Skip to main content
World Journal of Gastroenterology logoLink to World Journal of Gastroenterology
. 2012 May 7;18(17):2105–2111. doi: 10.3748/wjg.v18.i17.2105

Study of Helicobacter pylori genotype status in saliva, dental plaques, stool and gastric biopsy samples

Hassan Momtaz 1,2,3,4, Negar Souod 1,2,3,4, Hossein Dabiri 1,2,3,4, Meysam Sarshar 1,2,3,4
PMCID: PMC3342610  PMID: 22563199

Abstract

AIM: To compare genotype of Helicobacter pylori (H. pylori) isolated from saliva, dental plaques, gastric biopsy, and stool of each patient in order to evaluate the mode of transmission of H. pylori infection.

METHODS: This cross-sectional descriptive study was performed on 300 antral gastric biopsy, saliva, dental plaque and stool samples which were obtained from patients undergoing upper gastrointestinal tract endoscopy referred to endoscopy centre of Hajar hospital of Shahrekord, Iran from March 2010 to February 2011. Initially, H. pylori strains were identified by rapid urease test (RUT) and polymerase chain reaction (PCR) were applied to determine the presence of H. pylori (ureC) and for genotyping of voculating cytotoxin gene A (vacA) and cytotoxin associated gene A (cagA) genes in each specimen. Finally the data were analyzed by using statistical formulas such as Chi-square and Fisher’s exact tests to find any significant relationship between these genes and patient’s diseases. P < 0.05 was considered statistically significant.

RESULTS: Of 300 gastric biopsy samples, 77.66% were confirmed to be H. pylori positive by PCR assay while this bacterium were detected in 10.72% of saliva, 71.67% of stool samples. We were not able to find it in dental plaque specimens. The prevalence of H. pylori was 90.47% among patients with peptic ulcer disease (PUD), 80% among patients with gastric cancer, and 74.13% among patients with none ulcer dyspepsia (NUD) by PCR assay. The evaluation of vacA and cagA genes showed 6 differences between gastric biopsy and saliva specimens and 11 differences between gastric and stool specimens. 94.42% of H. pylori positive specimens were cagA positive and all samples had amplified band both for vacA s and m regions. There was significant relationship between vacA s1a/m1a and PUD diseases (P = 0.04), s2/m2 genotype and NUD diseases (P = 0.05). No statically significant relationship was found between cagA status with clinical outcomes and vacA genotypes (P = 0.65). The evaluation of vacA and cagA genes showed 6 differences between gastric biopsy and saliva specimens and 11 differences between gastric and stool specimens.

CONCLUSION: Regard to high similarity in genotype of H. pylori isolates from saliva, stomach and stool, this study support the idea which fecal- oral is the main route of H. pylori transmission and oral cavity may serve as a reservoir for H. pylori, however, remarkable genotype diversity among stomach, saliva and stool samples showed that more than one H. pylori genotype may exist in a same patient.

Keywords: Helicobacter pylori, Gastric biopsy, Saliva, Dental plaque, Stool

INTRODUCTION

Helicobacter pylori (H. pylori) is the organism responsible for diseases such as atrophic gastritis, chronic gastritis, duodenal ulcers, gastric mucosa-associated lymphoid tissue lymphoma, and gastric cancer[1]. H. pylori is distributed worldwide and is found in developing countries in particular. For instance, more than 90% of Iranian individuals are infected with H. pylori[2]. Although there is much information about H. pylori infection, several aspects of the pathogenesis and epidemiology of this organism remains unclear[3]. The transmission route of H. pylori infection has been the topic of several studies. Most infections are probably acquired in childhood, mainly via oral-oral or fecal-oral routes[4], however, the exact mode(s) of transmission is still unknown.

H. pylori has been found in saliva, dental plaques and feces, which shows that oral and fecal cavities are probably involved in H. pylori transmission[5]. The role of H. pylori in the oral cavity remains controversial since the detection rate of the bacterium in the mouth is very diverse, ranging between 0% and 100%[6]. Different typing methods have been proposed for the study of correlations between H. pylori isolates from different anatomical sites for epidemiological purposes[7]. Genotyping using some well-known virulence marker genes, such as the cytotoxin associated gene A (cagA) and voculating cytotoxin gene A (vacA), are considered as one of the best approaches[8]. The cagA gene is located at the end of the cag pathogenicity island (PAI) and has been proposed as a marker for the cag PAI, and the presence of certain cagA alleles (e.g., cagA1a in East Asian strains) have been associated with severe clinical outcomes[9]. The vacA gene is present in virtually all strains of H. pylori but it is polymorphic, comprising variable signal regions (type s1 or s2) and mid-regions (type m1 or m2). Type s1/m1 vacA causes more epithelial cell damage than type s1/m2, whereas type s2/m2 and the rare s2/m1 are non-toxic due to the presence of a short 12-residue hydrophilic extension on the s2 form[10,11]. The s-region is classified into s1 and s2 types and the m-region into m1 and m2 types. The s1 type is further subtyped into s1a, s1b and s1c subtypes, and the m1 into m1a and m1b subtypes. The mosaic combination of sand m-region allelic types determines the particular cytotoxin and, consequently, the pathogenicity of the bacterium[12,13]. Recently, several studies have examined the presence of H. pylori in saliva, dental plaque, gastric biopsies and stool, but few studies have evaluated the relationship between genotypes of H. pylori isolated from these specimens in a single patient. Therefore, we aimed to compare H. pylori cagA and the vacA allelic status among strains isolated from saliva, dental plaque, gastric biopsies and stool samples in the same patient with dyspepsia manifestations in order to evaluate the mode of transmission of H. pylori infection.

MATERIALS AND METHODS

Patients and samples

Samples were obtained over a year (March 2010 to February 2011) from patients with gastroduodenal diseases that were referred to the endoscopy center of Hagar Hospital of Shahrekord, Iran.

Prior to sampling, the questionnaire, including medical history and demographic data, were recorded for each patient. All studied patients signed an informed consent form before endoscopy and declared their willingness to allow the application of their anonymous data for research purposes. Gastric biopsies, saliva, dental plaques and stool samples were collected from each patient. Saliva and dental plaque sampling was done in the morning before undergoing endoscopy. All patients were asked to wash their mouth with normal saline prior to saliva and dental plaque sampling. Saliva samples, in a volume of 2-3 mL, were collected using sterile toothpicks and filter paper. Dental floss was used to remove the dental plaque from the interdental spaces and both samples were transported in sterile flasks containing digestion buffer [100 mmol NaCl, 10 mmol Tris-HCl (pH 8.0), 250 mmol ethylenediaminetetraacetic acid (EDTA) (pH 8.0) and 1% sodium lauryl sarcosine] on the day of sampling and were stored at -70 °C until DNA extraction[6]. For each patient, two biopsy specimens from the antrum were taken using a disinfected endoscope. One was used for screening of H. pylori positive specimens by a rapid urease test (RUT). The second piece from RUT-positive patients was placed in 1 mL of sterile phosphate buffer saline solution. Stool was collected in a container with a screw cap and was transported immediately to the biotechnology research center of Islamic Azad University, Shahrekord Branch for molecular analysis.

Rapid urease test

One biopsy piece from each patient was inoculated immediately after collection into 1.5 mL to 2 mL of urea broth (Merck, Germany). It was incubated at 37 °C in the incubator for 1.5 h. The change in color of the broth from yellow to pink was taken as a positive test.

Genomic DNA extraction and polymerase chain reaction

DNA was extracted from biopsies and stool specimens using a Genomic DNA Purification kit (Fermentas, Germany) according to the manufacturer’s instructions. To prepare DNA from saliva and dental plaque, one volume of the digestion buffer and 100 g/mL proteinase K were added to the saliva samples and incubated at 55 °C for 3 h. DNA was extracted twice with an equal volume of phenol-chloroform-isoamyl alcohol (25:24:1) and precipitated with 3 mol sodium acetate and 0.7 mL volume of isopropanol. Rinsed and dried DNA pellets were dissolved in Tris-EDTA (TE) buffer (Tris 10 mmol, EDTA 1 mmol and pH 8.0)[8]. The concentration and quality of DNA preparations were determined spectrophotometrically by measuring absorbance at 260 nm and 280 nm by agarose gel electrophoresis. The DNA preparations were stored at -20 °C. The presence of ureC and cagA and the genotypes of vacA alleles (s1a, s1b, s1c, m1a, m1b and m2) were determined by polymerase chain reaction (PCR). The primer sequences are shown in Table 1[8,11,14].

Table 1.

Primers used for polymerase chain reaction analysis of voculating cytotoxin gene A and cytotoxin associated gene A

Region Primer Sequence (5'-3') Size and location of PCR product
s1a vacA s1a-F CTC TCG CTT TAG TAG GAG C 213 bp
VA1-R CTG CTT GAA TGC GCC AAA C (843-1055)
s1b SS3-F AGC GCC ATA CCG CAA GAG 187 bp
VA1-R CTG CTT GAA TGC GCC AAA C (869-1055)
s1c vacA s1c-F CTC TCG CTT TAG TGG GGY T 213 bp
VA1-R CTG CTT GAA TGC GCC AAA C (843-1055)
s2 SS2-F GCT AAC ACG CCA AAT GAT CC 199 bp
VA1-R CTG CTT GAA TGC GCC AAA C (433-631)
m1a VA3-F GGT CAA AAT GCG GTC ATG G 290 bp
VA3-R CCA TTG GTA CCT GTA GAA AC (2741-3030)
m1b VAm-F3 GGC CCC AAT GCA GTC ATG GA 291 bp
VAm-R3 GCT GTT AGT GCC TAA AGA AGC AT (2741-3031)
m2 VA4-F GGA GCC CCA GGA AAC ATT G 352 bp
VA4-R CAT AAC TAG CGC CTT GCA (976-1327)
cagA cagA-U GGA ATA CCA AAA ACG CAA AAA CCA 300 bp
cagA-L CCC CAC AAT ACA CCA GCA AAA CT
ureC (glmM) GlmM1-R GCTTACTTTCTAACACTAACGCGC 296 bp
GlmM1-F GGATAAGCTTTTAGGGGTGTTAGGGG

PCR: Polymerase chain reaction; cagA: Cytotoxin associated gene A; vacA: Voculating cytotoxin gene A.

DNA samples from H. pylori (D0008, Genekam, Germany) were used as positive controls for ureC, cagA and vacA genes, and sterile distilled water was used as a negative control. All PCR mixtures were prepared in a volume of 25 μL containing 1X PCR buffer, 0.4 μmol of each primer, 0.3 U Taq DNA polymerase and 2 μL DNA sample[5]. The mixture was placed in a thermocycler (Eppendrof Mastercycler 5330; Eppendorf-Nethel-Hinz GmbH, Hamburg, Germany), and PCR products were visualized by electrophoresis in a 1.5% agarose gel, strained with ethidium bromide, and examined under ultraviolet illumination.

Statistical analysis

The data were analyzed using SPSS software (Version 17.SPSS Inc, United States) and P values were calculated using Chi-square and F test to find any significant relationship. P < 0.05 was considered statistically significant.

RESULTS

The study population consisted of 300 patients; 143 men and 157 women with mean age 46 ± 17 years. The patients were classified at the time of endoscopy and histopathology as having peptic ulcer disease (PUD: n = 63), gastric cancer (GC: n = 5) and none ulcer dyspepsia (NUD: n = 232) regardless of H. pylori status. Based on RUTs, 271 (90.33%) patients were positive for H. pylori while 233 (77.66%) patients had positive PCR results by using specific primers (ureC) looking for H. pylori DNA in their gastric specimens. H. pylori was detected in 25 (10.72%) of saliva and 167 (71.67%) of stool samples but we were not able to detect this bacterium in the dental plaques of studied patients.

According to gastric specimen results, the prevalence of H. pylori was 90.47% (57 of 63) among patients with PUD, 80% (4 of 5) among patients with GC, and 74.13% (172 of 232) among patients with NUD by PCR assay. Generally, of 233 H. pylori positive isolates from gastric biopsy specimens, 220 samples (94.42%) were cagA positive and all samples had amplified bands both for vacA s and m regions. Overall, 114 (48.92%) samples had vacA s1a, 32 (13.73%) had vacA s1b, 52 (22.31%) had vacA s1c and 35 (15.00%) had vacA s2 alleles, whereas the frequency of m1a, m1b and m2 alleles were 76 (32.61%), 13 (5.57%) and 144 (61.80%), respectively. There was a significant relationship between vacA s1a/m1a and PUD diseases (P = 0.04) and the s2/m2 genotype and NUD diseases (P = 0.05). No statically significant relationship was found between cagA status with clinical outcomes and vacA genotypes (P = 0.65). There was a statistically significant correlation between H. pylori s2/m2 genotypes and the development of NUD (P = 0.05) and among s1a/m1a and PUD outcomes (P = 0.04).

Of 25 saliva samples positive for H. pylori, all were cagA positive while 18 (72.00%) samples had s1a/m2, 5 (20.00%) samples had s1a/m1a, 2 (8.00%) samples had s2/m2 genotypes and all of the samples were cagA positive (Table 2). There was no association between genotypes of H. pylori from saliva with clinical outcomes (P > 0.05).

Table 2.

The frequency of cytotoxin associated gene A and voculating cytotoxin gene A genotypes in gastric biopsy, saliva and stool samples

cagA n (%) vacA n (%)
s1a/m1a s1a/m1b s1a/m2 s1b/m1a s1b/m1b s1b/m2 s1c/m1a s1c/m1b s1c/m2 s2/m1a s2/m1b s2/m2
Gastric biopsy 220 (94.42) 36 (15.45) 9 (3.86) 60 (25.75) 7 (3) 5 (2.14) 13 (5.57) 17 (7.29) 5 (2.14) 39 (16.73) 12 (5.15) 0 30 (12.87)
Saliva 25 (100) 5 (20) - 18 (72) - - - - - - - - 2 (8)
Stool 162 (97) 14 (8) 2 (1.19) 120 (71.85) 2 (1.19) - 2 (1.19) 3 (1.79) - 3 (1.79) - - 22 (13.17)

cagA: Cytotoxin associated gene A; vacA: Voculating cytotoxin gene A.

In stool samples, of 167 positive strains, the cagA gene was positive in 162 (97.00%) specimens. One hundred twenty (71.85%) had s1a/m2, 22 (13.17%) had s2/m2, 14 (8.38%) had s1a/m1a, 3 (1.79%) had s1c/m2, 3 (1.79%) had s1c/m1a, 2 (1.19%) had s1b/m2, 2 (1.19%) had s1b/m1a and s1a/m1b genotypes (Table 2). There was a significant relationship between NUD manifestation and the s2/m2 genotype of H. pylori from stool samples (P = 0.04).

PCR tests for dental samples looking for H. pylori gene clues were negative. The H. pylori detection rate was statistically associated with the type of sample (P = 0.01). All patients with positive H. pylori in their saliva had a positive PCR reaction for gastric biopsy samples simultaneously.

Upon analysis of the results, in some cases we found different genotypes of H. pylori from the saliva, gastric biopsies and stool of the same patient. As presented in Table 3, in 6 (24.00%) patients, isolated H. pylori strains from gastric biopsies and the saliva of every patient showed a different genotype. In 11 (6.58%) patients, the genotypes of stool strains differed from genotypes of gastric isolates, and in one (4.00%) patient there were three different genotypes in his gastric biopsy, saliva and stool specimen (Table 3). However, variation of H. pylori genotypes in different studied sites were statistically non-significant (P > 0.05).

Table 3.

The list of patients with incompatible Helicobacter pylori voculating cytotoxin gene A genotypes

Patient number Gastric biopsy strain Saliva strain Stool strain
1 s1a/m1a s1a/m2 s2/m2
2 s1a/m1a s1a/m2 -
3 s2/m1a s1a/m2 -
4 s1c/m2 s1a/m2 s1c/m2
5 s2/m2 s1a/m2 -
6 s2/m2 s1a/m2 s2/m2
7 s1a/m1a s1a/m1a s2/m2
8 s1a/m2 s1a/m2 s2/m2
9 s1a/m2 - s1a/m1a
10 s1a/m1b - s1b/m2
11 s2/m2 s2/m2 s1a/m2
12 s2/m2 - s1a/m2
13 s2/m2 - s1a/m2
14 s1a/m2 s1a/m2 s1a/m1a
15 s2/m2 - s1c/m2
16 s2/m1a - s2/m2

DISCUSSION

Infection by H. pylori remains one of the most important scientific phenomena in the biomedical literature worldwide and represents the most prevalent chronic bacterial disease because it affects more than half of the world’s population, with a distribution related to the degree of economic development in each country[3]. The prevalence of H. pylori differs significantly both between and within countries, with high rates of infection being associated with low socioeconomic status and high densities of living[15]. For instance, in Japan, South America, Turkey and Pakistan, the prevalence is more than 80%, while in Scandinavia and England, the prevalence is between 20% and 40%[11]. The prevalence of this bacterium in Iran is 60%-90%, indicating Iran is a high risk region for H. pylori infection. The prevalence of this bacterium was 77.66% in our study and it was therefore compatible with other reports in Iran[2,11]. In our study, the rate of H. pylori in different sites of the gastric tract (0% dental plaques, 10.72% saliva, 77.66% gastric biopsy and 71.67% stool) varied, which is inconsistent with other studies[16,17]. There are several hypotheses which can explain the low rate of H. pylori in oral cavity compare to gastric biopsy and stool samples. First may be due to the fact that eradication therapy usually removes the gastric infection while it does not necessarily affect oral and intestinal colonization[16]. The second reason for such decreasing level of the rate of bacterium can be related to the presence of oral normal flora, which is able to affect the H. pylori growth by producing bacteriocin-like inhibitory proteins against H. pylori strains[1]. The third reason is based on the hypothesis that the H. pylori may persists in yeast while is in mouth. The Candida spp. could be the reservoir for H. pylori and play an important role in the bacterial re-inoculation in gastric tissue or transmission to a new host[18], so may yeast protects H. pylori from the stressful conditions in the mouth and carries it to the gastrointestinal tract of human[19]. According to Gatti et al[20] from Brazil and Bindayna et al[21] from India in 2006, there was a significant relationship between cagA gene and the inflammation of gastric tissue. The prevalence of cagA+ gene in their samples was 79% and 59% respectively. However, Kangsadalampai et al[22] from Thailand in 2005 and Cirak et al[23] from Turkey in 2003, and Gutiérrez et al[24] from Cuba in 2005 failed to confirm such relationship between cagA status and gastric disorders. The prevalence of cagA gene was 31% in Thailand, 71% in Turkey and 88.5% in Cuba. In our survey, the prevalence of cagA gene was 94.42% in gastric biopsy samples and due to high prevalence of cagA in our studied isolates, we did not find any significant relationship between this gene and gastric disorders. The prevalence of cagA gene in our study was in accordance with our previous report[9] and similar to East Asian countries where the most of isolates are positive for cagA gene. Also this finding was different with major of previous reports from Iran, which the cagA positive rate was 44% to 91% and similar to European isolates[11,25,26]. This phenomenon may be because of changes in Iranian isolates status or targeting different part of cagA gene for amplification. According to López-Vidal et al[27] from Mexico in 2008 vacA s1b/m1, Linpisarn et al[28] from Thailand in 2007, vacA s1a/m1 and vacA s1c/m1, Ahmad et al[29] from Pakistan in 2009, vacA s1b/m2 and vacA s1a/m1a, Rudi et al[30] from Germany in 1998, Miciuleviciene et al[31] from Lithuania in 2008 and Saribasak et al[32] from Turkey in 2004, Hussein et al[33] from Iraq in 2008 and Momenah et al[34] from Saudi Arabia in 2006, vacA s1a/m2 were the prominent strains in their country. We have found vacA s1a/m2 as a predominant genotype in gastric specimens of Iranian patients with gastroduodenal diseases which was similar to Germany, Lithuania, Turkey, Iraq and Saudi Arabia but far different with Mexico, Thailand and Pakistan. There was statically significant correlation between vacA s2/m2 genotype and NUD (P = 0.05) and vacA s1a/m1a genotype with PUD (P = 0.04). This finding is in accordance with the major of studies which believe s1/m1 isolate are more virulent than s2/m2[27,29]. Similar to the previous reports from Iran, from statistical point of view no relationship was found between gastric cancer and vacA status (P = 0.1)[2,11]. Gastric epithelial cells seem to be the main niche of the H. pylori, however there are limited studies considering H. pylori status in oral cavity. Some of studies have detected H. pylori from different sites of the oral cavity[7,9] and some other groups failed to detect H. pylori from saliva, subgingival plaques and gingival pockets[35,36].

Medina et al[3] from Argentina in 2010 found H. pylori in 18.4% of saliva and Fernández-Tilapa et al[5] from Mexico in 17% of dental plaque during 2011. Cześnikiewicz-Guzik et al[16] from Poland in 2004 find this bacterium in 54% of saliva and 48.3% of gingival packets while Iamaroon et al[7] from Thailand in 2003 did not find H. pylori in oral aphtous ulceration patients (Table 4). In this study we found H. pylori in 10.72% of saliva and none of dental plaques. That’s may be because of the high level of hygiene in our studied population[1]. Some authors have suggested that H. pylori may belong to the normal oral flora of the human oral cavity, maintaining a commensal relation with the host, but sometimes present in very low numbers which is difficult for identification. Others have suggested that H. pylori are not consistently present in dental plaque and saliva so when present, may be the result of occasional gastroesophageal reflux[1]. Some researchers suggest that H. pylori in oral cavity may serve as a source of gastric reinfection by this bacterium[7]. According to Tanahashi et al[37] from Austria, 93.7% of stool samples were H. pylori positive and Parsonnet et al[17] found this bacterium in 88% of the specimens. Both of them applied PCR assay for detection of H. pylori. In our study, 71.67% of stool samples of infected patients were H. pylori positive which is somehow accordance with other studies[17,38]. The lower prevalence of H. pylori in feces rather than stomach may is due to the effect of the intestinal tract normal flora. Our results showed high homology (58%) in vacA genotype in saliva and gastric samples from the same patients. This result was consistent with the findings of study by Wang et al[8] which showed 64% homology between saliva and gastric samples from the same patients. These findings support the hypothesis that saliva is a possible source of H. pylori infection. The major difference between gastric biopsy, stool and saliva is that saliva represents the entire oral cavity, but punch biopsy and stool sample serve only as a fraction of the total gastric mucosal surface. Interestingly the H. pylori isolated from gastric samples showed high diversity compare to those isolated from saliva and stool which may indicate that gastric biological nature support survive of all different genotype of H. pylori. Saliva is more likely to contain the entire DNA from every strain colonizing the oral cavity but at concentrations that may be close to or below the detection level of our PCR assay. In current study we found several genotypic diversities between H. pylori strains isolated from saliva, stool and stomach of the same patient. Our data indicated that isolates from different sites of a single individual tend to be more a like than strains isolated from the same site of different individuals (P = 0.001). This is in agreement with our previous report which there was 61% homology between H. pylori vacA genotypes in saliva and gastric biopsy of same individuals[9]. The heterogeneity of H. pylori may be due to genotypic variation among strains and/or variations in H. pylori populations within an individual host, as proposed by Blaser[13]. Genotypic variation of H. pylori has been documented in point mutations and variation in the gene order[31,32]. Although high rate of similarity was seen among H. pylori isolates from different anatomical sites, but 16% of patients were infected with 3 different strains. This finding supports the idea that humans can be simultaneously infected with two or more H. pylori genotypes[39]. Variation might be because of co-existence of these bacteria together or occurring mutations[1].

Table 4.

Summary of studies which analysed Helicobacter pylori status in different oral cavity, stool and gastric sample

Author name Country Target population Number of sample Type of specimens Method Positive rate %
Cześnikiewicz-Guzik et al[16] Poland Gastrointensinal patients 100 Gastic biopsy, saliva and gingival plaques ELISA 51 biopsy 54 saliva and 48.3 gingival pockets
Medina et al[3] Argentina Gastroduodenal patients 98 Saliva, dental plaque and gastric biopsy PCR 88.4 biopsy and 18.98 oral samples
Iamaroon et al[7] Thailand Recurrent auphtus ulcer patients and healthy volunteers 22 patients/15 normal people Mocusa Nested PCR 4.5 auphtus patients and 4.5 normal patients
Tanahashi et al[37] Northern California Gastric patients 16 infected 10 uninfected Stool, saliva and vomits PCR and culture 18.8 saliva, 21.8 stool and 37.5 vomits
Silva et al[6] Brazil Gastric patients 30 Gastric biopsy, saliva and dental plaque Single step and nested PCR 80 gastric biopsy, 30 saliva and 20 dental plaque
Fernández-Tilapa et al[5] Mexico Adults without dyspepsia 200 Gastric biopsy, saliva and dental plaque Nested and semi nested PCR, ELISA 62 biopsy and 17 oral samples
Wang et al[8] Tennessee Gastric patients 31 Gastric biopsy and saliva PCR and DNA sequencing 100 gastric biopsy and 71 saliva
Current study Iran Gastroduodenal patients 300 Gastric biopsy, saliva, dental plaque and stool PCR 77.66 biopsy, 10.72 saliva, 0 dental plaque and 71.67 stool

ELISA: Enzyme-linked immunosorbent assay; PCR: Polymerase chain reaction.

In conclusion, there is high similarity between H. pylori strains isolated from saliva, stool and gastric specimens so it indicates that the possibly role of saliva and stool as H. pylori infection sources. However, the diversity of H. pylori genotypes between stomach, stool and saliva in the same patient suggest that more than one H. pylori strains may exist in the saliva and stomach of the same patient due to co-infection or genetic variation.

ACKNOWLEDGMENTS

The authors would like to thank Mr. M Momeni, Dr. A Rahimian, Dr. E Tajbakhsh and Mr. Gh Ramezani at the Biotechnology Research Center of the Islamic Azad, University of Shahrekord, and Endoscopy Unit of Hajar, Hospital of Shahrekord, for their sincere technical and clinical support.

COMMENTS

Background

Helicobacter pylori (H. pylori) infection is widespread throughout the world, and it is estimated that more than half of people are infected with this bacterium, but the exact route of transmission has not yet been fully clarified and remains poorly understood.

Research frontiers

Overall there are limited studies considering H. pylori status in oral cavity or feces. Some limited studies suggest that dental plaques, oral cavity and feces have important role in infection transmission and may serve as a reservoir for H. pylori, however some other studies did not find such correlation.

Innovations and breakthroughs

To date there has been a very limited study considering genotyping of H. pylori in oral cavity and feces. In this study, the authors employed genotyping in more detail using well-known virulence marker genes such as cytotoxin associated gene A (cagA) and voculating cytotoxin gene A (vacA). Furthermore, more anatomical sites of each patient including dental plaques, saliva, gastric and stool were analyzed for H. pylori genotyping by authors. Current study confirmed the significant role of saliva and feces but not dental plaques as a possible mean of H. pylori transmission and reservoir.

Applications

By finding correlation between H. pylori genotypes isolated from saliva and stool with gastric biopsy, the authors concluded that control of H. pylori in saliva and stool is crucial for managing of H. pylori infection in gastric tissue.

Terminology

Genotype: The genotype is the genes makeup and characteristic of an organism, a cell or an individual which reflect genetic profile of the cell. Genotyping is the process of determining and classification of organisms or cell based on differences in the genetic makeup (genotype) using biological techniques. Compare to observable characteristics (phenotype) of organisms, genotyping can provide a more accurate view of the biological and genetical status and be expected to be more useful for evaluating, for example, the source of infection, the mode of infection transmission and genetic variation.

Peer review

In the current cross-sectional study on high number of patients, the authors analyzed H. pylori genotype status in digestive system from mouth to rectum by targeting 8 regions of two important virulence marker genes, cagA and vacA alleles. The result indicate that although saliva and stool seems to be major source of H. pylori which infects gastric, however remarkable number of patients carry different genotypes in their gastrointestinal tract.

Footnotes

Supported by The Islamic Azad University, Shahre Kord Branch-Iran grant 89/8761

Peer reviewers: Dr. Nawfal R Hussein, University of Nottingham, Nottingham NG7 2RD, United Kingdom; Reza Malekzadeh, Professor, Digestive Disease Research Center, Tehran University of Medical Sciences, Shariati Hospital, Kargar Shomali Aven, Tehran 14114, Iran

S- Editor Gou SX L- Editor A E- Editor Li JY

References

  • 1.Kargar M, Souod N, Ghorbani-Dalini S, Doosti A, Rezaian AA. Evaluation of cagA tyrosine phosphorylation DNA motifs in Helicobacter pylori isolates from gastric disorder patients in West of Iran. Sci Res Ess. 2011;6:6454–6458. [Google Scholar]
  • 2.Dabiri H, Maleknejad P, Yamaoka Y, Feizabadi MM, Jafari F, Rezadehbashi M, Nakhjavani FA, Mirsalehian A, Zali MR. Distribution of Helicobacter pylori cagA, cagE, oipA and vacA in different major ethnic groups in Tehran, Iran. J Gastroenterol Hepatol. 2009;24:1380–1386. doi: 10.1111/j.1440-1746.2009.05876.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Medina ML, Medina MG, Martín GT, Picón SO, Bancalari A, Merino LA. Molecular detection of Helicobacter pylori in oral samples from patients suffering digestive pathologies. Med Oral Patol Oral Cir Bucal. 2010;15:e38–e42. [PubMed] [Google Scholar]
  • 4.Prasanthi CH, Prasanthi NL, Manikiran SS, Rama Rao NN. Focus on current trends in the treatment of Helicobacter pylori infection: An update. Inter J Pharm Sci Rev Res. 2011;1:42–51. [Google Scholar]
  • 5.Fernández-Tilapa G, Axinecuilteco-Hilera J, Giono-Cerezo S, Martínez-Carrillo DN, Illades-Aguiar B, Román-Román A. vacA genotypes in oral cavity and Helicobacter pylori seropositivity among adults without dyspepsia. Med Oral Patol Oral Cir Bucal. 2011;16:e175–e180. doi: 10.4317/medoral.16.e175. [DOI] [PubMed] [Google Scholar]
  • 6.Silva DG, Tinoco EM, Rocha GA, Rocha AM, Guerra JB, Saraiva IE, Queiroz DM. Helicobacter pylori transiently in the mouth may participate in the transmission of infection. Mem Inst Oswaldo Cruz. 2010;105:657–660. doi: 10.1590/s0074-02762010000500009. [DOI] [PubMed] [Google Scholar]
  • 7.Iamaroon A, Chaimano S, Linpisarn S, Pongsiriwet S, Phornphutkul K. Detection of Helicobacter pylori in recurrent aphthous ulceration by nested PCR. J Oral Sci. 2003;45:107–110. doi: 10.2334/josnusd.45.107. [DOI] [PubMed] [Google Scholar]
  • 8.Wang J, Chi DS, Laffan JJ, Li C, Ferguson DA, Litchfield P, Thomas E. Comparison of cytotoxin genotypes of Helicobacter pylori in stomach and saliva. Dig Dis Sci. 2002;47:1850–1856. doi: 10.1023/a:1016417200611. [DOI] [PubMed] [Google Scholar]
  • 9.Momtaz H, Souod N, Dabiri H. Comparison of the virulence factors of Helicobacter pylori isolated in stomach and saliva in Iran. Am J Med Sci. 2010;340:345–349. doi: 10.1097/MAJ.0b013e3181d94fbc. [DOI] [PubMed] [Google Scholar]
  • 10.Argent RH, Thomas RJ, Letley DP, Rittig MG, Hardie KR, Atherton JC. Functional association between the Helicobacter pylori virulence factors VacA and CagA. J Med Microbiol. 2008;57:145–150. doi: 10.1099/jmm.0.47465-0. [DOI] [PubMed] [Google Scholar]
  • 11.Jafari F, Shokrzadeh L, Dabiri H, Baghaei K, Yamaoka Y, Zojaji H, Haghazali M, Molaei M, Zali MR. vacA genotypes of Helicobacter pylori in relation to cagA status and clinical outcomes in Iranian populations. Jpn J Infect Dis. 2008;61:290–293. [PMC free article] [PubMed] [Google Scholar]
  • 12.Gzyl A, Berg DE, Dzierzanowska D. Epidemiology of cagA/vacA genes in H. pylori isolated from children and adults in Poland. J Physiol Pharmacol. 1997;48:333–343. [PubMed] [Google Scholar]
  • 13.Blaser MJ. Heterogeneity of Helicobacter pylori. Eur J Gastroenterol Hepatol. 1997;9 Suppl 1:S3–6; discussion S6-7. doi: 10.1007/978-94-009-1792-7_3. [DOI] [PubMed] [Google Scholar]
  • 14.Yamazaki S, Yamakawa A, Okuda T, Ohtani M, Suto H, Ito Y, Yamazaki Y, Keida Y, Higashi H, Hatakeyama M, et al. Distinct diversity of vacA, cagA, and cagE genes of Helicobacter pylori associated with peptic ulcer in Japan. J Clin Microbiol. 2005;43:3906–3916. doi: 10.1128/JCM.43.8.3906-3916.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Abu-Ahmad NM, Odeh A, Sallal A-K J. Prevalence of Helicobacter pylori gastritis at the North of Jordan. Jordan J Bio Sci. 2011;4:71–76. [Google Scholar]
  • 16.Cześnikiewicz-Guzik M, Karczewska E, Bielański W, Guzik TJ, Kapera P, Targosz A, Konturek SJ, Loster B. Association of the presence of Helicobacter pylori in the oral cavity and in the stomach. J Physiol Pharmacol. 2004;55 Suppl 2:105–115. [PubMed] [Google Scholar]
  • 17.Parsonnet J, Shmuely H, Haggerty T. Fecal and oral shedding of Helicobacter pylori from healthy infected adults. JAMA. 1999;282:2240–2245. doi: 10.1001/jama.282.23.2240. [DOI] [PubMed] [Google Scholar]
  • 18.Salmanian AH, Siavoshi F, Akbari F, Afshari A, Malekzadeh R. Yeast of the oral cavity is the reservoir of Heliobacter pylori. J Oral Pathol Med. 2008;37:324–328. doi: 10.1111/j.1600-0714.2007.00632.x. [DOI] [PubMed] [Google Scholar]
  • 19.Siavoshi F, Salmanian AH, Akbari F, Malekzadeh R, Massarrat S. Detection of Helicobacter pylori-specific genes in the oral yeast. Helicobacter. 2005;10:318–322. doi: 10.1111/j.1523-5378.2005.00319.x. [DOI] [PubMed] [Google Scholar]
  • 20.Gatti LL, Lábio R, Silva LC, Smith Mde A, Payão SL. CagA positive Helicobacter pylori in Brazilian children related to chronic gastritis. Braz J Infect Dis. 2006;10:254–258. doi: 10.1590/s1413-86702006000400008. [DOI] [PubMed] [Google Scholar]
  • 21.Bindayna KM, Al Baker WA, Botta GA. Detection of Helicobacter pylori cagA gene in gastric biopsies, clinical isolates and faeces. Indian J Med Microbiol. 2006;24:195–200. [PubMed] [Google Scholar]
  • 22.Kangsadalampai S, Rojpibulstit P, Ratanavalachai T, Tomtitchong P. cagA positive Helicobacter pylori and gastroduodenal pathology. Thamasat Int J Sc Tech. 2005;10:1–5. [Google Scholar]
  • 23.Cirak MY, Ozdek A, Yilmaz D, Bayiz U, Samim E, Turet S. Detection of Helicobacter pylori and its CagA gene in tonsil and adenoid tissues by PCR. Arch Otolaryngol Head Neck Surg. 2003;129:1225–1229. doi: 10.1001/archotol.129.11.1225. [DOI] [PubMed] [Google Scholar]
  • 24.Gutiérrez B, Vidal T, Valmaña CE, Camou-Juncas C, Santos A, Mégraud F, González N, Leonard I, Martínez R, Díaz-Canel O, et al. Helicobacter pylori infection in Havana, Cuba. Prevalence and cagA status of the strains. VacciMonitor. 2005;14:15–19. [Google Scholar]
  • 25.Dabiri H, Bolfion M, Mirsalehian A, Rezadehbashi M, Jafari F, Shokrzadeh L, Sahebekhtiari N, Zojaji H, Yamaoka Y, Mirsattari D, et al. Analysis of Helicobacter pylori genotypes in Afghani and Iranian isolates. Pol J Microbiol. 2010;59:61–66. [PMC free article] [PubMed] [Google Scholar]
  • 26.Talebkhan Y, Mohammadi M, Mohagheghi MA, Vaziri HR, Eshagh Hosseini M, Mohajerani N, Oghalaei A, Esmaeili M, Zamaninia L. cagA gene and protein status among Iranian Helicobacter pylori strains. Dig Dis Sci. 2008;53:925–932. doi: 10.1007/s10620-007-9978-y. [DOI] [PubMed] [Google Scholar]
  • 27.López-Vidal Y, Ponce-de-León S, Castillo-Rojas G, Barreto-Zúñiga R, Torre-Delgadillo A. High diversity of vacA and cagA Helicobacter pylori genotypes in patients with and without gastric cancer. PLoS One. 2008;3:e3849. doi: 10.1371/journal.pone.0003849. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Linpisarn S, Suwan W, Lertprasertsuk N, Koosirirat C, Steger HF, Prommuangyong K, Phornphutkul K. Helicobacter pylori cagA, vacA and iceA genotypes in northern Thai patients with gastric disease. Southeast Asian J Trop Med Public Health. 2007;38:356–362. [PubMed] [Google Scholar]
  • 29.Ahmad T, Sohail K, Rizwan M, Mukhtar M, Bilal R, Khanum A. Prevalence of Helicobacter pylori pathogenicity-associated cagA and vacA genotypes among Pakistani dyspeptic patients. FEMS Immunol Med Microbiol. 2009;55:34–38. doi: 10.1111/j.1574-695X.2008.00492.x. [DOI] [PubMed] [Google Scholar]
  • 30.Rudi J, Kolb C, Maiwald M, Kuck D, Sieg A, Galle PR, Stremmel W. Diversity of Helicobacter pylori vacA and cagA genes and relationship to VacA and CagA protein expression, cytotoxin production, and associated diseases. J Clin Microbiol. 1998;36:944–948. doi: 10.1128/jcm.36.4.944-948.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Miciuleviciene J, Calkauskas H, Jonaitis L, Kiudelis G, Tamosiūnas V, Praskevicius A, Kupcinskas L, Berg D. Helicobacter pylori genotypes in Lithuanian patients with chronic gastritis and duodenal ulcer. Medicina (Kaunas) 2008;44:449–454. [PubMed] [Google Scholar]
  • 32.Saribasak H, Salih BA, Yamaoka Y, Sander E. Analysis of Helicobacter pylori genotypes and correlation with clinical outcome in Turkey. J Clin Microbiol. 2004;42:1648–1651. doi: 10.1128/JCM.42.4.1648-1651.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Hussein NR, Mohammadi M, Talebkhan Y, Doraghi M, Letley DP, Muhammad MK, Argent RH, Atherton JC. Differences in virulence markers between Helicobacter pylori strains from Iraq and those from Iran: potential importance of regional differences in H. pylori-associated disease. J Clin Microbiol. 2008;46:1774–1779. doi: 10.1128/JCM.01737-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Momenah AM, Tayeb MT. Relationship between Helicobacter pylori vacA genotypes status and risk of peptic ulcer in Saudi patients. Saudi Med J. 2006;27:804–807. [PubMed] [Google Scholar]
  • 35.Berloco P, Cavallini A, Di Leo A, Russo F. Saliva samples not a reliable tool for diagnosis of Helicobacter pylori infection. Eur J Clin Microbiol Infect Dis. 2001;20:68–69. doi: 10.1007/pl00011238. [DOI] [PubMed] [Google Scholar]
  • 36.Olivier BJ, Bond RP, van Zyl WB, Delport M, Slavik T, Ziady C, Terhaar Sive Droste JS, Lastovica A, van der Merwe SW. Absence of Helicobacter pylori within the oral cavities of members of a healthy South African community. J Clin Microbiol. 2006;44:635–636. doi: 10.1128/JCM.44.2.635-636.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Tanahashi T, Kita M, Kodama T, Sawai N, Yamaoka Y, Mitsufuji S, Katoh F, Imanishi J. Comparison of PCR-restriction fragment length polymorphism analysis and PCR-direct sequencing methods for differentiating Helicobacter pylori ureB gene variants. J Clin Microbiol. 2000;38:165–169. doi: 10.1128/jcm.38.1.165-169.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Makristathis A, Pasching E, Schütze K, Wimmer M, Rotter ML, Hirschl AM. Detection of Helicobacter pylori in stool specimens by PCR and antigen enzyme immunoassay. J Clin Microbiol. 1998;36:2772–2774. doi: 10.1128/jcm.36.9.2772-2774.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Occhialini A, Urdaci M, Doucet-Populaire F, Bébéar CM, Lamouliatte H, Mégraud F. Macrolide resistance in Helicobacter pylori: rapid detection of point mutations and assays of macrolide binding to ribosomes. Antimicrob Agents Chemother. 1997;41:2724–2728. doi: 10.1128/aac.41.12.2724. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from World Journal of Gastroenterology : WJG are provided here courtesy of Baishideng Publishing Group Inc

RESOURCES