Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2013 Jun 1.
Published in final edited form as: Biochim Biophys Acta. 2012 Mar 24;1821(6):923–933. doi: 10.1016/j.bbalip.2012.03.002

A predicted geranylgeranyl reductase reduces the ω-position isoprene of dolichol phosphate in the halophilic archaeon, Haloferax volcanii

Shai Naparstek 1,#, Ziqiang Guan 2,#, Jerry Eichler 1,*
PMCID: PMC3340491  NIHMSID: NIHMS367674  PMID: 22469971

Abstract

In N-glycosylation in both Eukarya and Archaea, N-linked oligosaccharides are assembled on dolichol phosphate prior to transfer of the glycan to the protein target. However, whereas only the α-position isoprene subunit is saturated in eukaryal dolichol phosphate, both the α- and ω-position isoprene subunits are reduced in the archaeal lipid. The agents responsible for dolichol phosphate saturation remain largely unknown. The present study sought to identify dolichol phosphate reductases in the halophilic archaeon, Haloferax volcanii. Homology-based searches recognize HVO_1799 as a geranylgeranyl reductase. Mass spectrometry revealed that cells deleted of HVO_1799 fail to fully reduce the isoprene chains of Hfx. volcanii membrane phospholipids and glycolipids. Likewise, the absence of HVO_1799 led to a loss of saturation of the ω-position isoprene subunit of C55 and C60 dolichol phosphate, with the effect of HVO_1799 deletion being more pronounced with C60 dolichol phosphate than with C55 dolichol phosphate. Glycosylation of dolichol phosphate in the deletion strain occurred preferentially on that version of the lipid saturated at both the α- and ω-position isoprene subunits.

Keywords: Archaea, dolichol phosphate, geranylgeranyl reductase, Haloferax volcanii, isoprene, reductase

1. INTRODUCTION

Polyisoprenoids, polymers of up to 100 linearly-linked isoprene subunits, serve various structural and biochemical functions [1–3]. Although synthesized by all three domains of life, namely Eukarya, Bacteria and Archaea [1–5], only Archaea rely on polyisoprenoids as the building blocks of their membrane lipids. Indeed, although originally defined as a domain of life distinct from either Bacteria or Eukarya on the basis of 16S ribosomal RNA (16S rRNA) secondary sequence comparison [6,7], Archaea can also be distinguished by their unique membrane lipid structures. Rather than comprising fatty acyl groups ester-linked to sn-glycerol-3-phosphate as in Eukarya and Bacteria, archaeal phospholipids are composed of isoprenoid chains ether-linked to sn-glycerol-1-phosphate [8,9].

Despite their importance in archaeal biology, the biogenesis of polyisoprenoids in Archaea has received only limited attention. While it is thought that archaeal polyisoprenoid biosynthesis relies on similar pathways as in Eukarya and Bacteria [2,3,5], aspects of the process seemingly unique to Archaea have been reported. In Methanocaldococcus jannaschii, Thermoplasma acidophilum and Methanothermobacter thermautotrophicum, the mevalonate (MVA)1 pathway used for generating the polyisoprenoid precursors, isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP), relies on isopentenyl phosphate kinase (IPK) to convert isopentenyl phosphate to IPP [10,11]. In the traditional MVA pathway, mevalonate-5-pyrophosphate undergoes decarboxylation to yield IPP [12]. Indeed, IPK is apparently unique to Archaea [5]. A second example of a seemingly archaea-specific facet of polyisoprenoid biogenesis was provided upon in vitro analysis of Sulfolobus acidocaldarius cis-polyprenyl diphosphate synthase, where the preferred substrate was reported to be geranylgeranyl pyrophosphate (GGPP) [13]. This differs from what occurs in Eukarya and Bacteria, where farnesyl pyrophosphate (FPP) serves as the primary substrate of this enzyme in the biogenesis of the polyisoprenoids, dolichol phosphate [DolP] and undecaprenol phosphate (UndP), respectively [2,3]. Finally, an enzyme from M. thermoautotrophicum catalyzing both GGPP and FPP synthesis was characterized and shown to be a bi-functional enzyme, distinct from the single function prenyl synthases found elsewhere [14].

In addition to playing structural roles in membrane lipids, polyisoprenoids also participate in other biological processes in Archaea. In archaeal N-glycosylation, as in the parallel processes in Eukarya and Bacteria, the oligosaccharides that decorate select asparagine residues of target proteins are first assembled on polyisoprenoid carriers [2,3,15–18]. Like Eukarya, Archaea utilize DolP as the glycan-charged lipid carrier [19,20]. In contrast, UndP serves this role in Bacteria [16]. However, unlike eukaryal dolichol that contains only a saturated α-position isoprene subunit, both the α- and ω-position isoprene subunits are saturated in archaeal dolichol [19,20]. Presently, little is known of the enzymes responsible for dolichol isoprene subunit reduction. Recently, SRD5A3 was identified as a polyprenol reductase responsible for saturating the α-position isoprene subunit of human dolichol, with mutation in Srd5a3 being the cause of a novel congenital disorder of glycosylation [21]. As the Hfx. volcanii genome does not include a Srd5a3 ortholog, the polyprenol reductase(s) responsible for saturating the α- and ω-position isoprene subunits of archaeal dolichol have yet to identified.

In this study, we report that HVO_1799, a predicted geranylgeranyl reductase (GGR) homologue found in the halophilic archaeon Haloferax volcanii, reduces the ω-position isoprene of dolichol phosphate.

2. MATERIALS AND METHODS

2.1 Strains and growth conditions

Hfx. volcanii WR536 parent strain cells were grown in medium containing 3.4 M NaCl, 0.15 M MgSO4•7H20, 1 mM MnCl2, 4 mM KCl, 3 mM CaCl2, 0.3 % (w/v) yeast extract, 0.5 % (w/v) tryptone, 50 mM Tris-HCl, pH 7.2, at 42°C [22].

2.2 Deletion of HVO_1799

Deletion of Hfx. volcanii HVO_1799 was achieved using a previously described approach [23,24]. To amplify approximately 500 bp-long regions flanking the coding sequence of HVO_1799, the HVO_1799-5’ upfor (gggctcgagGTTCCGCGACGCCCTCGCCGA; genomic sequence in capital letters) and HVO_1799-5’uprev (cccaagcttTGTAGAGTAGGCATCACCGGT) primers, directed against the upstream flanking region, and the HVO_1799-3’downfor (cccggatccGCCGCCGGGCGACACGCGCGT) and HVO_1799-3’downrev (gggtctagaCGGCCGCCGTCTCCCGAGTCG) primers, directed against the downstream flanking region, were employed. XhoI and HindIII sites were introduced using the HVO_1799-5'upfor and HVO_1799-5'uprev primers, respectively, while BamHI and XbaI sites were introduced using the HVO_1799-3’downfor and HVO_1799-3’downrev primers, respectively.

To confirm deletion of HVO_1799 at the DNA level, PCR amplification was performed using forward primers directed against either an internal region of HVO_1799 (HVO_1799-for; ATGACTGACAACTACGACGTGATTATCGC) or trpA (gggaagcttATGTCGCTCGAAGACGCCTCC) together with a reverse primer against a region downstream of HVO_1799 (HVO_1799-5’downrev).

For complementation of the deletion strain, HVO_1799 was PCR amplified from Hfx. volcanii parent strain genomic DNA using primers designed to introduce NdeI (catatgATGACTGACAACTACGACGTGAT) and KpnI (ggtaccTCAGTTCGAGAACCAGTCTTTC) at the 5′- and 3′-ends, respectively. Next, the insert was ligated into the pGEM-T Easy vector (Promega). The HVO_1799 gene was then excised upon digestion with NdeI and KpnI and inserted into the pWL-CBD vector [25], also digested with the same restriction enzymes, resulting in DNA encoding the Clostridium thermocellum cellulosome cellulose-binding domain (CBD) fused to the 5′ end of HVO_1799.

2.3 Reverse transcription-polymerase chain reaction (RT-PCR)

RT-PCR performed as previously described [24]. Briefly, RNA from parent strain cells was isolated using an Easy Spin Total RNA Extraction Kit (Intron Biotechnology, Kyungki-Do, Korea). RNA concentration was determined spectrophotometrically and contaminating DNA was eliminated with a DNAFree kit (Ambion, Austin, TX). cDNA was prepared from the corresponding RNA (2 µg) using random hexamers (150 ng) in a SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen, Carlsbad, CA). The single-stranded cDNA was then used as PCR template in a reaction containing the appropriate forward (ATGACTGACAACTACGACGTGATTATCGC) and reverse (TCAGTTCGAGAACCAGTCTTTCGCGG) primer pair.

2.4 Liquid Chromatography/Electrospray Ionization Mass Spectrometry (LC/MS) and Tandem Mass Spectrometry (MS/MS)

LC-ESI/MS/MS analysis of a total Hfx. volcanii lipid extract and the S-layer glycoprotein were performed as described previously [26,27].

Normal phase LC-ESI/MS of Hfx. volcanii lipids was performed using an Agilent 1200 Quaternary LC system coupled to a QSTAR XL quadrupole time-of-flight tandem mass spectrometer (Applied Biosystems, Foster City, CA). An Ascentis Si HPLC column (5 µm, 25 cm × 2.1 mm) was used. Mobile phase A consisted of chloroform/methanol/aqueous ammonium hydroxide (800:195:5, v/v/v). Mobile phase B consisted of chloroform/methanol/water/ aqueous ammonium hydroxide (600:340:50:5, v/v/v/v). Mobile phase C consisted of chloroform/methanol/water/aqueous ammonium hydroxide (450:450:95:5, v/v/v/v). The elution program consisted of the following: 100% mobile phase A was held isocratically for 2 min and then linearly increased to 100% mobile phase B over 14 min and held at 100% B for 11 min. The LC gradient was then changed to 100% mobile phase C over 3 min and held at 100% C for 3 min, and finally returned to 100% A over 0.5 min and held at 100% A for 5 min. The total LC flow rate was 300 µl/min. The post-column splitter diverted ~10% of the LC flow to the ESI source of the Q-Star XL mass spectrometer, with MS settings as follows: IS = −4500 V, CUR = 20 psi, GS1 = 20 psi, DP = −55 V, and FP = −150 V. Nitrogen was used as the collision gas for MS/MS experiments. Data acquisition and analysis were performed using the instrument’s Analyst QS software.

For LC-ESI/MS analysis of the Hfx. volcanii S-layer glycoprotein, Hfx. volcanii cells were separated on 7.5% polyacrylamide gels and stained with Coomassie R-250 (Fluka, St. Louis MO). For in-gel digestion of the S-layer glycoprotein, the protein band was excised, destained in 400 µl of 50% (vol/vol) acetonitrile (Sigma, St Louis, MO) in 40 mM NH4HCO3, pH 8.4, dehydrated with 100% acetonitrile, and dried using a SpeedVac drying apparatus. The S-layer glycoprotein was reduced with 10 mM dithiothreitol (Sigma) in 40 mM NH4HCO3 at 56°C for 60 min and then alkylated for 45 min at room temperature with 55 mM iodoacetamide in 40 mM NH4HCO3. The gel pieces were washed with 40 mM NH4HCO3 for 15 min, dehydrated with 100% acetonitrile, and SpeedVac dried. The gel slices were rehydrated with 12.5 ng/µl of mass spectrometry (MS)-grade Trypsin Gold (Promega, Madison, WI) in 40 mM NH4HCO3. The protease-generated peptides were extracted with 0.1% (v/v) formic acid in 20 mM NH4HCO3, followed by sonication for 20 min at room temperature, dehydration with 50% (v/v) acetonitrile, and additional sonication. After three rounds of extraction, the gel pieces were dehydrated with 100% acetonitrile, dried completely with a SpeedVac, resuspended in 5% (v/v) acetonitrile containing 1% formic acid (v/v) and infused into the mass spectrometer using static nanospray Econotips (New Objective, Woburn, MA). The protein digests were separated on-line by nano-flow reverse-phase liquid chromatography (LC) by loading onto a 150-mm by 75-µm (internal diameter) by 365-µm (external diameter) Jupifer pre-packed fused silica 5-µm C18 300Å reverse-phase column (Thermo Fisher Scientific, Bremen, Germany). The sample was eluted into the LTQ Orbitrap XL mass spectrometer (Thermo Fisher Scientific) using a 60-min linear gradient of 0.1% formic acid (v/v) in acetonitrile/0.1% formic acid (1:19, by volume) to 0.1% formic acid in acetonitrile/0.1% formic acid (4:1, by volume) at a flow rate of 300 nl/min.

2.5 Other methods

Immunoblotting was performed using polyclonal antibodies raised against the C. thermocellum cellulose-binding domain (obtained from Ed Bayer, Weizmann Institute of Science; 1:10,000). Antibody binding was detected using goat anti-rabbit horseradish peroxidase (HRP)-conjugated antibodies (1:4000, BioRad, Hercules, CA) and an ECL enhanced chemiluminescence kit (Amersham, Buckingham, UK).

3. RESULTS

3.1 HVO_1799 is a predicted geranylgeranyl reductase

The search for Hfx. volcanii genes encoding proteins responsible for reduction of the α-and/or ω position isoprene subunit[s] of dolichol phosphate began with a scanning of the Hfx. volcanii genome for homologues of known archaeal GGRs. During membrane lipid biogenesis, GGRs are responsible for the reduction of unsaturated isoprenoid side chains [2,3], such as those that constitute the hydrophobic moiety of the ether-linked membrane lipids of Archaea [28–31]. This strategy was based on the fact that almost all Archaea harbor multiple paralogues of GGRs within their genome and that these enzymes are considered to be involved in the reduction of other archaeal isoprenoid-based compounds, besides membrane lipids [5]. Accordingly, the amino acid sequences of T. acidophilum TA0516, Archaeoglobus fulgidus AF0464 and S. acidocaldarius Saci_0986, all shown to possess 2,3-di-O-geranylgeranylglyceryl phosphate (DGGGP)-reducing activity [28–30], were used to probe the Hfx. volcanii genome. Such homology searches led to the identification of HVO_1799 as putative Hfx. volcanii GGR. Like T. acidophilum TA0516, S. acidocaldarius Saci_0986 and A. fulgidus AF0464, HVO_1799 is also assigned to the NADB_Rossmann Superfamily, a group of proteins that share a NAD(P)H/NAD(P)(+)-binding domain found in many redox enzymes [32]. Alignment of the four sequences is presented in Fig 1.

Fig 1.

Fig 1

Alignment of HVO_1799 with other archaeal GGRs. The amino acids sequences of Hfx. volcanii HVO_1799, T. acidophilum TA0516, A. fulgidus AF0464 and S. acidocaldarius Saci_0986 were aligned by ClustalW2 (www.ebi.ac.uk/Tools/clustalw2/index.html), using the default settings. Fully or largely conserved residues are shown against a black background.

As transcription of a given open reading frame offers strong support that the sequence in question corresponds to a true, protein-encoding gene, RT-PCR was performed. Under the growth condition considered (i.e. growth to mid-logarithmic phase in rich medium), HVO_1799 was transcribed (Fig 2A). Next, to begin assessing HVO_1799 function, a strain of Hfx. volcanii deleted of the encoding gene was generated. In this so-called ‘pop-in/pop-out’ approach [23], the genomic copy of the gene of interest (in this case, HVO_1799) in a strain auxotrophic for tryptophan is replaced by the Hfx. volcanii tryptophan synthase-encoding trpA sequence. The successful replacement of HVO_1799 by trpA was verified at the DNA level by PCR, using genomic DNA from the parent or the deletion strain as template, together with a forward primer directed at a region within HVO_1799 and a reverse primer directed at a downstream region or using the same reverse primer together with a forward primer directed at a region within trpA. While the parent strain contains the HVO_1799 sequence, the gene was not detected in the deletion strain, having been replaced by the trpA sequence (Fig 2B). Despite the absence of HVO_1799, the mutant strain grew as well as did the parent strain. Mutant cell colonies were, however, less pigmented than were colonies of parent strain cells.

Fig 2.

Fig 2

Deletion of HVO_1799. A. RT-PCR was performed using appropriate primers and genomic DNA or RNA from Hfx. volcanii cells, cDNA generated from the isolated RNA or no nucleic acids as template to reveal the transcription of HVO_1799. The position of the HVO_1799 PCR product is indicated. B. The deletion of HVO_1799, performed as described in the Materials and Methods section, was verified by PCR amplification using a forward primer directed to a sequence within the HVO_1799 coding region and a reverse primer directed at the HVO_1799 3’ flanking region (primer pair a) or using a forward primer directed to a sequence at the start of the trpA sequence and the same reverse primer as above (primer pair b), together with genomic DNA from cells of the parent strain (parent panel) or from cells where HVO_1799 had been replaced with trpA (ΔHVO_1799 panel), as template. The positions to which the various primer pairs bind are shown in the drawing below the panels. Note that the same flanking regions border HVO_1799 and trpA. The positions of HVO_1799 and trpA PCR products are shown.

3.2 Hfx. volcanii membrane lipids are affected in cells lacking HVO_1799

To assess whether HVO_1799 contributes to Hfx. volcanii membrane lipid biogenesis, possibly acting as a GGR, a total lipid extract was prepared and examined by LC-ESI/MS. When the major membrane phospholipids, archaetidylglycerol methylphosphate (PGP-Me) and archaetidylglycerol (PG), respectively accounting for 44% and 35% of the Hfx. volcanii polar lipid pool [33], were considered, substantial differences were noted between the MS profiles of each lipid in the parent and mutant strains. In the parent strain, mass spectrometry detected PGP-Me (C47H98O11P2) as a [M-H]− ion peak at m/z 899.609, a value in good agreement with the exact mass of the molecule (900.658 Da) (Fig 3, upper panel of top pair of profiles). In cells deleted of HVO_1799, this peak was instead detected at m/z 891.560, a value that would result from a failure to saturate four isoprene subunits of the molecule (Fig 3, lower panel of top pair of profiles). Likewise, LC-ESI/MS analysis of PG (C46H95O8P) revealed a [M-H]− ion peak at m/z 805.664, corresponding to a mono-isotopic mass of 806.672 Da, which is in agreement with the calculated exact mass of the molecule (806.676 Da). The same molecule was detected at the m/z 797.615 position in the mutant-derived lipid extract, a value again consistent with a failure to saturate four isoprene subunits of the molecule (Fig 3, second pair of panels, upper and lower profiles, respectively).

Fig 3.

Fig 3

Normal phase LC/ESI-MS analysis reveals structural differences in Hfx. volcanii membrane lipids in parent strain and ΔHVO_1799 cells. [M-H]− ions corresponding to Hfx. volcanii PGP-Me (upper pair of panels), PG (second pair of panels), S-GL-1 (third pair of panels) and S-GL-2 (bottom pair of panels) in parent strain (upper panel in each pair) and ΔHVO_1799 cells (lower panel in each pair) are presented. The inset in the upper panel of each panel pair depicts the native structure of the lipid in question. The mass spectra shown are averaged from spectra acquired during the 20–21 min window.

Similar results were obtained when the MS profiles of the two major Hfx. volcanii sulphated glycolipids, 6-HSO3-D-Manp-α1,2-D-Glcpα1,1-[sn-2,3-di-O-phytanylglycerol] (S-GL-1) and 6-HSO3-D- Manp-α1,2-D-Glcpα1,1-[sn-2,3-di-O-phytanylglycerol-6-[phospho-sn-2,3-di-O-phytanylglycerol]] (S-GL-2), together accounting for some 15% of the Hfx. volcanii polar lipid pool [33], were compared in the parent and mutant strains. In the case of S-GL-1 (C55H108O16S), a [M-H]− ion peak at m/z 1055.725 was detected in the parent strain, while in the case of S-GL-2 (C98H195O21PS), [M-H]− ion peak at m/z 1770.369 was detected. These observed values are in good agreement with the calculated masses of each molecule, namely 1056.736 and 1771.365 Da, respectively (Fig 3, third and bottom pairs of panels, upper profiles, respectively). When, however, the mass spectrometry profiles of these molecules from the mutant strain were addressed, considerable shifts were noted. S-GL-1 from the ΔHVO_1799 strain appears as a [M-H]− ion peak at m/z 1047.685, while S-GL-2 from the same source appears as a [M-H]− ion peak at m/z 1754.270, corresponding to a failure to saturate four and eight isoprene positions in each molecule, respectively (Fig 3, third and bottom pairs of panels, lower profiles, respectively). Finally, the assignment of the m/z 1055.725 and 1770.369 peaks and the m/z 1047.685 and 1754.270 peaks as S-GL-1 and S-GL-2 in the parent and mutant strains, respectively, was confirmed by MS/MS (Supplementary Fig 1).

3.3 The omega position of DolP is only partially saturated in the absence of HVO_1799

In Hfx. volcanii, N-glycosylation involves the assembly of glycans on C55 and C60 DolP carriers [20]. However, in contrast to the DolP recruited in eukaryal N-glycosylation bearing a saturated α-position isoprene subunit [15], Hfx. volcanii DolP is saturated at both the α- and ω-positions [19,20]. In agreement with earlier studies [20], LC-ESI/MS analysis of a total Hfx. volcanii lipid extract revealed a [M-H]− ion peak at m/z 917.741 corresponding to C60 DolP (Fig 4A, upper panel). To assess whether this membrane lipid was also affected by the absence of HVO_1799, the same species was assayed in the lipid pool extracted from cells of the deletion strain. In this instance, a [M-H]− ion peak at m/z 915.735 was observed, consistent with a species in which a single isoprene had failed to undergo saturation, with a calculated mass of 915.736 Da (Fig 4A, lower panel). A considerable fraction of Hfx. volcanii DolP saturated at both the α- and ω-positions, was, however, also detected. To determine the position of the affected isoprene subunit in the [M-H]− ion at m/z 915.735, MS/MS was performed. Such analysis revealed a fragmentation pattern consistent with a DolP saturated at the α- but not the ω-position (Fig 4B).

Fig 4.

Fig 4

Normal phase LC/ESI-MS/MS reveals that in Hfx. volcanii ΔHVO_1799 cells, the ω-position isoprene of C60 DolP is not saturated. A. The [M-H]− ions of Hfx. volcanii C60 DolP detected at m/z 917.741 and 915.735 in the parent and ΔHVO_1799 strains, respectively. B. Collision-induced dissociation MS/MS analysis of the m/z 915.736 [M-H]− ion peak corresponding to Hfx. volcanii C60 DolP in the HVO_1799 deletion strain. The inset shows the fragmentation scheme and lists the chemical formula and expected mass of the starting material. The arrows marked x15.0 and x20.0 reflect magnification of ion peaks in the corresponding m/z region.

3.4 Differential glycosylation of C60 DolP is seen in the absence of HVO_1799

In Hfx. volcanii, DolP is charged with either a tetrasaccharide comprising a hexose, two hexuronic acids and a methyl ester of hexuronic acid or a single mannose residue [20]. Together, these glycans serve to generate the pentasaccharide N-linked to the S-layer glycoprotein, a reporter of N-glycosylation in Hfx. volcanii [34]. Accordingly, LC-ESI/MS analysis of a total Hfx. volcanii lipid extract revealed [M-H]− ion peaks at m/z 1079.797 and 1255.858 and [M-2H]2− ion peaks at m/z 715.438 and 810.460, corresponding to monosaccharide (hexose)-, disaccharide (hexose and hexuronic acid)-, trisaccharide (hexose and two hexuronic acids)- and tetrasaccharide (hexose, two hexuronic acids and methyl ester of hexuronic acid)-charged C60 DolP, respectively (Fig 5, left column, top to bottom panels, respectively). When the same glycan-charged lipid species were analyzed in ΔHVO_1799 cells, a very different set of profiles was obtained. Here, mono-, di- and trisaccharide-charged C60 DolP saturated at both the α- and ω-positions and at the α-position alone were observed, with the latter pool accounting for a larger portion of the population (Fig 5, right column, top, second and third panels, respectively). When, however, the distribution of the two versions of C60 DolP bearing the tetrasaccharide was assessed, the level of that lipid saturated at both the α- and ω-positions exceeded its counterpart saturated at the α-position alone by a factor of two (Fig 5, right column, bottom panel).

Fig 5.

Fig 5

Differential glycosylation of C60 DolP in Hfx. volcanii ΔHVO_1799 cells as a function of ω-position isoprene saturation. Normal phase LC/ESI-MS analysis of monosaccharide- (upper pair of panels), disaccharide- (second pair of panels), trisaccharide- (third pair of panels) and tetrasaccharide-charged (bottom pair of panels) C60 DolP was performed on parent strain (left panel in each pair) and ΔHVO_1799 cells (right panel in each pair). C60 DolP saturated at the α- and ω-position isoprenes is denoted by an arrow, while C60 DolP saturated at the α-position isoprene alone is denoted by an arrowhead. [M-H]− ions are shown for mono- and disaccharide-charged C60 DolP, while [M-2H]2− ions are shown for tri- and tetrasaccharide-charged C60 DolP.

3.5 C55 DolP is also affected in the absence of HVO_1799

Like C60 DolP, C55 DolP also participates in the Hfx. volcanii N-glycosylation process [20]. Accordingly the effect of HVO_1799 deletion on C55 DolP and its glycan-charged variants was considered. While LC-ESI/MS revealed the presence of a [M-H]− ion peak at m/z 849.674 in the parent strain corresponding to C55 DolP saturated at both the α- and ω-positions, the absence of HVO_1799 led to the appearance of a new [M-H]− ion peak at m/z 847.683 corresponding to C55 DolP saturated at the α-position alone, in addition to the [M-H]− ion peak also seen in the parent strain (m/z 849.689) (Fig 6A), reminiscent of what was observed in the case of C60 DolP. Unlike what was seen with C60 DolP, where the version of the lipid saturated at the α-position alone predominated, in the case of C55 DolP, twice as much lipid saturated at both the α- and ω-positions than saturated at the α-position alone was observed.

Fig 6.

Fig 6

C55 DolP and glycosylated C55 DolP are also affected by HVO_1799 deletion. A. The [M-H]− ions of Hfx. volcanii C55 DolP in the parent and ΔHVO_1799 strains, respectively. B. Normal phase LC/ESI-MS analysis of monosaccharide- (upper pair of panels), disaccharide- (second pair of panels), trisaccharide- (third pair of panels) and tetrasaccharide-charged (bottom pair of panels) C55 DolP was performed on parent strain (left panel in each pair) and ΔHVO_1799 cells (right panel in each pair). C55 DolP saturated at the α- and ω-position isoprenes is denoted by an arrow, while C55 DolP saturated at the a-position isoprene alone is denoted by an arrowhead. [M-H]− ions are shown for mono- and disaccharide-charged C55 DolP, while [M-2H]2− ions are shown for tri- and tetrasaccharide-charged C55 DolP.

When the ratios of glycan-charged C55 DolP carriers saturated at both the α- and ω-positions versus those glycan-charged C55 DolP molecules saturated at the α-position alone were considered, increasing amounts of doubly saturated glycan-charged C55 DolP accumulated as the number of lipid-linked sugar subunits climbed from one to three (Fig 6B, right column, top, second and third panels), as was also seen with C60 DolP modified by glycans of varying lengths. However, whereas species saturated at the α-position alone predominated with C60 DolP modified by mono-, di- and trisaccharides (Fig 5), in the case of similarly modified C55 DolP, more carriers saturated at both the α- and ω-positions were noted. Finally, only tetrasaccharide-modified C55 DolP saturated at both the α- and ω-positions was noted in the mutant cells (Fig 6B, right column, bottom panel).

3.6 Complementation of ΔHVO_1799 cells with a plasmid-encoded version of the gene restores HVO_1799 activity

To confirm that the effect on lipid and DolP biogenesis observed in cells lacking HVO_1799, the deletion strain was transformed to express HVO_1799 bearing a Clostridium thermocellum CBD tag. Expression of CBD-HVO_1799 in the transformed cells was confirmed by immunoblot using anti-CBD antibodies. The antibodies recognized a single band of approximately 75 kDa (Supplementary Fig 2). While this value is greater than the combined molecular masses of HVO_1799 (45,318 Da) and the CBD moiety (17,215 Da), the slower migration of halophilic proteins on SDS-PAGE is a well-known phenomenon [35]. When the total lipid extract from ΔHVO_1799 cells transformed to express CBD-HVO_1799 was examined by LC-ESI/MS, it was observed that peaks associated with the major membrane lipid, PGP-Me, and the glycolipids, S-GL-1 and S-GL-2, as well as with di-, tri- and tetrasacccharide-charged C60 DolP, were as seen in the parent strain (Supplementary Fig 3).

3.7 The absence of HVO_1799 does not prevent Hfx. volcanii N-glycosylation

Given the effects on HVO_1799 deletion on glycan-charged DolP, N-glycosylation of the Hfx. volcanii reporter glycoprotein, the S-layer glycoprotein, was addressed. Accordingly, trypsin-generated fragments of the S-layer glycoprotein were examined by normal phase LC-ESI/MS. Such analysis revealed a peak of m/z 1224.47 in both the parent and mutant strain samples (Fig 7), corresponding to the [M+2H]2+ ion of a pentasaccharide-modified S-layer glycoprotein-derived peptide containing the N-glycosylation site, Asn-13 [34] As such, it can be concluded that although HVO_1799 contributes to dolichol phosphate ω-position isoprene reduction, the absence of HVO_1799 does not prevent N-glycosylation in Hfx. volcanii, at least under the growth conditions tested here.

Fig 7.

Fig 7

The Hfx. volcanii S-layer glycoprotein is N-glycosylation in both parent strain and ΔHVO_1799 cells. LC-ESI/MS analysis of the Asn-13-containing tryptic peptide derived from the S-layer glycoprotein from cells of the parent strain (upper panel) or from ΔHVO_1799 cells (lower panel). Shown are doubly charged [M+2H]2+ ion peaks at m/z 1224.97, corresponding to the peptide modified with the N-linked pentasaccharide.

4. DISCUSSION

Numerous aspects of DolP biosynthesis have yet to be defined [2,3]. It is generally thought that polyprenol diphosphate undergoes two rounds of dephosphorylation to produce polyprenol. The polyprenol α-position isoprene subunit is subsequent reduced to yield dolichol, which is subsequently phosphorylated to produce DolP [36]. However, many enzymes involved in this pathway still await identification. While a eukaryal α-isoprene reductase responsible for converting polyprenol to dolichol has been recently identified, the same study demonstrated that more than one enzyme is able to catalyze this reaction [21]. In seeking these and other as yet unidentified components involved in DolP biogenesis, Archaea offer largely unexplored biological ‘territory’. Accordingly, unlike their eukaryal counterparts, in which only the α-position isoprene is saturated, archaeal DolPs contain saturated α- and ω-position isoprene subunits [19,20]. Indeed, in some species, such as the acidothermophile, S. acidocaldarius, additional DolP isoprene subunits are reduced [37].

In this study, Hfx. volcanii HVO_1799 was identified as a DolP ω-isoprene reductase. In Hfx. volcanii cells deleted of HVO_1799, the molecular composition of both C55 and C60 DolP, as well as glycan-charged versions of these lipids, differed from what was seen in the parent strain. In the mutant strain, a substantial population each of these lipid species failed to reduce the ω-position isoprene subunit, with this effect being far more pronounced for C60 than for C55 DolP. The greater impact of deleting HVO_1799 on C60 rather than on C55 DolP may reflect the fact that Hfx. volcanii contains more of the former than the latter [20]. Such differential effects were also observed with glycan-charged C55 and C60 DolP in the deletion strain. In the case of C60 DolP, the prevalent species, i.e. that species saturated at the α-position isoprene alone, was preferentially modified by mono-, di- and trisaccharides. In contrast, C55 DolP saturated at both the α- and ω-position isoprenes was more likely to be modified by one to three sugar residues. Indeed, as more sugars are added to C55 DolP, the dually saturated species becomes increasingly modified at the expense of the singly saturated version of the lipid. Nonetheless, with both tetrasaccharide-modified C55 and C60 DolP, that version of the molecule saturated at both the α- and ω-position isoprene subunits predominates. In fact, only dually saturated C55 tetrasaccharide-modified DolP was detected.

It would thus appear that AglE, the Hfx. volcanii glycosyltransferase responsible for adding the final subunit of the tetrasaccharide-modified glycan (methyl ester of hexuronic acid [38,39]), exclusively modifies the dually saturated form of C55 DolP while also favoring this native form of C60 DolP. Neither the basis for such discrimination nor whether AglE alone is responsible for such selectively is presently known. Similarly, AglG and AglI, Hfx. volcanii glycosyltransferases respectively responsible for addition of the hexuronic acids that serve as the second and third subunits of the lipid-linked glycan [34,40], also seem to prefer the native form of C55 DolP over that form saturated at the α-position alone. AglJ, the Hfx. volcanii glycosyltransferase responsible for adding the first hexose residue to DolP [26], appears to be insensitive to the degree of saturation experienced by C55 DolP. In contrast, AglJ, AglG and AglI seem to prefer that version of C60 DolP saturated at the α-position isoprene alone that predominates in the mutant strain. However, despite such differential glycosylation of DolP, the reporter glycoprotein, the S-layer glycoprotein [24,41], was decorated with the same N-linked pentasaccharide described earlier [34] in cells either containing or lacking HVO_1799. Still, the relative contributions of glycan-charged C55 and C60 DolPs to Hfx. volcanii N-glycosylation have yet to be determined.

While the absence of HVO_1799 had a striking effect on the appearance and processing of DolP, thus assigning the protein the role of a DolP ω-isoprene reductase, mass spectrometry reveals that HVO_1799 also acts as a reductase affecting Hfx. volcanii membrane lipid biosynthesis. The absence of HVO_1799 affected both the major phospho- and glycolipids comprising the Hfx. volcanii membrane, leading to the appearance of lipid species not seen in the parent strain. Indeed, whereas HVO_1799 deletion had only a partial effect on the DolP ω-position isoprene, the entire Hfx. volcanii PGP-Me, PG, S-GL-1 and S-GL-2 content, molecules that together comprising some 90% of the polar lipid pool in this organism [33], were affected by the absence of HVO_1799. As such, it would seem that the major role played by HVO_1799 is that of a GGR or related enzyme. Considering that archaeal lipids are composed of isoprenoid chains ether-linked to sn-glycerol-1-phosphate, rather than fatty acyl groups ester-linked to sn-glycerol-3-phosphate as in Eukarya and Bacteria, the widespread effects of HVO_1799 deletion on Hfx. volcanii lipid biosynthesis is not unexpected.

Through a combination of bioinformatics, gene deletion and mass spectrometry, this study revealed HVO_1799 to act as a DolP ω-isoprene reductase, in addition to its more general role as an apparent GGR. This is the first time an enzyme responsible for saturation of the ω-isoprene reductase in an archaeal dolichol phosphate has been identified. Still, HVO_1799 is not alone in catalyzing ω-position isoprene reduction, as residual activity remains in cells deleted of the encoding gene. In this sense, is noteworthy that a similar phenomenon was observed with the recently identified dolichol reductase, SRD5A3, namely some extent of α-position isoprene reduction persisted in the absence of the encoding gene [21]. It is, moreover, conceivable that in Hfx. volcanii, the same as yet unidentified reductase acts on both the α- and the ω-position isoprene subunits. The search for enzyme(s) able to reduce the α- and/or the ω-position isoprene subunits will be the focus of continued analysis of DolP biosynthesis in Hfx. volcanii. Such analysis will also consider whether α- and/or ω-position isoprene reduction occurs before or after dolichol phosphorylation.

Highlights.

  • -

    Hfx. volcanii ΔHVO_1799 cells don’t fully reduce phospho/glycolipid isoprene chains

  • -

    ΔHVO_1799 cells do not saturate the dolichol phosphate ω-position isoprene

  • -

    Dolichol phosphate with reduced α- and ω-isoprenes is preferentially glycosylated

Supplementary Material

01

ACKNOWLEDGEMENTS

J.E. is supported by the Israel Science Foundation (grant 08/11) and the US Army Research Office (W911NF-11-1-520). The mass spectrometry facility in the Department of Biochemistry of the Duke University Medical Center and Z.G. are supported by the LIPID MAPS Large Scale Collaborative Grant number GM-069338 from NIH. S.N. is the recipient of a Negev-Zin Associates Scholarship. The authors dedicate this paper to the memory of Dr. Chris Raetz.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

1

Abbreviations used: 2,3-di-O-geranylgeranylglyceryl phosphate, DGGGP; 6-HSO3-D-Manp-α-1-2-D-Glcp-α-1,1-(sn-2,3-di-O-phytanylglycerol), S-GL-1; 6-HSO3-D-Manp-α-1-2-D-Glcp- α-1,1-(sn-2,3-di-O-phytanylglycerol-6-(phospho-sn-2,3-di-O-phytanylglycerol)), S-GL-2; archaetidylglycerol, PG; archaetidylglycerol methylphosphate, PGP-Me; cellulose-binding domain, CBD; dimethylallyl pyrophosphate, DMAPP; dolichol phosphate, DolP; farnesyl pyrophosphate, FPP; geranylgeranyl pyrophosphate, GGPP; geranylgeranyl reductase, GGR; isopentenyl phosphate kinase, IPK; isopentenyl pyrophosphate, IPP; liquid chromatography/electrospray ionization mass spectrometry, LC/MS; mevalonate, MVA; Reverse-transcription polymerase chain reaction, RT-PCR; tandem mass spectrometry, MS/MS.

REFERENCES

  • 1.Rip JW, Rupar CA, Ravi K, Carroll KK. Distribution, metabolism and function of dolichol and polyprenols. Prog. Lipid Res. 1985;24:269–309. doi: 10.1016/0163-7827(85)90008-6. [DOI] [PubMed] [Google Scholar]
  • 2.Swiezewska E, Danikiewicz W. Polyisoprenoids: Biosynthesis, structure and function. Prog. Lipid Res. 2005;44:235–258. doi: 10.1016/j.plipres.2005.05.002. [DOI] [PubMed] [Google Scholar]
  • 3.Jones BM, Rosenberg JN, Betenbaugh MJ, Krag SS. Structure and synthesis of polyisoprenoids used in N-glycosylation across the three domains of life. Biochim. Biophys. Acta. 2009;1790:485–494. doi: 10.1016/j.bbagen.2009.03.030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Lange BM, Rujan T, Martin W, Croteau R. Isoprenoid biosynthesis: the evolution of two ancient and distinct pathways across genomes. Proc. Natl. Acad. Sci. USA. 2000;97:13172–13177. doi: 10.1073/pnas.240454797. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Matsumi R, Atomi H, Driessen AJ, van der Oost J. Isoprenoid biosynthesis in Archaea--biochemical and evolutionary implications. Res. Microbiol. 2011;162:39–52. doi: 10.1016/j.resmic.2010.10.003. [DOI] [PubMed] [Google Scholar]
  • 6.Fox GE, Magrum LJ, Balch WE, Wolfe RS, Woese CR. Classification of methanogenic bacteria by 16S ribosomal RNA characterization. Proc. Natl. Acad. Sci. USA. 1977;74:4537–4541. doi: 10.1073/pnas.74.10.4537. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Woese CR, Fox GE. Phylogenetic structure of the prokaryotic domain: the primary kingdoms. Proc. Natl. Acad. Sci. USA. 1977;74:5088–5090. doi: 10.1073/pnas.74.11.5088. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Kates M, Moldoveanu N, Stewart LC. On the revised structure of the major phospholipid of Halobacterium salinarium. Biochim. Biophys. Acta. 1993;1169:46–53. doi: 10.1016/0005-2760(93)90080-s. [DOI] [PubMed] [Google Scholar]
  • 9.Koga Y, Morii H. Biosynthesis of ether-type polar lipids in archaea and evolutionary considerations. Microbiol. Mol. Biol. Rev. 2007;71:97–120. doi: 10.1128/MMBR.00033-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Grochowski LL, Xu H, White RH. Methanocaldococcus jannaschii uses a modified mevalonate pathway for biosynthesis of isopentenyl diphosphate. J. Bacteriol. 2006;188:3192–3198. doi: 10.1128/JB.188.9.3192-3198.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Chen M, Poulter CD. Characterization of thermophilic archaeal isopentenyl phosphate kinases. Biochemistry. 2010:207–217. doi: 10.1021/bi9017957. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Miziorko HM. Enzymes of the mevalonate pathway of isoprenoid biosynthesis. Arch. Biochem. Biophys. 2011;505:131–143. doi: 10.1016/j.abb.2010.09.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Hemmi H, Yamashita S, Shimoyama T, Nakayama T, Nishino T. Cloning, expression, and characterization of cis-polyprenyl diphosphate synthase from the thermoacidophilic archaeon Sulfolobus acidocaldarius. J. Bacteriol. 2001;183:401–404. doi: 10.1128/JB.183.1.401-404.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Chen A, Poulter CD. Purification and characterization of farnesyl diphosphate/geranylgeranyl diphosphate synthase. A thermostable bifunctional enzyme from Methanobacterium thermoautotrophicum. J. Biol. Chem. 1993;268:11002–11007. [PubMed] [Google Scholar]
  • 15.Burda P, Aebi M. The dolichol pathway of N-linked glycosylation. Biochim. Biophys. Acta. 1999;1426:239–257. doi: 10.1016/s0304-4165(98)00127-5. [DOI] [PubMed] [Google Scholar]
  • 16.Szymanski CM, Wren BW. Protein glycosylation in bacterial mucosal pathogens. Nat. Rev. Microbiol. 2005;3:225–237. doi: 10.1038/nrmicro1100. [DOI] [PubMed] [Google Scholar]
  • 17.Weerapana E, Imperiali B. Asparagine-linked protein glycosylation: from eukaryotic to prokaryotic systems. Glycobiology. 2006;16:91R–101R. doi: 10.1093/glycob/cwj099. [DOI] [PubMed] [Google Scholar]
  • 18.Calo D, Kaminski L, Eichler J. Protein glycosylation in Archaea: Sweet and extreme. Glycobiology. 2010;20:1065–1079. doi: 10.1093/glycob/cwq055. [DOI] [PubMed] [Google Scholar]
  • 19.Kuntz C, Sonnenbichler J, Sonnenbichler I, Sumper M, Zeitler R. Isolation and characterization of dolichol-linked oligosaccharides from Haloferax volcanii. Glycobiology. 1997;7:897–904. doi: 10.1093/glycob/7.7.897. [DOI] [PubMed] [Google Scholar]
  • 20.Guan Z, Naparstek S, Kaminski L, Konrad Z, Eichler J. Distinct glycan-charged phosphodolichol carriers are required for the assembly of the pentasaccharide N-linked to the Haloferax volcanii S-layer glycoprotein. Mol. Microbiol. 2010;78:1294–1303. doi: 10.1111/j.1365-2958.2010.07405.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Cantagrel V, Lefeber DJ, Ng BG, Guan Z, Silhavy JL, Bielas SL, Lehle L, Hombauer H, Adamowicz M, Swiezewska E, De Brouwer A, Bluemel P, Cegielska J, Houliston SR, Swistun D, Ali BR, Babovic-Vuksanovic D, van Bokhoven H, Wevers RA, Raetz CRH, Freeze HH, Morava E, Al-Gazali L, Gleeson JG. SRD5A3 is required for converting polyprenol to dolichol and is mutated in a congenital glycosylation disorder. Cell. 2010;142:1–15. doi: 10.1016/j.cell.2010.06.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Mevarech M, Werczberger R. Genetic transfer in Halobacterium volcanii. J. Bacteriol. 1985;162:461–462. doi: 10.1128/jb.162.1.461-462.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Allers T, Ngo HP, Mevarech M, Lloyd RG. Development of additional selectable markers for the halophilic archaeon Haloferax volcanii based on the leuB and trpA genes. Appl. Environ. Microbiol. 2004;70:943–953. doi: 10.1128/AEM.70.2.943-953.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Abu-Qarn M, Eichler J. Protein N-glycosylation in Archaea: defining Haloferax volcanii genes involved in S-layer glycoprotein glycosylation. Mol. Microbiol. 2006;61:511–525. doi: 10.1111/j.1365-2958.2006.05252.x. [DOI] [PubMed] [Google Scholar]
  • 25.Irihimovitch V, Eichler J. Post-translational secretion of fusion proteins in the halophilic archaeon Haloferax volcanii. J. Biol. Chem. 2003;278:12881–12887. doi: 10.1074/jbc.M210762200. [DOI] [PubMed] [Google Scholar]
  • 26.Kaminski L, Abu-Qarn M, Guan Z, Naparstek S, Ventura VV, Raetz CRH, Hitchen PG, Dell A, Eichler J. AglJ adds the first sugar of the N-linked pentasaccharide decorating the Haloferax volcanii S-layer glycoprotein. J. Bacteriol. 2010;192:5572–5579. doi: 10.1128/JB.00705-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Calo D, Guan Z, Eichler J. Glyco-engineering in Archaea: differential N-glycosylation of the S-layer glycoprotein in a transformed Haloferax volcanii strain. Microb. Biotechnol. 2011;4:461–470. doi: 10.1111/j.1751-7915.2011.00250.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Nishimura Y, Eguchi T. Biosynthesis of archaeal membrane lipids: digeranylgeranylglycerophospholipid reductase of the thermoacidophilic archaeon Thermoplasma acidophilum. J. Biochem. 2006;139:1073–1081. doi: 10.1093/jb/mvj118. [DOI] [PubMed] [Google Scholar]
  • 29.Murakami M, Shibuya K, Nakayama T, Nishino T, Yoshimura T, Hemmi H. Geranylgeranyl reductase involved in the biosynthesis of archaeal membrane lipids in the hyperthermophilic archaeon Archaeoglobus fulgidus. FEBS J. 2007;274:805–814. doi: 10.1111/j.1742-4658.2006.05625.x. [DOI] [PubMed] [Google Scholar]
  • 30.Sato S, Murakami M, Yoshimura T, Hemmi H. Specific partial reduction of geranylgeranyl diphosphate by an enzyme from the thermoacidophilic archaeon Sulfolobus acidocaldarius yields a reactive prenyl donor, not a dead-end product. J. Bacteriol. 2008;190:3923–3929. doi: 10.1128/JB.00082-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Koga Y, Morii H. Recent advances in structural research on ether lipids from archaea including comparative and physiological aspects. Biosci. Biotechnol. Biochem. 2005;69:2019–2034. doi: 10.1271/bbb.69.2019. [DOI] [PubMed] [Google Scholar]
  • 32.Marchler-Bauer A, Lu S, Anderson JB, Chitsaz F, Derbyshire MK, DeWeese-Scott C, Fong JH, Geer LY, Geer RC, Gonzales NR, Gwadz M, Hurwitz DI, Jackson JD, Ke Z, Lanczycki CJ, Lu F, Marchler GH, Mullokandov M, Omelchenko MV, Robertson CL, Song JS, Thanki N, Yamashita RA, Zhang D, Zhang N, Zheng C, Bryant SH. CDD: a Conserved Domain Database for the functional annotation of proteins. Nucleic Acids Res. 2011;39:225–229. doi: 10.1093/nar/gkq1189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Sprott GD, Larocque S, Cadotte N, Dicaire CJ, McGee M, Brisson JR. Novel polar lipids of halophilic eubacterium Planococcus H8 and archaeon Haloferax volcanii. Biochim. Biophys. Acta. 2003;1633:179–188. doi: 10.1016/j.bbalip.2003.08.001. [DOI] [PubMed] [Google Scholar]
  • 34.Abu-Qarn M, Yurist-Doutsch S, Giordano A, Trauner A, Morris HR, Hitchen P, Dell A, Eichler J. Haloferax volcanii AglB and AglD are involved in N-glycosylation of the S-layer glycoprotein and proper assembly of the surface layer. J. Mol. Biol. 2007;14:1224–1236. doi: 10.1016/j.jmb.2007.10.042. [DOI] [PubMed] [Google Scholar]
  • 35.Lanyi JK. Salt-dependent properties of proteins from extremely halophilic bacteria. Bacteriol. Rev. 1974;38:272–290. doi: 10.1128/br.38.3.272-290.1974. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Schenk B, Fernandez F, Waechter CJ. The ins(ide) and out(side) of dolichyl phosphate biosynthesis and recycling in the endoplasmic reticulum. Glycobiology. 2001;11:61R–70R. doi: 10.1093/glycob/11.5.61r. [DOI] [PubMed] [Google Scholar]
  • 37.Guan Z, Meyer BH, Albers SV, Eichler J. The thermoacidophilic archaeon Sulfolobus acidocaldarius contains an unsually short highly reduced dolichyl phosphate. Biochim. Biophys. Acta. 181:607–616. doi: 10.1016/j.bbalip.2011.06.022. (12011) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Magidovich H, Yurist-Doutsch S, Konrad Z, Ventura VV, Dell A, Hitchen PG, Eichler J. AglP is a S-adenosyl-L-methionine-dependent methyltransferase that participates in the N-glycosylation pathway of Haloferax volcanii. Mol. Microbiol. 2010;76:190–199. doi: 10.1111/j.1365-2958.2010.07090.x. [DOI] [PubMed] [Google Scholar]
  • 39.Abu-Qarn M, Giordano A, Battaglia F, Trauner A, Hitchen P, Morris HR, Dell A, Eichler J. Identification of AglE, a second glycosyltransferase involved in N glycosylation of the Haloferax volcanii S-layer glycoprotein. J. Bacteriol. 2008;190:3140–3316. doi: 10.1128/JB.00056-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Yurist-Doutsch S, Abu-Qarn M, Battaglia F, Morris HR, Hitchen PG, Dell A, Eichler J. AglF, aglG and aglI, novel members of a gene island involved in the N-glycosylation of the Haloferax volcanii S-layer glycoprotein. Mol. Microbiol. 2008;69:1234–1245. doi: 10.1111/j.1365-2958.2008.06352.x. [DOI] [PubMed] [Google Scholar]
  • 41.Sumper M, Berg E, Mengele R, Strobel I. Primary structure and glycosylation of the S-layer protein of Haloferax volcanii. J. Bacteriol. 1990;172:7111–7118. doi: 10.1128/jb.172.12.7111-7118.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

01

RESOURCES