurally characterized products exhibiting variable chain lengths (14, 22, or 24 carbons) and aberrant first-ring cyclization patterns (C7-C12, C8-C13, C10-C15, and C13-C18) (14). The addition of WhiE ARO/CYC led to the exclusive biosynthesis of the 24-carbon naphthyl dodecaketide TW95a (1 in Figure 1) as a result of C9-C14 first-ring and C7-C16 second-ring cyclizations (15). These studies demonstrated the ability of WhiE ARO/CYC to promote chain length specificity, as well as efficiently suppressing spontaneous aldol chemistry to direct the specific folding and cyclization of the polyketide.

Figure 1.

Figure 1

Proposed WhiE PKS biosynthetic pathway from genetic recombination studies (7, 14, 15). (A) Cartoon representation of the whiE gene cluster with each open-reading frame (ORF) annotated with the putative or proposed function. (B) Proposed WhiE PKS biosynthetic pathway from genetic recombination studies showing the products in the presence of absence of WhiE ARO/CYC. In the presence of WhiE ARO/CYC there was exclusive production of a 24-carbon polyketide product with C9-C14, C7-C16 cyclizations (TW95a (1) and TW95b (2)). When WhiE ARO/CYC is absent there are many shunt products with varying carbon lengths and cyclization patterns.

WhiE ARO/CYC produces a C9-C14, C7-C16 cyclized polyketide intermediate, similar to that of TcmN ARO/CYC. However, an important distinction is that the endogenous WhiE ARO/CYC substrate is a 24-carbon, rather than 20-carbon (tcm-encoded), polyketide chain. Engineered biosynthesis involving different combinations of PKS subunits has shown that WhiE ARO/CYC can functionally replace TcmN ARO/CYC, because expression of the Tcm MinPKS with WhiE (16) or TcmN ARO/CYC (17, 18) yields the same 20-carbon, C9-C14 first-ring (and C7-C16 second-ring) cyclized polyketides, RM80 (3) and RM80b (4) (Figure 2). Amino acid sequence comparison reveals that WhiE ARO/CYC shares an overall identity/similarity of 54% / 65% to TcmN ARO/CYC with 80% / 93% identity/similarity for interior pocket-defining residues (Figure 3). Because the interior pocket of ARO/CYC has been shown to be a determinant of cyclization specificity (18, 19), the high similarity observed between the pocket defining residues of WhiE and TcmN ARO/CYCs follows logically in that both enzymes promote the same first and second ring cyclization specificity, and the only difference is the chain lengths of the respective natural polyketide substrates (24 and 20 carbons, respectively). Structural insight into WhiE ARO/CYC pocket composition and conformation will therefore aid in understanding how WhiE ARO/CYC accommodates a 24-carbon polyketide intermediate (4-carbons longer than that naturally acted on by TcmN ARO/CYC) to effect similar chain folding and cyclization patterns. However, in the past, such a comparative effort has been hampered by the lack of co-crystal structures of ARO/CYC bound with substrate or product analogs.

Figure 2.

Figure 2

The polyketide compounds used in this study. RM80 (3) and RM80b (4) are both aromatic polyketides from engineered biosynthesis. JRSi284 (5) and Taxifolin (6) are both co-crystallization ligands. 7 is used for docking simulations for WhiE ARO/CYC.

Figure 3.

Figure 3

Sequence alignment of WhiE, Tcm, ZhuI, Act, and Gris ARO/CYCs rendered using ESPript (Risler similarity matrix with global score set to 0.7). Top line illustrates secondary structure elements according to the WhiE ARO/CYC structure. Asterisks found below the aligment are used to indicate those residues that define the interior pocket.

We present the first report of an ARO/CYC crystal structure with a bound aromatic polyketide analog solved to 1.8 Å along with the 1.8 Å native crystal structure. Additionally, we present the results of polyketide docking simulations and in vitro functional characterization of WhiE ARO/CYC. The co-crystal structure of WhiE ARO/CYC with a bound synthetic aromatic polyketide analog is critically compared to a co-crystal structure of TcmN ARO/CYC bound to the plant polyketide taxifolin; together, these co-crystal structures enable us to highlight key features of the interior pocket in its capacity to bind multicyclic aromatic compounds. Taken together, this work provides insight into the ability of ARO/CYC to accommodate a variety of polyketide chain lengths, and enables us to propose a generalized mechanism of ARO/CYC-mediated polyketide cyclizations/aromatizations, in which the interior pocket is an active participant in binding, folding, and cyclization of an unreduced polyketide

MATERIALS AND METHODS

Construction of pWhiE

The plasmid pYT198, a pCR blunt plasmid (Invitrogen) construct containing the whiE ORFVI (whiE ARO/CYC) gene, was kindly provided by Prof. Yi Tang. All cloning steps were performed in Escherichia coli strain Nova-Blue (Novagen). The whiE ARO/CYC gene was amplified via PCR using Pfu Turbo DNA polymerase (Stratagene) along with the following primers: (underlined portions denote non-complementary region; restriction sites, in bold, are inserted to the 5′ portion of the primer sequence)

Forward: GCGCTCCATATGGCAGGGCACACCGAC

Reverse: GCGCGAATTCTTAGTCGGCGAGCACCGAC

The amplified gene product was double-digested with EcoRI and NdeI, gel-purified, and ligated onto pET28a vector (Novagen). DNA sequencing (UCSequencing Facility, UC Davis) was used to confirm the final construct.

WhiE ARO/CYC Protein Overproduction and Purification Protocol

Escherichia coli strain BL21 (DE3) transformed with pWhiE was cultured in 2 × 1 L LB containing kanamycin (50 μg/ml) at 37 °C until A600 reached ~0.6, the temperature was then reduced to 18 °C and 0.1 mM IPTG was added to induce expression. After approximately 18 h of additional incubation, the cells were harvested at 4,000 rpm for 20 min, yielding approximately 5 g of wet cell mass per liter culture, and the pellets were stored at −80 °C.

The cell pellets containing expressed protein were resuspended in lysis buffer (50mM Tris×HCl [pH 7.5], 300mM NaCl, 20mM imidazole, and 10% glycerol), sonicated, and clarified (21,000 rpm for 60 min). The clarified lysate was mixed with Ni-IMAC resin (Bio-Rad Laboratories), and batch-bound at 4 °C for 1 h. The mixture was then applied to a gravity-flow column, washed once with 25 mL of wash buffer 1 (lysis buffer + 20 mM imidazole) and again with 25 mL of wash buffer 2 (lysis buffer + 30 mM imidazole). The protein was then eluted with six 5 mL fractions of lysis buffer containing increasing concentrations of imidazole (50 mM, 75 mM, 100 mM, 150 mM, 250 mM, and 500 mM). The wash and elution fractions were visualized by SDS-PAGE, with >90% pure protein observed at 30 mM imidazole fraction and onward. Eluted protein fractions (30 mM – 250 mM imidazole) were pooled, concentrated to 5-10 mg/ml using an iCON 9,000-MW cutoff centrifugal filter device (Pierce), and buffer-exchanged into 20 mM HEPES pH 7.0 using a PD-10 desalting column (GE Healthcare). The protein concentration was determined using the Bradford method with BSA as a standard (20) (Bio-Rad Laboratories).

Site-Directed Mutagenesis

The QuikChange II Site-Directed Mutagenesis Kit (Stratagene) was used to introduce WhiE ARO/CYC pocket-residue mutations, which were confirmed through automated DNA sequencing. The primers used for mutagenesis are as follow (mutated nucleotides are in bold):

F32A: GTGGCCCGGCCTGGCGAGCGAGTACGCC

F32Y: GGCCCGGCCTGTATAGCGAGTACGCC

E34A: GCCTGTTCAGCGCGTACGCCTCCGTG

Y35A: GCCTGTTCAGCGAGGCGGCCTCCGTGGAGG

Y35F: CCTGTTCAGCGAGTTTGCCTCCGTGGAGGTG

Y35T: CTGTTCAGCGAGACCGCCTCCGTGG

R69A: GGGTCTCCGAGGCGGTCGCCGACCC

R69K: GCTGGGTCTCCGAGAAAGTCGCCGACCCCGTC

R69Q: GGGTCTCCGAGCAGGTCGCCGACCC

R82A: GTCCGCGCCCAGGCGGTCGAGACCG

R82E: CACCGTCCGCGCCCAGGAAGTCGAGACCGG

R82K: CACCGTCCGCGCCCAGAAAGTCGAGACCGG

R82Q: GTCCGCGCCCAGCAGGTCGAGACCGG

WhiE ARO/CYC Crystallization

2 μl of 5 mg/ml WT protein was mixed with 2 μl of well solution (0.1 M Bis-Tris [pH 5.0-6.0], 0.2 M MgCl2×6H2O, 24-30% PEG3350) and equilibrated over a well volume of 500 μl at 4 °C using sitting drop vapor diffusion method. The clustered crystals would grow within one week [space group P2(1), with one molecule per asymmetric unit].

For co-crystallization, 5 mM of JRSi284 (100mM stock solution dissolved in DMSO; Prof. Townsend, Johns Hopkins University) was mixed with 5mg/ml WT WhiE ARO/CYC. The mixture was then passed through a 0.2 μm centrifugal filter device (Pall Life Sciences) to remove precipitate due to the low solubility of JRSi284 in aqueous solutions. 2 μl of this mixture was then mixed with 2 μl of well solution (0.1 M Bis-Tris [pH5.0-6.0], 0.2 M MgCl2×6H2O, 28-34% PEG3350) and equilibrated over a well volume of 500 μl at 4 °C using hanging drop vapor diffusion method. The colored crystals appeared within one week (space group P2(1), with two molecules per asymmetric unit). The unit cell dimensions of either crystal used for structural determination are shown in Table 2.

Table 2.

Data collection and refinement statistics

WhiE-ORFVI
TcmN ARO/CYC
Native (+) JRSi284 (+) Taxifolin
Crystallographic Data:
 Wavelength (Å) 1.0000 0.9998 1.0332
 Resolution (Å) 50-1.8 50-1.8 50-1.7
 Space group P21 P21 C2221
  a, b, c (Å) 47.8, 42.1, 48.0 64.4, 42.1, 69.3 72.5, 105.0, 51.1
  α, β, γ (°) 90, 91.9, 90 90, 102.0, 90 90, 90, 90
 Total observations 65592 125588 157778
 Unique reflections 17725 31213 22974
 High resolution shell (Å) 1.84-1.80 1.85-1.80 1.73-1.67
 Average redundancy* 3.7 (3.4) 4.0 (3.0) 6.9 (5.6)
 Completeness (%) 99.2 (93.6) 98.9 (92.2) 99.9 (100)
 Mean I/σ(I) 18.3 (6.1) 14.9 (2.8) 46.9 (5.0)
 Rsym (%) 7.6 (19.1) 8.5 (33.8) 3.8 (30.9)
Refinement:
 Resolution (Å) 48-1.80 50-1.80 32-1.67
 No. of reflections 17705 28074 22482
 No. of protein atoms 1376 2536 1245
 No. of water atoms 199 217 154
 No. of heteroatoms 6 51 22
 Rcrys , Rfree (%) 18.7, 21.4 19.0, 25.4 20.8, 23.3
Geometry:
 rmsd bonds (Å) 0.013 0.015 0.005
 rmsd angles (°) 1.987 1.587 1.20
 Ave. B factors (Å2) 27.0 28.7 24.3
Ramachandran (%)
 Most favored 98.2 94.4 94.8
 Additional allowed 1.8 5.6 5.2
 Generously allowed 0 0 0
*

Values in parentheses represent the highest resolution shell

Co-crystallization of TcmN ARO/CYC with Taxifolin

The expression and purification of TcmN ARO/CYC (for crystal structure solution with bound taxifolin) was performed as previously described (18). Crystals of TcmN ARO/CYC were grown as previously described (18). Soaks with the flavonoid polyketide taxifolin (trans-dihydroquercetin) were performed with (±)-taxifolin hydrate (Sigma); a stock solution of 45 mM taxifolin was made in well solution (20% PEG 8000, 0.1 M NaOAc, pH 5.0) plus 10% DMSO, crystals were transferred to a 10 μL drop containing 5 mM taxifolin and let stand for 1 hour at 4 °C, then to cryoprotectant solution (well solution plus 5 mM taxifolin and 20% glycerol) prior to being flash frozen in liquid nitrogen.

Diffraction Data Collection

The crystals were cryopreserved in well solution containing 20% glycerol then flash frozen in liquid nitrogen. Monochromatic x-ray diffraction data for native WhiE ARO/CYC were collected to 1.8 Å on beamline 9-2 of the Stanford Synchrotron Radiation Laboratory (SSRL). For WhiE ARO/CYC with bound JRSi284, diffraction data to 1.8 Å resolution were collected at beamline 8.2.2 of the Advanced Light Source (ALS). Diffraction data for TcmN ARO/CYC with bound taxifolin were collected at ALS beamline 8.3.1. Single crystals were used for all data sets used for structure solution, and all data was processed using HKL2000 (21). Table 2 lists the data collection statistics.

Phasing, Model Building, and Refinement

The initial phasing for WhiE ARO/CYC were performed by molecular replacement using CNS (22) using a poly-alanine version of the TcmN ARO/CYC structure (18) as the search model. Rigid-body refinement using CNS was applied to the molecular replacement solution followed by manual model building of main-chain and side chain atoms in COOT (23). Iterative rounds of model building and refinement (combined with density modification) in CNS was performed until an Rcrys of 27.5% and an Rfree of 29.4% was reached. At this point, crystallographic waters and a bound glycerol molecule were added to the model with COOT, and the data were transferred for refinement in REFMAC (CCP4) (24) with the final few rounds of refinement done using Phenix.refine (25, 26) in Phenix. Further building, improvement, and refinement of the model gave a final Rcrys of 18.7% and an Rfree of 21.4%; with the model consisting of residues 1 to 159 (with an additional 14-residues at the N-terminal end present as cloning artifacts), 199 waters, and 3 glycerols.

The initial phases for WhiE ARO/CYC + JRSi284 cocrystal structure were determined by molecular replacement using Phaser (CCP4) (27) and the refined WhiE ARO/CYC structure as the search model. In contrast to the native structure, there are two WhiE molecules present in the asymmetric unit. Following one round of refinement in REFMAC, inspection of the 2Fo – Fc (contoured to 1.0σ), and Fo – Fc (at 3.0σ) electron density maps revealed clear and complete density in the pocket defining the ligand JRSi284. The coordinate and topology files of JRSi284 were prepared using the Dundee PRODRG server (28), and automatic ligand fitting in COOT was used to place the compound into the experimental density. Iterative rounds of model building in COOT and refinement in REFMAC were used to complete the structure solution

The TcmN ARO/CYC-taxifolin cocrystal structure was solved by molecular replacement in CNS using the WT TcmN ARO/CYC structure as the search model. Following one round of combined refinement in CNS, there was well-defined and complete electron density defining the bound ligand taxifolin. The ligand coordinates were generated using the PRODRG server and the molecule placed into the corresponding electron density using Quanta (Accelrys Software Inc.). Further rounds of model building and improvement in Quanta and refinement in CNS produced the final model (Rcrys of 20.8% and an Rfree of 23.3%). Data refinement statistics for the WhiE and TcmN ARO/CYC structures described herein are listed in Table 2.

ActKS/CLF Expression and Purification

The expression of actKS/CLF from Streptomyces coelicolor CH999/pRJC006 spores has been described previously (29). Briefly, spores were grown in 50 mL Super YEME containing 50 g/mL kanamycin for 3 days at 30 °C shaking at 250 rpm. The mycelia were then transferred to 500 mL Super YEME containing 50 g/mL kanamycin and grown as before for 2 days. Protein expression was induced by the addition of 5 g/mL thiostrepton and cell growth continued as before for 1 more day. Cells were harvested by centrifugation (5,000 rpm x 30 min), resuspended in 40 mL lysis buffer (100 mM KPi [pH 7.5], 0.1% Triton X-100, 5 mM TCEP, 1.5 mM benzamidine, 1 tablet EDTA-free protease inhibitor cocktail [Roche], and 10% glycerol), and lysed on ice by sonication (8 × 1 min pulses). Cell debris were removed by centrifugation (21,000 rpm x 30 min) followed by binding of lysate supernatant to 3 mL Ni-IMAC resin (Bio-Rad) in batch-mode by spinning at 4 °C for 2 hrs. Protein was eluted with increasing concentrations of imidazole in 100 mM KPi pH 7.5, 500 mM NaCl, and 10% glycerol. Fractions containing actKS/CLF were collected at 150 and 500 mM imidazole, pooled, and buffer-exchanged to 100 mM KPi (pH 7.2) and 20% glycerol.

Holo-FrenN and holo-Act ACP and MAT Expression and Purification

E. coli BAP1 cells (30) expressing pET21c-frenACP or pET28a-actACP were grown at 37 °C in 1 L Luria-Bertani media supplemented with 100 g/mL ampicillin to an OD600 of 0.5. At that point, protein expression was induced by the addition of 1 mM IPTG at 18 °C overnight. The initial purification of holo-ACP was conducted as described previously (31). Following Phenyl-Sepharose chromatography, ACP was buffer-exchanged to buffer A (50 mM Tris-Cl [pH 7.5], 2 mM DTT, 2 mM EDTA, and 10% glycerol). Protein was applied to a HiTrap Q FF column (GE Healthcare) and eluted with a linear gradient from 0-100% buffer B (buffer A plus 1 M NaCl). Fractions containing pure holo-ACP were pooled and concentrated. S. coelicolor MAT was expressed and purified from E. coli BL21(DE3)/pGFL16 by Ni-IMAC as described previously (32).

PKS4 MinPKS Protein Expression and Purification

The expression and purification of the PKS4 KS-AT di-domain construct and the standalone PKS4 ACP (together constituting the PKS4 ‘MinPKS’ for use in the in vitro reconstitution assay) was performed as previously described (33).

The in vitro Reconstitution Assay

10μM PKS4 KS-MAT or actKS-CLF, 50μM holo-ACP (either system), 5mM malonyl-CoA, and 50μM WhiE ARO/CYC (WT or mutant) were mixed together in a 250 μL reaction tube. An additional component required for the Act MinPKS reconstitution assay is 1 M MAT (S. coelicolor). The reaction buffer used was 0.1 M Tris·HCl (pH 7.0). The mixture was incubated at room temperature overnight and extracted with an organic solvent solution containing 95:4.9:0.1 (v%:v%:v%) of ethyl acetate : methanol : formic acid. The organic phase of the extraction was then dried via SpeedVac vacuum concentrator (Thermo Scientific) and reconstituted in 100% DMSO. The extracts were then run through analytical reverse-phase HPLC using a Synergi Hydro-RP C18 column (Phenomenex), 150 × 4.60 mm. The mobile phases for RP-HPLC: buffer A, water containing 0.1% formic acid; buffer B, acetonitrile containing 0.1% formic acid. The gradient for the HPLC run consisted of the following steps: equilibration (0-5 min, 5% B); linear gradient (5-15 min, 5-50% B); linear gradient (15-20 min, 50-95% B); wash (20-25min, 95% B); linear gradient (25-28 min, 95-5% B); and re-equilibration (3 min, 5% B). Peak integration ratios of the HPLC chromatograms are listed in Table 1.

Table 1.

In vitro assay results for WhiE ARO/CYC mutants.

PKS4 MinPKS +
WhiE ARO/CYC
Products Isolated (% Peak Area)
Act MinPKS +
WhiE ARO/CYC
Products Isolated (% Peak Area)
PK8 (8) naphthopyrone (9) Ratio of 8 : 9 SEK4 (10) SEK4b (11) UWM1 (12) RM77 (13)
-- 52.2% 47.8% 1.1 : 1 -- 26.6% 71.8% -- --
WT 87.4% 12.6% 6.9 : 1 WT 11.4% 44.6% 15.3% 28.7%
R82A 54.1% 45.9% 1.2 : 1 R82A 32.6% 74.7% -- --
R82E 66.2% 33.8% 2.0 : 1 R82E 28.9% 71.1% -- --
R82Q 53.1% 46.9% 1.1 : 1 R82Q 24.3% 73.8% -- --
Y35A 58.8% 41.2% 1.4 : 1 R82K 24.4% 71.6% -- --
Y35T 50.5% 49.5% 1.0 : 1 Y35A 28.8% 70.9% -- --
Y35F 79.9% 20.1% 4.0 : 1 Y35F 10.8% 45.6% 23.8% 19.7%
R69A 54.0% 46.0% 1.2 : 1 F32YY35F 20.5% 67.9% 3.4% 8.2%
R69Q 55.4% 44.6% 1.2 : 1 R69A 26.4% 72.9% -- --
R69K 87.8% 12.2% 7.2 : 1 R69Q 26.5% 72.9% -- --
F32A 61.4% 38.6% 1.6 : 1 R69K 10.3% 39.3% 25.8% 24.6%
E34A 81.5% 18.5% 4.4 : 1 TcmN ARO/CYC 11.5% 29.4% 29.3% 29.8%
TcmN ARO/CYC 75.9% 24.1% 3.1 : 1 Zhul ARO/CYC 68.4% 30.7% -- --

Small-Molecule Docking

Docking simulations between WhiE ARO/CYC the polyketide intermediates were performed using GOLD (34). The WhiE ARO/CYC structure was defined as static, with the binding pocket being defined as 15 Å around the side chain hydroxyl of tyrosine 35, atom #384 in the mol2 file. The default settings were for the genetic algorithm (GA) parameters and 20 docking trials were performed each run.

RESULTS AND DISCUSSION

Overall fold: WhiE and TcmN ARO/CYCs are highly similar

The crystal structure of apo WhiE ARO/CYC was solved to 1.8 Å using molecular replacement with TcmN ARO/CYC (PDB code: 2RER (18)) as the search model. The overall structure is characterized by a helix-grip fold (35, 36) consisting of a seven-stranded anti-parallel β-sheet flanking a long C-terminal α-helix and two small helices to one side of the protein (Figure 4A). Structural superimposition between WhiE and TcmN ARO/CYC reveals that both structures are highly similar with an RMSD of 0.75 Å for residues 1-151 (Figure 4B). The only notable difference in backbone structure is the C-terminal helix (α-3) where this region extends for an additional 1.5 helical turns at the C-terminal end for WhiE ARO/CYC, while for TcmN ARO/CYC the equivalent region is random coil. The ordering of this region in the WhiE ARO/CYC structure may be due to crystal packing, because the C-terminal end of α-3 contacts adjacent protein molecules in the crystal lattice. Similar to TcmN ARO/CYC, WhiE ARO/CYC crystallized as a monomer. The similarity between the overall fold of WhiE and TcmN ARO/CYCs offers an excellent opportunity to critically compare the molecular features of their corresponding interior pockets.

Figure 4.

Figure 4

The overall WhiE ARO/CYC structure characterized by a helix-grip fold (A). Structural alignment of WhiE ARO/CYC (red) to TcmN ARO/CYC (green) (B) to show that overall, the topology of these two enzymes is highly similar.

Co-crystal structures highlight important features in the interior pocket

An important structural element of the helix-grip fold is the presence of an interior pocket formed between the β-sheets and C-terminal helix. The lipid/sterol-binding StAR-related lipid transfer (START) protein domains (37, 38) and the PR-10 family of plant pathogenesis-related proteins (36, 39) have both demonstrated the ability of the interior pocket to mediate polycyclic ligand binding. Related to this function of binding multicyclic ligands, the interior pocket of ARO/CYC is predicted to bind the putative linear polyketide substrate, as well as ARO/CYC-mediated cyclization products (18). The pocket-defining residues of WhiE ARO/CYC include hydrophobic (3 Phe, 4 Trp, 3 Met and 8 with aliphatic side chains), polar (2 Asn, 2 Gln, 1 Tyr, and 1 Ser), and charged (2 Arg, 1 Asp, and 1 Glu) residues (Figure 3). The amphipathic composition of residues would provide appropriate hydrophobic and hydrogen bond interaction for binding both the linear and cyclized polyketide intermediates. The pocket residues between WhiE and TcmN ARO/CYC are highly conserved both at the sequence level (Figure 3) and in 3-dimensional structures (Figure 5, SI Figure S1).

Figure 5.

Figure 5

Docking simulations of polyketide substrates into the interior pocket of WhiE and TcmN ARO/CYCs. (A) WhiE ARO/CYC docked with the 24-carbon bicyclic aromatic intermediate 7 (Figure 2), and (B) TcmN ARO/CYC docked with the 20-carbon bicyclic aromatic intermediate. For both panels: left, cutaway mesh surface view showing the positions of the docked molecules; right, view of pocket residue interactions with the docked polyketides.

The polyketide binding potential of the ARO/CYC interior pocket was confirmed experimentally by two co-crystal structures: WhiE ARO/CYC with bound JRSi284 (5) (Figure 2, a synthetic tricyclic aromatic polyketide mimic) and TcmN ARO/CYC with bound taxifolin (6) (Figure 2, an aromatic plant polyketide). These two aromatic polyketide analogs were found after extensive searching and crystallization screening of aromatic polyketides with WhiE and TcmN ARO/CYCs; only two co-crystals afforded well-defined electron density of the bound polyketide analogs (Figure 6). The WhiE ARO/CYC co-crystal structure with bound JRSi284 was solved to 1.8 Å with clear electron density of JRSi284 bound approximately halfway into the pocket of WhiE ARO/CYC (Figure 6A). Upon JRSi284 binding, a conformational change in the N-terminal region of β-strands 3, 4 and 6, and loops 5, 7, and 9 (and associated residue side chains) is observed (Figure 6A). There are substantial interactions between the active-site residue side chains and JRSi284, including (Figure 6B): 1) edge-face and offset-stacked π-π interactions mediated by 3 Trp (W63, W65, W124) and 1 Phe (F88). Of particular note is the dramatic shift observed for W63, which moves ~4 Å with ~50° rotation of the indole ring to set up perpendicular π-π stacking interactions with the JRSi284 aromatic rings. 2) Hydrophobic interaction above or below the plane of the ligand ring system by 3 Met (M54, M91, M125) and 1 Ile (I129), with additional interactions provided by the β-CH2 side chains of D57 and N128. 3) Hydrogen bond interactions provided by R82, Q110, and N132. The nature of the interactions described are relevant to understanding how an aromatic polyketide intermediate, such as the bicyclic product of WhiE ARO/CYC-mediated cyclizations (1, Figure 1), may bind to the pocket of WhiE ARO/CYC. Because JRSi284 is a tricyclic aromatic compound that mimics the ARO/CYC product (5, Figure 2), the fact that it is not within interaction distance to the conserved and functionally essential pocket arginine (R69, Figure 3) may reflect the product-exit mode, as opposed to the substrate-binding mode. Note that the JRSi284-WhiE complex is a snapshot of binding, which may represent the product exiting the active site or a non-productive mode. Nevertheless, to the best of our knowledge, this is the first product analog-bound ARO/CYC structure that helps visualize how a polyketide product may interact with the ARO/CYC pocket residues.

Figure 6.

Figure 6

A comparison of the co-crystal structures WhiE ARO/CYC with bound JRSi284 and TcmN ARO/CYC with bound taxifolin. (A) Left, molecular surface view of WhiE ARO/CYC showing the bound ligand as yellow sticks. Middle, a cutaway view of the surface reveals the position of the JRSi284 in the interior pocket. Right, overlay of apo (grey) and ligand-bound (green) forms of WhiE ARO/CYC illustrates the conformational changes that occur to accommodate ligand binding (the residue shown is W63). The grey mesh surrounding the ligand is from the 1.8 Å experimental 2Fo – Fc electron density map contoured to 1.5 σ. (B) Left, stereoview of ligand binding interactions, potential hydrogen bonding is indicated by a dashed line. Right, an alternate view of the same. Panels (C) and (D) illustrate the co-crystal structure of taxifolin bound to TcmN ARO/CYC (cartoon representation of ligand-bound structure colored blue), and are represented as described for panels (A) and (B) above. The electron density map contoured around taxifolin is from the 1.7 Å 2Fo – Fc electron density map contoured to 1.0 σ.

Similarly, the TcmN ARO/CYC-taxifolin co-crystal structure shows taxifolin bound at the entrance to the interior pocket, where minimal protein conformation changes occur at R82, H128, F120, and loops 4 and 6 to accommodate taxifolin binding (Figure 6C). Similar to the binding of JRSi284 to WhiE ARO/CYC, there are substantial aromatic π-π interactions observed between taxifolin and 2 Trp (W63 and W65), 2 Phe (F88 and F120), and a His (H128) residue of TcmN ARO/CYC. There are also hydrophobic interactions with aliphatic side chains of M125 and P87, and four potential hydrogen bond interactions provided by R82 and D57 (Figure 6D). Similar to JRSi284, taxifolin binds the entrance of the pocket and is distant from conserved and functionally critical residues such as Y35 and R69. Specifically, the 2-(3,4-dihydroxyphenyl) substituent forms a hydrogen bond with R82 and may preclude the ligand from fitting deeper into the pocket. Interestingly, attempts to crystallize WhiE ARO/CYC with taxifolin were unsuccessful, suggesting that small changes to pocket residue composition can affect ligand binding potential. In addition, although the location and binding modes of ligands (JRSi284 to WhiE ARO/CYC and taxifolin to TcmN ARO/CYC) are different due to their distinct chemical structures, they share many common residues that may govern putative substrate-binding and product-exit modes, including D57, W65, R82, F88, and M125. Of these residues, W65 is highly conserved among mono- and di-domain ARO/CYC, R82 is found as either Arg or Gln, while the hydrophobic character of F88 and M125 is conserved (Figure 3). In summary, the two co-crystal structures show that the interior pocket of ARO/CYC can bind multi-cyclic molecules that mimic natural aromatic polyketide products, and they highlight key residues that may interact directly with the putative substrate and product.

Docking simulations visualize chain length control of ARO/CYCs

In order to visualize how the putative bicyclic aromatic product of WhiE ARO/CYC (7, Figure 2) may bind to the interior pocket, and for comparison to the experimentally observed co-crystal structures, we performed docking simulations utilizing the program GOLD (40) (Figure 6A). Over 100 independent docking rounds, the bicyclic intermediate 7 was consistently docked in a wide ‘U’ shaped geometry. A cutaway view of a mesh surface representation of WhiE ARO/CYC reveals that its interior pocket (Figure 5A) is larger than the pocket of TcmN ARO/CYC (Figure 5B). Therefore, WhiE ARO/CYC is capable of accepting a 24-carbon polyketide intermediate and contains sufficient interior pocket space to mediate the C9-C14 first-ring and C7-C16 second-ring cyclizations.

To generate the larger interior pocket to accommodate a C24 (vs C20) polyketide substrate, WhiE ARO/CYC undergoes several subtle changes in pocket-residue composition and conformation compared to TcmN ARO/CYC (Figure 6). There are seven changes to the residues that define the WhiE ARO/CYC pocket, as compared to those of TcmN ARO/CYC (TcmN → WhiE ARO/CYC residue: T54 → M54, L93 → I93, H128 → N128, T132 → N132, T133 → S133, and N136 → Q136) (Figure 3, SI Figure S1). As noted from this list, there are three pocket-defining residues in WhiE ARO/CYC (T54, T132, and N136) with side-chains larger than the corresponding residues in TcmN ARO/CYC (M54, N132, and Q136). Therefore, pocket-residue switching alone does not explain the increased pocket size of WhiE ARO/CYC. Rather, the larger pocket for WhiE ARO/CYC can be explained by a combination of several factors: 1) The switch of H128 and T133 in TcmN ARO/CYC to the smaller N128 and S133, respectively, in WhiE ARO/CYC; 2) the change in conformation of the guanidinium group of R82 (flipped 180° and forming a 2.9 Å hydrogen bond with the backbone carbonyl of E84) (Figure 5A); 3) the slightly extended conformation of the loop connecting α3-β7 (Figures 4); and 4) the observed conformation of the side chains N132 and Q136 (both oriented away from the pocket interior). The extent to which protein crystallization may account for these changes is unknown; nevertheless, WhiE ARO/CYC crystal structure exemplifies that the interior pocket can accommodate a 24-carbon polyketide intermediate as compared to the pocket of TcmN ARO/CYC in binding a 20-carbon polyketide intermediate.

Pocket residue mutagenesis and in vitro activity assay

To explore the importance of pocket residues for ARO/CYC activity, we generated the following WhiE ARO/CYC mutants: F32A, E34A, Y35A/F/T, R69A/K/Q, and R82A/G/E/K/Q. Y35 and R69 were previously proposed as the active site residues that were critical for TcmN ARO/CYC activity and R82 had been observed to directly interact with the ligand from the two co-crystal structures (Figures 6 and 9B). The other residues were identified to be in close interaction distance to the putative ligand from our docking trials.

Figure 9.

Figure 9

The π–π interactions of Trp65-Arg82-Phe88. (A) WhiE (red) and TcmN (green) ARO/CYC overlays showing the positions of Trp and Phe are almost identical, while Arg82 of TcmN is in a different rotameric state than that of WhiE Arg82. (B) WhiE ARO/CYC apo (red) and JRSi284-bound (blue) overlays, with the ligand (JRSi284) showing significant movement for all three residues upon ligand binding.

To assay WT and mutant WhiE ARO/CYC activity, we performed in vitro reconstitution assays utilizing either the fungal PKS4 MinPKS (KS-MAT and ACP) from Gibberella fujikuroi (Figure 7, the PKS4 assay) (33) or the bacterial type II actinorhodin MinPKS (Act KS-CLF and ACP) from Streptomyces coelicolor (Figure 8, the Act assay) (29). Previous studies have established that PKS4 MinPKS alone produces a 1:1 mixture of 8 and 9 (Figure 7) (33). In contrast, when the C9-C14 (first ring) and C7-C16 (second ring)-specific WhiE or TcmN ARO/CYCs were combined in vitro with PKS4 MinPKS, there is a dramatic increase in the production of the C9-C14 cyclized compound 9 (9 : 8 = 10 : 1) (33).

Figure 7.

Figure 7

PKS4 MinPKS-based in vitro assay for WhiE ARO/CYC mutational analyses. The PKS4 MinPKS alone produces two products, 8 and 9 (in ~ 1:1 ratio), each with distinct cyclization patterns. WhiE ARO/CYC directs the cyclizations of nascent polyketide chain down a single path for C9-C14 first-ring cyclization in the production of PK8 (9).

Figure 8.

Figure 8

Actinorhodin MinPKS-based in vitro assay for WhiE ARO/CYC mutational analyses. The actinorhodin MinPKS alone produces two products, 10 and 11, each with distinct cyclization patterns. WhiE ARO/CYC directs the cyclizations of nascent polyketide chain down a single path for C9-C14 first-ring cyclization in the production of RM77 (13).

In the second assay, Act MinPKS alone produces the octaketides SEK4 10 (C7-C12 first-ring cyclization) and SEK4b 11 (C10-C15 first-ring cyclization) (41). These in vitro results correspond well with the in vivo expression results (41). In contrast, when WhiE or TcmN ARO/CYCs were incubated with the Act MinPKS, the resulting polyketides are the octaketide RM77 13 (42) and its reduced product, UWM1 12 (43), both of which are C9-C14 first-ring cyclized products (Figure 8). ZhuI ARO/CYC was included as a control for the Act assay, as it catalyzes C7-C12 first ring cyclization to produce SEK4 10 as the major product along with the minor product, SEK4b 11 (44). Based on the HPLC UV absorption, the yields are similar between the wild type and mutant enzymes. Therefore, the mutation affects the product distribution (in terms of cyclization pattern) but not the catalytic efficiency. Based on previous studies (45, 46), the rate limiting step for aromatic PKS should be the upstream chain elongation catalyzed by the KS domain, thus the mutation significantly changed the cyclization outcome, but not the efficiency. Below, we present the assay results of WhiE mutants.

1. Y35 Mutants

Based on work of TcmN ARO/CYC (18), the conserved Tyr35 was proposed to be the general base of ARO/CYC. To test this hypothesis, we generated Y35A, Y35T, and Y35F. Consistent with the previously proposed mechanism, Y35A and Y35T were inactive (Table 1). However, to our surprise, Y35F remains partially active (9 : 8 = 4.0 : 1 for the PKS4 assay, 12 and 13 are produced to WT levels in the Act assay). Further examination of WhiE ARO/CYC crystal structure reveals that Y35 interacts with F32 through edge-face π-π stacking. Y35F thus preserves this interaction. To probe the importance of this edge-face π-π interaction, F32A and F32Y/Y35F mutants were generated. F32A, similar to Y35A and Y35T, is inactive (Table 1). F32Y/Y35F is active, albeit to a lesser degree when compared to WT (12 and 13 are produced at approximately 4 times less than WT levels in the Act assay, Table 1). Taken together, these assay results show that the hydroxyl-moiety at residue 35 need not be present for catalysis but the preservation of the edge-face π-π interaction between Phe32 and Tyr35 is critical for ARO/CYC activity. Therefore, the tyrosinate may not act as the sole active site base. Rather, because the crystal structure shows a series of ordered water molecules interacting with Y35 and neighboring E34, the active site base can be a polarized water molecule. The inactive E34A mutant further supports this hypothesis. On the other hand, the loss of activity of F32A, Y35A, and Y35T may be related to a change of the local protein conformation. In comparison, Y35F and F32Y/Y35F remains active because the π-π interaction between Y35F and F32 is preserved, thus the ARO/CYC pocket remains unperturbed.

2. R69 Mutants

Based on our TcmN ARO/CYC work, the conserved R69 was proposed to be a general acid important for first-ring cyclization by ARO/CYC (18). To test this hypothesis, R69A, R69K, and R69Q mutants were generated. Consistent with the TcmN ARO/CYC mutation result, R69A and R69Q were both inactive (Table 1). The inactive R69Q supports the hypothesis that residue 69 needs to be more than just a polar functionality capable of anchoring the polyketide substrate through forming hydrogen bonds; rather, this position requires a positively charged residue side chain. The fact that R69K remains active corroborates well with this hypothesis (Table 1). In contrast, our recently published work on ZhuI ARO/CYC showed that the mutation of Arg66 (equivalent to Arg69 of WhiE and TcmN ARO/CYCs) to A, E, Q, or K abolished activity, suggesting that this guanidinium functionality is critical in controlling first ring cyclization and aromatization (5).

The slightly enhanced polyketide production by WhiE ARO/CYC R69K could be the result of the lowered pKa of the Lys ε-amine group compared to the Arg guanidinium moiety, thus allowing the Lys side chain to serve as a better proton donor. Further, because the Lys side chain is shorter than that of Arg, Lys may be better positioned to orient and interact with carbonyl-13 for protonation to form an enol intermediate. Supporting this hypothesis, docking simulation and the two co-crystal structures both that support that the different geometries of these two residues result in different positioning to interact with the substrate carbonyl groups. The residual activity was not observed in ZhuI ARO/CYC R66K mutant, as it remained inactive. Taken together, the above results suggest that the positive charge of residue 69 is critical for its role as the active site acid and aids in intermediate stabilization, as previously proposed for TcmN ARO/CYC (18).

3. Arg82 Mutants

The conserved Arg82 was proposed previously (18) as a proton donor that facilitates the second-ring aromatization (18).. To determine the role of R82 in catalysis, we generated R82A, R82G, R82E, R82Q, and R82K. Based on the above result for R69 mutants, we expect that R82K should remain active while the other mutants would be inactive. Additionally, if residue 82 only requires a side chain that can anchor the polyketide substrate, then the E, Q, and K mutants should all remain active. To our surprise, all five R82 mutants are inactive (Table 1). Therefore, the presence of an Arg at residue 82 is critical for enzyme activity. The WhiE ARO/CYC crystal structure provides a structural role for Arg82: there is a π-π stacking interaction between the delocalized π-electrons from the guanidinium moiety of Arg82 and the Trp65 indole ring. This is additionally stabilized by a perpendicular π-π stacking interaction from the side chain of Phe88 (Figure 9). These π-π stacking interactions help orient the WhiE ARO/CYC entrance loop (L-8, Figures 2 and 9) that controls ligand binding and product egress. Structural super-imposition of WhiE with TcmN ARO/CYC shows that the positions of Phe88 and Trp65 overlay well, while Arg82 possesses different rotameric conformations (Figure 9A). Despite the different conformations of the R82 guanidinium group, this series of π-π stacking interactions are preserved (Figure 9A).

In the WhiE ARO/CYC co-crystal structure, these side chain π-π stacking interactions are disturbed (Figure 9B) as a result of JRSi284 binding. JRSi284 binding essentially replaces Arg82 spatially, causing Trp65 to shift 1.2 Å to allow for Trp65-ligand π-π stacking (Figure 9B). An additional edge-face π-π interaction is observed between the ligand and Phe88 as Phe88 shifts 1.4 Å relative to the apo structure (Figure 9B). Finally, Arg82 shifts 0.9 Å away from its original position in the apo structure, but forms additional hydrogen bonds with JRSi284 (Figures 5 and 9B). From these interactions with the product analog JRSi284, we postulate that during the binding of the putative 24-carbon polyketide substrate Arg82 may modulate and facilitate the substrate binding or product release event via W65-R82-F88 interactions that orient loop L-8. The Trp-Arg-Phe stacking interactions would be disrupted and L-8 could be mis-oriented when Arg82 is mutated to other residues, resulting in a loss of enzyme activity as observed (Table 1). We conclude that Arg82 serves both a critical structural role in maintaining L-8 conformation, as well as the previously proposed role in polyketide substrate stabilization of the enol form (18, 19).

Proposed Gereral Mechanism of C9-C14 ARO/CYC

Based on the apo WhiE ARO/CYC structures, co-crystal structures of WhiE and TcmN ARO/CYCs, docking simulations, and mutational analyses, we proposed the following general mechanism for ARO/CYC-catalyzed C9-C14 and C7-C16 cylizations/aromatizations of type II polyketides. During our previous study of TcmN ARO/CYC, R69 and Y35 were proposed as the active site acid and base (18). Advancing from the proposed TcmN ARO/CYC mechanism (18), Arg69 is the active site acid, while the active-site base can be an E34-Y35-coordinated water molecule (Figure 10). For this reason, we mutated the corresponding Arg69, Arg82 and Tyr35 of WhiE ARO/CYC (Table 1), which supported the importance of these residues for ARO/CYC functions. Therefore, the first step is the abstraction of the α-proton from carbon 14 to form the enolate of carbonyl-13. Following the generation of the negative charge on carbonyl-13 oxygen, Arg69 is oriented to donate a proton to form an enol intermediate, which then collapses for C9-C14 first-ring cyclization. The coordinated water molecule then donates a proton to the negatively charged oxygen linked to carbon 9 as a result of the ring formation to stabilize the oxyanion. Docking simulation supports that the –OH of carbon-9 and proton of carbon-14 are in the anti- conformation, allowing for spontaneous dehydration to occur, forming a C-C double bond between carbon 9 and carbon 14. Alternatively, the coordinated water can abstract the proton from carbon-14 to generate the charge, which results in a C-C double bond between carbon 14 and carbon 13 (Figure 10). First-ring aromatization occurs before the same set of reactions proceeds for the C7-C16 second-ring cyclization. In the second ring cyclization step, the active site base is again a replenished, coordinated water molecule; however, the proton donor for second-ring cyclization and dehydration is hypothesized then to be the critical Arg82 residue (Figure 10).

Figure 10.

Figure 10

A revised ARO/CYC mechanism based on this work. A water molecule coordinated by Tyr35 and Glu34 acts as the active-site base to abstract a proton from carbon 14 (C14) to create the enolate at C13. The guanidinium moiety of Arg69, in close proximity to C13 oxygen, donates a proton to form the enol, which then collapses down to attack the C9 carbonyl to form the first ring. Tyr35, Ser67, and Arg69 then are involved in multiple rounds of dehydrations en route to an aromatized first ring. The second ring cyclization between C16 and C7, as well as the aromatization events, follow in a similar fashion. The absence of ARO/CYC leads to compound 8 in Figure 7 and compounds 10-11 in Figure 8, while the presence of WhiE ARO/CYC promotes C9-C14 cyclization and leads to the formation of compound 9 in Figure 7 and 13 in Figure 8.

Biological Significance

The crystal structure of WhiE ARO/CYC reveals that the overall structure and residue composition is similar to that of TcmN ARO/CYC, but subtle conformation and residue change in the pocket of WhiE ARO/CYC effectively increases the pocket space (compared to TcmN ARO/CYC) to accommodate the binding of a 24-carbon polyketide substrate that cyclized at C9-C14 first-ring and C6-C16 second ring. Findings from this work show that pocket residue variability and side chain conformation are important for chain length determination. The two cocrystal structures with product analogs bound pave the foundation for future studies on substrate/product binding of ARO/CYC. These findings can be leveraged to understand the large diversity of polyketides with varied chain lengths and cyclization patterns that are affected by the ARO/CYCs from various Type II PKS pathways. These examples include actinorhodin (13) (octaketide), tetracenomycin C (47) and daunorubicin (48) (decaketides), whiE spore pigment (15) and pradimicin (49) (dodecaketides), griseorhodin A (50) (tridecaketide), and the pentadecaketide fredericamycin (51) ARO/CYCs.

The two enzyme assays show that WhiE ARO/CYC productively interacts with both bacterial Type II and fungal aromatic Type I MinPKS assemblies to direct the C9-C14 first-ring and C7-C16 second-ring cyclization. These findings are significant in utilizing ARO/CYCs in engineered biosynthesis as they show that ARO/CYCs control the initial cyclization regiospecificity. Further, ARO/CYCs not only control the cyclization pattern but also control chain lengths when reconstituted with different MinPKS systems.

The WhiE ARO/CYC interior pocket residues R69 and R82 are critical for its cyclization activity. The observation that the charge property of Arg69 is critical corroborates well with the TcmN ARO/CYC mutagenesis studies (18). Despite the larger interior pocket size and four extra carbons for its natural substrate, WhiE ARO/CYC promotes the same first- and second-ring cyclization pattern as TcmN ARO/CYC, suggesting that the residues at the entrance of the pocket may be as important as the interior pocket residues for directing cyclization events. The conserved Arg82 near the pocket entrance may mediate these interactions, as we demonstrated that the guanidinium moiety contributes critical structural and physical properties to the ARO/CYC entrance local environment. We conclude that the docking of ACP and the extent to which the polyketide chain is introduced into the ARO/CYC pocket, possibly controlled by the conserved Arg82 along with the loop L-8 local environment, are critical determinants of cyclization specificity.

Supplementary Material

1_si_001

Acknowledgements

We thank Prof. Yi Tang for the generous provision of pYT198 and Pks4 Min PKS constructs, Prof. Craig Townsend for the generous gift of JRSi284, Prof. John Crosby for the generous gift of pRJC006, and we are grateful for the assistance of Dr. John Greaves, Director of the UCI Mass Spectrometry Facility, for product characterization. Diffraction data were collected at the Stanford Synchrotron Radiation Laboratory (SSRL) and the Advanced Light Source (ALS).

Abbreviations

ARO/CYC

aromatase/cyclase

PKS

polyketide synthase

ACP

acyl carrier protein

KS

ketosynthase

CLF

chain length factor

DH

dehydratase

KR

ketorductase

PPT

phosphopantetheine

FAS

fatty acid synthase

Footnotes

†

SCT, BDA, and MYL are supported by the Pew Foundation and National Institute of General Medicinal Sciences (NIGMS R01GM076330).

Supporting Information Available on the stereo view of protein models. This material is available free of charge via the Internet at http://pubs.acs.org.

The atomic coordinates have been deposited in the Protein Data Bank (accession codes 3TVR, 3TVQ, and 3TL1).

Reference

  • 1.Rawlings BJ. Biosynthesis of polyketides (other than actinomycete macrolides) Nat Prod Rep. 1999;16:425–484. doi: 10.1039/a900566h. [DOI] [PubMed] [Google Scholar]
  • 2.Byers DM, Gong H. Acyl carrier protein: structure-function relationships in a conserved multifunctional protein family. Biochem Cell Biol. 2007;85:649–662. doi: 10.1139/o07-109. [DOI] [PubMed] [Google Scholar]
  • 3.Zhou P, Florova G, Reynolds KA. Polyketide synthase acyl carrier protein (ACP) as a substrate and a catalyst for malonyl ACP biosynthesis. Chem Biol. 1999;6:577–584. doi: 10.1016/S1074-5521(99)80090-8. [DOI] [PubMed] [Google Scholar]
  • 4.Ames BD, Korman TP, Zhang W, Smith P, Vu T, Tang Y, Tsai SC. Crystal structure and functional analysis of tetracenomycin ARO/CYC: implications for cyclization specificity of aromatic polyketides. PNAS. 2008;105:5349–5354. doi: 10.1073/pnas.0709223105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Ames BD, Lee MY, Moody C, Zhang W, Tang Y, Tsai SC. Structural and biochemical characterization of ZhuI aromatase/cyclase from the R1128 polyketide pathway. Biochemistry. 2011;50:8392–8406. doi: 10.1021/bi200593m. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Davis NK, Chater KF. Spore colour in Streptomyces coelicolor A3(2) involves the developmentally regulated synthesis of a compound biosynthetically related to polyketide antibiotics. Mol Microbiol. 1990;4:1679–1691. doi: 10.1111/j.1365-2958.1990.tb00545.x. [DOI] [PubMed] [Google Scholar]
  • 7.Yu T-W, Hopwood DA. Ectopic expression of the Streptomyces coelicolor whiE genes for polyketide spore pigment synthesis and their interaction with the act genes for actinorhodin biosynthesis. Microbiology. 1995;141:2779–2791. doi: 10.1099/13500872-141-11-2779. [DOI] [PubMed] [Google Scholar]
  • 8.Blanco G, Brianb P, Pereda A, Méndez C, Salas JA, Chater KF. Hybridization and DNA sequence analyses suggest an early evolutionary divergence of related biosynthetic gene sets encoding polyketide antibiotics and spore pigments in Streptomyces spp. Gene. 1993;130:107–116. doi: 10.1016/0378-1119(93)90352-4. [DOI] [PubMed] [Google Scholar]
  • 9.Blanco G, Pereda A, Méndez C, Salas J. Cloning and disruption of a fragment of Streptomyces halstedii DNA involved in the biosynthesis of a spore pigment. Gene. 1992;112:59–65. doi: 10.1016/0378-1119(92)90303-7. [DOI] [PubMed] [Google Scholar]
  • 10.Bergh S, Uhlén M. Analysis of a polyketide synthesis-encoding gene cluster of Streptomyces curacoi. Gene. 1992;117:131–136. doi: 10.1016/0378-1119(92)90501-f. [DOI] [PubMed] [Google Scholar]
  • 11.Motamedi H, Hutchinson CR. Cloning and heterologous expression of a gene cluster for the biosynthesis of tetracenomycin C, the anthracycline antitumor antibiotic of Streptomyces glaucescens. PNAS. 1987;84:4445–4449. doi: 10.1073/pnas.84.13.4445. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Ichinose K, Bedford DJ, Tornus D, Bechthold A, Bibb MJ, Revill W. Peter, Floss HG, Hopwood DA. The granaticin biosynthetic gene cluster of Streptomyces violaceoruber Tü22: sequence analysis and expression in a heterologous host. Chem Biol. 1998;5:647–659. doi: 10.1016/s1074-5521(98)90292-7. [DOI] [PubMed] [Google Scholar]
  • 13.McDaniel R, Ebert-Khosla S, Hopwood DA, Khosla C. Engineered biosynthesis of novel polyketides: actVII and actIV genes encode aromatase and cyclase enzymes, respectively. J Am Chem Soc. 1994;116:10855–10859. [Google Scholar]
  • 14.Shen Y, Yoon P, Yu TW, Floss HG, Hopwood D, Moore BS. Ectopic expression of the minimal whiE polyketide synthase generates a library of aromatic polyketides of diverse sizes and shapes. PNAS. 1999;96:3622–3627. doi: 10.1073/pnas.96.7.3622. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Yu T-W, Shen Y, McDaniel R, Floss HG, Khosla C, Hopwood DA, Moore BS. Engineered Biosynthesis of Novel Polyketides from Streptomyces Spore Pigment Polyketide Synthases. J Am Chem Soc. 1998;120:7749–7759. [Google Scholar]
  • 16.Alvarez MA, Fu H, Khosla C, Hopwood DA, Bailey JE. Engineered biosynthesis of novel polyketides: properties of the whiE aromatase/cyclase. Nat Biotechnol. 1996;14:335–338. doi: 10.1038/nbt0396-335. [DOI] [PubMed] [Google Scholar]
  • 17.McDaniel R, Hutchinson CR, Khosla C. Engineered Biosynthesis of Novel Polyketides: Analysis of tcmN Function in Tetracenomycin Biosynthesis. J Am Chem Soc. 1995;117:6805–6810. [Google Scholar]
  • 18.Ames BD, Korman TP, Zhang W, Smith P, Vu T, Tang Y, Tsai S-C. Crystal structure and functional analysis of tetracenomycin ARO/CYC: Implications for cyclization specificity of aromatic polyketides. PNAS. 2008;105:5349–5354. doi: 10.1073/pnas.0709223105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Ames BD, Lee M-Y, Moody C, Zhang W, Tang Y, Tsai S-C. Structural and Biochemical Characterization of ZhuI Aromatase/Cyclase from the R1128 Polyketide Pathway. Biochemistry. 2011 doi: 10.1021/bi200593m. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Bradford M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248–254. doi: 10.1016/0003-2697(76)90527-3. [DOI] [PubMed] [Google Scholar]
  • 21.Otwinowski Z, Minor W. Processing of x-ray diffraction data collected in oscillation mode. Methods in enzymology. 1997;276:307–326. doi: 10.1016/S0076-6879(97)76066-X. [DOI] [PubMed] [Google Scholar]
  • 22.Brunger AT, Adams PD, Clore GM, DeLano WL, Gros P, Grosse-Kunstleve RW, Jiang JS, Kuszewski J, Nilges M, Pannu NS, Read RJ, Rice LM, Simonson T, Warren GL. Crystallography & NMR system: A new software suite for macromolecular structure determination. Acta Crystallogr D. 1998;54(Pt 5):905–921. doi: 10.1107/s0907444998003254. [DOI] [PubMed] [Google Scholar]
  • 23.Emsley P, Cowtan K. Coot: model-building tools for molecular graphics. Acta Crystallogr D. 2004;60:2126–2132. doi: 10.1107/S0907444904019158. [DOI] [PubMed] [Google Scholar]
  • 24.Murshudov GN, Vagin AA, Dodson EJ. Refinement of macromolecular structures by the maximum-likelihood method. Acta Crystallogr D. 1997;53:240–255. doi: 10.1107/S0907444996012255. [DOI] [PubMed] [Google Scholar]
  • 25.Afonine PV, Mustyakimov M, Grosse-Kunstleve RW, Moriarty NW, Langan P, Adams PD. Joint X-ray and neutron refinement with phenix.refine. Acta crystallogr D. 2010;66:1153–1163. doi: 10.1107/S0907444910026582. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Adams PD, Afonine PV, Bunkoczi G, Chen VB, Davis IW, Echols N, Headd JJ, Hung LW, Kapral GJ, Grosse-Kunstleve RW, McCoy AJ, Moriarty NW, Oeffner R, Read RJ, Richardson DC, Richardson JS, Terwilliger TC, Zwart PH. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta crystallogra D. 2010;66:213–221. doi: 10.1107/S0907444909052925. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Adams PD, Gopal K, Grosse-Kunstleve RW, Hung LW, Ioerger TR, McCoy AJ, Moriarty NW, Pai RK, Read RJ, Romo TD, Sacchettini JC, Sauter NK, Storoni LC, Terwilliger TC. Recent developments in the PHENIX software for automated crystallographic structure determination. Journal of synchrotron radiation. 2004;11:53–55. doi: 10.1107/s0909049503024130. [DOI] [PubMed] [Google Scholar]
  • 28.Schuttelkopf AW, van Aalten DMF. PRODRG: a tool for high-throughput crystallography of protein-ligand complexes. Acta Crystallogr D. 2004;60:1355–1363. doi: 10.1107/S0907444904011679. [DOI] [PubMed] [Google Scholar]
  • 29.Matharu AL, Cox RJ, Crosby J, Byrom KJ, Simpson TJ. MCAT is not required for in vitro polyketide synthesis in a minimal actinorhodin polyketide synthase from Streptomyces coelicolor. Chem Biol. 1998;5:699–711. doi: 10.1016/s1074-5521(98)90663-9. [DOI] [PubMed] [Google Scholar]
  • 30.Pfeifer BA, Admiraal SJ, Gramajo H, Cane DE, Khosla C. Biosynthesis of complex polyketides in a metabolically engineered strain of E. coli. Science. 2001;291:1790–1792. doi: 10.1126/science.1058092. [DOI] [PubMed] [Google Scholar]
  • 31.Oppermann U, Filling C, Hult M, Shafqat N, Wu X, Lindh M, Shafqat J, Nordling E, Kallberg Y, Persson B, Jornvall H. Short-chain dehydrogenases/reductases (SDR): the 2002 update. Chem Biol Interact. 2003;143-144:247–253. doi: 10.1016/s0009-2797(02)00164-3. [DOI] [PubMed] [Google Scholar]
  • 32.Kumar P, Koppisch AT, Cane DE, Khosla C. Enhancing the modularity of the modular polyketide synthases: transacylation in modular polyketide synthases catalyzed by malonyl-CoA:ACP transacylase. J Am Chem Soc. 2003;125:14307–14312. doi: 10.1021/ja037429l. [DOI] [PubMed] [Google Scholar]
  • 33.Zhang W, Li Y, Tang Y. Engineered biosynthesis of bacterial aromatic polyketides in Escherichia coli. PNAS. 2008;105:20683–20688. doi: 10.1073/pnas.0809084105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Jones G, Willett P, Glen RC, Leach AR, Taylor R. Development and validation of a genetic algorithm for flexible docking. J Mol Biol. 1997;267:727–748. doi: 10.1006/jmbi.1996.0897. [DOI] [PubMed] [Google Scholar]
  • 35.Iyer LM, Koonin EV, Aravind L. Adaptations of the helix-grip fold for ligand binding and catalysis in the START domain superfamily. Proteins. 2001;43:134–144. doi: 10.1002/1097-0134(20010501)43:2<134::aid-prot1025>3.0.co;2-i. [DOI] [PubMed] [Google Scholar]
  • 36.Radauer C, Lackner P, Breiteneder H. The Bet v 1 fold: an ancient, versatile scaffold for binding of large, hydrophobic ligands. BMC Evol Biol. 2008;8:286. doi: 10.1186/1471-2148-8-286. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Tsujishita Y, Hurley JH. Structure and lipid transport mechanism of a StAR-related domain. Nature Struct Biol. 2000;7:408–414. doi: 10.1038/75192. [DOI] [PubMed] [Google Scholar]
  • 38.Schrick K, Nguyen D, Karlowski W, Mayer K. START lipid/sterol-binding domains are amplified in plants and are predominantly associated with homeodomain transcription factors. Genome Biol. 2004;5:R41. doi: 10.1186/gb-2004-5-6-r41. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Liu J-J, Ekramoddoullah AKM. The family 10 of plant pathogenesis-related proteins: Their structure, regulation, and function in response to biotic and abiotic stresses. Physiol Mol Plant Path. 2006;68:3–13. [Google Scholar]
  • 40.Verdonk ML, Cole JC, Hartshorn MJ, Murray CW, Taylor RD. Improved protein-ligand docking using GOLD. Proteins. 2003;52:609–623. doi: 10.1002/prot.10465. [DOI] [PubMed] [Google Scholar]
  • 41.Carreras CW, Khosla C. Purification and in vitro reconstitution of the essential protein components of an aromatic polyketide synthase. Biochemistry. 1998;37:2084–2088. doi: 10.1021/bi972919+. [DOI] [PubMed] [Google Scholar]
  • 42.Kramer PJ, Zawada RJX, McDaniel R, Hutchinson CR, Hopwood DA, Khosla C. Rational design and engineered biosynthesis of a novel 18-carbon aromatic polyketide. J Am Chem Soc. 1997;119:635–639. [Google Scholar]
  • 43.Seow KT, Meurer G, Gerlitz M, Wendt-Pienkowski E, Hutchinson CR, Davies J. A study of iterative type II polyketide synthases, using bacterial genes cloned from soil DNA: a means to access and use genes from uncultured microorganisms. J Bacteriol. 1997;179:7360–7368. doi: 10.1128/jb.179.23.7360-7368.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Tang Y, Lee TS, Khosla C. Engineered biosynthesis of regioselectively modified aromatic polyketides using bimodular polyketide synthases. PLoS Biol. 2004;2:E31. doi: 10.1371/journal.pbio.0020031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Beltran-Alvarez P, Arthur CJ, Cox RJ, Crosby J, Crump MP, Simpson TJ. Preliminary kinetic analysis of acyl carrier protein-ketoacylsynthase interactions in the actinorhodin minimal polyketide synthase. Mol Biosyst. 2009;5:511–518. doi: 10.1039/b821844g. [DOI] [PubMed] [Google Scholar]
  • 46.Beltran-Alvarez P, Cox RJ, Crosby J, Simpson TJ. Dissecting the component reactions catalyzed by the actinorhodin minimal polyketide synthase. Biochemistry. 2007;46:14672–14681. doi: 10.1021/bi701784c. [DOI] [PubMed] [Google Scholar]
  • 47.Shen B, Hutchinson CR. Deciphering the mechanism for the assembly of aromatic polyketides by a bacterial polyketide synthase. PNAS. 1996;93:6600–6604. doi: 10.1073/pnas.93.13.6600. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Hutchinson CR. Biosynthetic Studies of Daunorubicin and Tetracenomycin C. Chem Rev. 1997;97:2525–2536. doi: 10.1021/cr960022x. [DOI] [PubMed] [Google Scholar]
  • 49.Kim BC, Lee JM, Ahn JS, Kim BS. Cloning, Sequencing, and Characterization of the Pradimicin Biosynthetic Gene Cluster of Actinomadura hibisca P157-2. J Microbiol Biotechnol. 2007;17:830–839. [PubMed] [Google Scholar]
  • 50.Li A, Piel J. A Gene Cluster from a Marine Streptomyces Encoding the Biosynthesis of the Aromatic Spiroketal Polyketide Griseorhodin A. Chem Biol. 2002;9:1017–1026. doi: 10.1016/s1074-5521(02)00223-5. [DOI] [PubMed] [Google Scholar]
  • 51.Wendt-Pienkowski E, Huang Y, Zhang J, Li B, Jiang H, Kwon H, Hutchinson CR, Shen B. Cloning, Sequencing, Analysis, and Heterologous Expression of the Fredericamycin Biosynthetic Gene Cluster from Streptomyces griseus. J Am Chem Soc. 2005;127:16442–16452. doi: 10.1021/ja054376u. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1_si_001

RESOURCES