Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2013 May 1.
Published in final edited form as: Free Radic Biol Med. 2012 Mar 6;52(9):2038–2046. doi: 10.1016/j.freeradbiomed.2012.02.042

Nrf2-regulated phase II enzymes are induced by chronic ambient nanoparticle exposure in young mice with age-related impairments

Hongqiao Zhang 1, Honglei Liu 1, Kelvin JA Davies 1, Constantinos Sioutas 1, Caleb E Finch 1, Todd E Morgan 1, Henry Jay Forman 1,2
PMCID: PMC3342863  NIHMSID: NIHMS370693  PMID: 22401859

Abstract

Background

Many xenobiotic detoxifying (phase II) enzymes are induced by sublethal doses of environmental toxicants. However, these adaptive mechanisms have not been studied in response to vehicular-derived airborne nano-sized particulate matter (nPM). Because aging is associated with increased susceptibility to environmental toxicants, we also examined the expression of Nrf2-regulated phase II genes in middle-aged mice and their inducibility by chronic nPM.

Methods

The nPM from vehicular traffic was collected in urban Los Angeles and re-aerosolized for exposure of C57BL/6J male mice (3 and 18 months old) for 150 hours over 10 weeks. Brain (cerebellum), liver, and lung were assayed by RT-PCR and/or western blots for the expression of phase II enzymes: glutamate cysteine ligase (catalytic GCLC, and modifier GCLM subunits), NAD(P)H:quinone oxidoreductase 1 (NQO1), heme oxygenase 1 (HO-1), and relevant transcription factors: NF-E2 related factor 2 (Nrf2), c-Myc, Bach1.

Results

Chronic nPM exposure induced GCLC, GCLM, HO-1, NQO1 mRNA and protein similarly in cerebellum, liver, and lung of young mice. Middle-aged mice had elevated basal levels, but showed impaired further induction by nPM. Similarly, Nrf2 increased with age and was induced by nPM in young but not old. c-Myc showed the same age- and induction- profile while the age-increase in Bach1 was further induced by nPM.

Conclusions

Chronic exposure to nanoparticles induced Nrf2-regulated detoxifying enzymes in brain (cerebellum), liver, and lung of young adult mice indicating a systemic impact of nPM. In contrast, middle-aged mice did not respond above their elevated basal levels except for Bach1. The lack of induction of phase II enzymes in aging mice may be a model for the vulnerability of elderly to air pollution.

Keywords: aging, detoxifying enzyme, Nrf2, antioxidant, particle

Introduction

Chronic exposure to nanoscale particulate matter (nPM) from urban freeway air can induce oxidative stress and inflammation in rodent organs, including brain (Campbell et al. 2009; Kleinman et al. 2008; Morgan et al. 2011), lung (Li et al. 2008; Muhlfeld et al. 2008), and arteries (Araujo et al. 2008). In vitro, nPM rapidly impaired mitochondrial respiration in monocytes (Xia et al. 2006) and in neuronal PC12 cells (Morgan et al. 2011). The impact of aging in responses to nPM has not been considered in animal models.

Older humans are generally considered more susceptible to adverse health effects of environmental insults (Risher et al. 2010). During surges of smoke, dust, or air pollution, urban elderly have a higher rate of hospitalization from cardio-pulmonary conditions (Jimenez et al. 2010; Qian et al. 2010; Prescott et al. 1998; Schwartz 1996). In the only animal model study we know, acute exposure (1- to 5-days) of aging mice to cigarette smoke caused greater activation of alveolar macrophages (NOS assay), but smaller induction of glutathione reductase (Gould et al. 2010).

Many factors may increase the susceptibility to toxicants during aging, including impaired oxidative homeostasis and altered clearance (Meyer 2010; Weiskopf et al. 2009; Liu and Mori 1999; Schmucker 1985; Klotz 2009; Li et al. 2000; Nguyen et al. 2000; Wild and Mulcahy 2000). We focus here on Phase II detoxifying enzymes, glutamate cysteine ligase (GCL), NAD(P)H quinone oxidoreductase 1 (NQO1) and heme oxygenase-1 (HO-1), which are critical to catabolizing endogenous and xenobiotic toxicants and are robustly induced in young adults as an adaptive response to toxic stressors (Li et al. 2000; Nguyen et al. 2000; Wild and Mulcahy 2000; Prochaska et al. 1985). In particular, Xia et al (Xia et al. 2006) suggested that phase II enzymes mediate responses to aerosolized particulate matter.

Besides examining phase II enzyme responses to nPM, we also examined Nrf2, a key transcription factor in the NF-E2 related factor 2 pathway (Nguyen et al. 2000; Venugopal and Jaiswal 1996; Itoh et al. 1997; Alam et al. 1999; Moinova and Mulcahy 1999; Wild et al. 1999; Hur and Gray 2011; Kaspar et al. 2009; Osburn and Kensler 2008). The Nrf2 transcription factor is rapidly turned over in the cytosol by ubiquitin-dependent degradation mediated by Nrf2 binding to Keap1 (also called iNrf2) under unstressed conditions (Itoh et al. 1999; Cullinan et al. 2003; Bloom and Jaiswal 2003). Upon exposure to electrophiles or other stressors, critical cysteine residues in Keap1 are modified allowing Nrf2 to be released without ubiquitination (Itoh et al. 2004; Giudice et al. 2010). After translocation to the nucleus, Nrf2 forms heterodimers with other transcription factors and binds to the electrophile response element (EpRE) (also known as the antioxidant response element) in the promoters of phase II genes to enhance transcription (Bloom and Jaiswal 2003; Itoh et al. 2004).

In addition, we examined two other co-transcription factors that interact with Nrf2: BACH1 (BTB and CNC homology 1), a BTB-basic leucine zipper transcription factor that binds to the EpRE site (Oyake et al. 1996), and c-Myc. Bach1 is a repressor of HO-1 (Sun et al. 2002; Kitamuro et al. 2003; Shan et al. 2004), NQO1 (Dhakshinamoorthy et al. 2005), and other Nrf2-regulated genes including GCLC and GCLM (Warnatz et al. 2011). Bach1 appears to repress gene expression by competing with Nrf2 for the binding to EpRE in the promoter region of these genes (Dhakshinamoorthy et al. 2005; Sun et al. 2004). In fact, inactivation of Bach1 is required for Nrf2 induction of HO-1 (Reichard et al. 2007). In addition, Bach1 can be regulated through the Nrf2 pathways: the delayed response relative to Nrf2 activation may contribute to the down-regulation of Nrf2-regulated genes and serve as a feedback inhibitory mechanism for Nrf2-mediated gene regulation (Jyrkkanen et al. 2011). c-Myc, which belongs to the basic helix-loop-helix leucine-zipper transcription factor family, has a complex relationship with Nrf2. In response to the electrophile, 4-hydroxynonenal, c-Myc and Nrf2 showed inverse binding to the EpRE element in several genes in human bronchial epithelial cells (Levy and Forman 2010). However, silencing of c-Myc expression elevated mRNA expression of those EpRE-regulated genes and EpRE-driven reporter constructs and increased the half-life of the Nrf2 protein, suggesting that c-Myc acts as a negative regulator of Nrf2 (Levy and Forman 2010).

The rodent studies discussed here include a range of ages within life spans that are typically 28–32 months. It is important to consider that ages being studied have varied widely between reports. Post-pubertal age changes may be denoted as maturational (2–5 months) or middle-age (12–24 months), when long-lived rodent genotypes have low mortality rates and modest levels of cancer, glomerulonephritis, and other degenerative diseases. After 24–26 months (senescence), chronic degenerative diseases and mortality increase sharply (Finch and Pike 1996).

The effect of aging on phase II enzyme expression is unresolved in direction and extent. On one hand, two studies reported age-related increases of detoxifying gene expression during aging: seven phase II enzymes were increased in liver of 20- vs 6-month old rats (Mori et al. 2007). Similarly, GCLC in aortic vascular smooth muscle cells was higher in primary cultures from senescent rats (24- vs 6-month old) (Li et al. 2006); moreover, nuclear Nrf2 increased with age. In contrast to these increases with aging, Wang et al. (2003) found progressive decreases during aging in the expression of both GCL subunits, GCLC (the catalytic subunit) and GCLM (the regulatory subunit) from livers of senescent mice (3-vs 12- vs 24-month-old), but no age change in spleen or brainstem. Similarly, mRNA levels of six phase II enzymes were decreased in liver of middle-aged rats (20- vs 6 month old) (Mori et al. 2007). Again, in rat liver, Nrf2 was decreased in senescent rats (26- vs 3-month old) (Suh et al. 2004; Shih and Yen 2007). Although GCL expression was decreased in the lungs of 8- vs 24-month-old mice (Gould et al. 2010) and in liver and kidney of 3 –vs 12-month old rats (Liu and Choi 2000), the absence of further age effects up through 26 months suggest that these changes are maturational rather than senescence related.

The present study extends our recent report that chronic nPM induces inflammatory genes and decreases neuronal glutamate receptors in the mouse brain (Morgan et al. 2011). Because the Nrf2/KEAP1 pathway is neuroprotective during oxidative stress (Satoh et al. 2006), we investigated the role of phase II enzyme regulation in responses to nPM. We also examined liver and lung in the same animals because of the literature cited above. It is notable that few studies of aerosol toxicity have included multiple organs. We investigated the basal expression of representative Nrf2-regulated phase II detoxifying enzymes, GCL, NQO1, and HO-1, and their induction by chronic exposure to nPM in the cerebellum, liver and lung. We also determined the change of Nrf2, c-Myc and Bach1 expression, with the purpose of beginning to identify the underlying mechanism of any changes in the basal and adaptive expression of phase II genes with age. Because of evidence for increased vulnerability to inhaled particulate matter in aging humans and a rodent model (see above), we compared responses of young adult (6-month-old) vs middle-aged (21-month-old) mice. Senescent mice were not examined to minimize possible confounds of gross organ pathology which are scattered unevenly in later age groups. The C57BL/6J male mouse was chosen because of its well characterized good health up through 21 months of age and because of its use in prior studies from the lab (Morgan et al. 2011) and other reports cited above (Gould et al. 2010; Finch and Pike 1996; Mori et al. 2007; Wang et al. 2003). As an animal model for human aging, a 6-month-old mouse is equivalent in physiological age to a 30-year-old human, while a 21-month-old mouse is equivalent to a 60 year-old human in a healthy environment (Flurkey K 2007).

Materials and Methods

Chemicals and reagents

Unless otherwise noted, all chemicals were from Sigma (St. Louis, MO). M-PER (Mammalian Protein Extraction Reagent) and NE-PER (Nuclear Protein Extraction Reagent) were from Thermal Fisher Scientific (Rockford, IL). Antibodies were from Santa Cruz (Santa Cruz, CA). TRIzol Reagent was from Life Technologies (Grand Island, NY). DNA-free DNase Treatment and Removal Reagents were from Ambion (Austin, TX). TaqMan Reverse Transcription Reagent and SYBR Green PCR Master Mix were from Applied Biosystems (Foster City, CA). The stripping buffer for Western Blots was from Millipore Inc. (Bedford, MA). All chemicals used were at least analytical grade.

Nanoparticle collection and transfer into aqueous suspension

Airborne nano-sized particulate matter (nPM) was collected with a High-Volume Ultrafine Particle (HVUP) Sampler (Misra C 2002) at 400 L/min in Los Angeles City near the CA-110 Freeway. These aerosols represent a mix of fresh ambient particles mostly from vehicular traffic nearby this freeway (Ning et al. 2007). The nPM fraction of diameter <200 nm was collected on pre-treated Teflon filters (20 × 25.4 cm, PTFE, 2 µm pore; Pall Life Sciences). The nPM fraction was transfered into aqueous suspension by 30 min soaking of nanoparticle loaded filters in Milli-Q deionized water (resistivity 18.2 megaΩ; total organic compounds <10 ppb; particle-free; bacteria levels <1 CFU/ml; endotoxin-free glass vials), followed by vortexing (5 min) and sonication (30 min). Aqueous nPM suspensions were pooled and frozen as a stock at −20 °C, which retains chemical stability for >3 mo (Li et al. 2003).

Animals and exposure

The nPM suspensions were re-aerosolized by a VORTRAN nebulizer using compressed particle-free filtered air (Morgan et al. 2011). Particles were diffusion-dried by passing through silica gel; static charges were removed by passing over 210Po neutralizers. Particle sizes and concentrations were continuously monitored during exposure at 0.3 lpm by a Scanning Mobility Particle Sizer (SMPS Model 3080, TSI Inc.). The nPM mass concentration was determined by pre- and post- weighing the filters under controlled temperature and relative humidity. Inorganic ions (NH4+, NO2−, SO42−) were analyzed by ion chromatography (IC). Particle-bound metals and trace elements were assayed by Magnetic-Sector Inductively Coupled Plasma-Mass Spectroscopy. Water-soluble organic carbon (WSOC) was assayed by a GE-Sievers liquid analyzer. Cadmium concentrations (5 ng/m3) are at trace level in nPM (300–400 µg/m3). The nPM used did not contain detectable levels of endotoxin (limulus amebocyte lysates assay, unpublished result).

C57BL/6J male mice (3- and 18 month-old) were maintained under standard conditions with ad libitum Purina Lab Chow and sterile water. Just before exposure, mice were transferred from home cages to exposure chambers that allowed free movement (Morgan et al. 2011). Temperature and airflow were controlled for adequate ventilation and to minimize buildup of animal-generated contaminants (skin dander; CO2, NH3). Re-aerosolized nanoparticle or ambient room air (control) was delivered to the sealed exposure chambers for 5 hr/day, 3 days/week for 10 weeks. Mice did not lose weight or show signs of respiratory distress. Mice were euthanized after isoflurane anesthesia; tissues were stored at −80°C. All rodents were treated humanely with procedures approved by the USC Institutional Animal Care and Use Committee.

Quantitative analysis of mRNA

Tissues were homogenized and RNA extracted with TriZol Reagent. The total RNA was treated with DNA-free reagent to remove contaminating DNA. RNA was reverse transcribed and the mRNA determined with RT-PCR assays (Zhang et al. 2005). Beta-glucuronidase (GUSB) was the internal control in the RT- PCR assay. The primers used were listed in Table 1.

Table 1.

Primers for RT-PCR determination of mRNAs of Phase II genes in mice

Gene Strand Sequence
(from 5’ to 3’)
Gclc Sense ATGTGGACACCCGATGCAGTATT
Anti-sense TGTCTTGCTTGTAGTCAGGATGGTTT
Gclm Sense GCCACCAGATTTGACTGCCTTT
Anti-sense CAGGGATGCTTTCTTGAAGAGCTT
NQO1 Sense CAAGTTTGGCCTCTCTGTGG
Anti-sense AAGCTGCGTCTAACTATATGT
HO-1 Sense AACAAGCAGAACCCAGTCTATGC
Anti-sense AGGTAGCGGGTATATGCGTGGGCC
GUSB Sense CGAGAGAGATACTGGAGGATTG
Anti-sense CAGTTCACAAAATCCCAAATAGA
Nrf2 Sense TCTCCTCGCTGGAAAAAGAA
Anti-sense AATGTGCTGGCTGTGCTTTA
Open in a new tab

Western Analysis

Briefly, cell lysates were extracted with M-PER (Thermo Scientific) and nuclear lysate with NE-PER (Thermo Scientific). 40 µg protein was heated for 15 min at 95°C in 2X loading buffer containing SDS (Tris base, pH 6.5, glycerol, DTT, and pyronin Y), electrophoresed on a 4–20% Tris-glycine acrylamide gel (Invitrogen, Carlsbad, CA), and then electroblotted onto polyvinylidene difluoride (PVDF) membranes (Millipore corporation, Bedford, MA). Membranes were blocked with 5% fat-free milk and then incubated overnight at 4°C with primary antibody in 5% milk in Tris-buffered saline (TBS). The antibodies used include GCLC, GCLM, Nrf2, c-Myc, Bach1, β-tubulin, or Lamin B1 (Santa Cruz). After completion of each Western blots, membrane was stripped with stripping buffer (Millipore) before starting next new blotting. After being washed with TBS containing 0.05% Tween 20 (TTBS), membranes were incubated with secondary antibody (Goat anti-rabbit) at room temperature for 2 h. After TTBS washing, membranes were treated with an enhanced chemiluminescence reagent mixture (ECL Plus; Amersham, Arlington Heights, IL) for 5 min. The target bands were imaged on a Kodak Image Station 2000R (Kodak Company, Rochester, New York).

Statistical analysis

A comparative ΔΔCT method was used for the relative mRNA quantitation as described before (Zhang et al. 2005). Data are expressed as mean ± standard error. SigmaStat 3.5 was used for statistical analysis, with statistical significance at p < 0.05. The one-way ANOVA and Tukey test were used for comparison of mRNA levels and protein levels.

Results

Exposure to airborne nano-sized particulate matter (nPM) induces phase II enzymes

Because exposure to airborne nPM from urban vehicular traffic generates reactive oxygen species in cells (Squadrito et al. 2001; Stone et al. 2007), we hypothesized that exposure to nPM would also induce Nrf2-regulated phase II enzymes in mice. Young adult mice exposed to nPM for 10 weeks showed vigorous induction (+50 to 150%) of GCLC and GCLM mRNA and protein (Fig. 1) in brain (cerebellum) (Fig. 1A,D), liver (Fig. 1B,E), and lung (Fig. 1 C, F). There was strong correlation between mRNA and protein values in these same samples (Fig. 3). Chronic nPM similarly induced NQO1 and HO-1 mRNA in cerebellum, liver, and lung (Fig. 4A).

Figure 1.

Figure 1

Open in a new tab

Induction of Nrf2-regulated phase II genes, GCLC and GCLM, in response to nPM exposure in young mouse cerebellum (A, D), Liver (B, E), Lung (C, F). Top panel (A, B, C) shows induction of mRNAs (relative to unexposed). Bottom panel (D, E, F) shows relative induction of proteins compared to unexposed (calculated from densitometry of western blot, representative blot is shown). * P<0.05 compared to unexposed (Air), N=6.

Figure 3.

Figure 3

Open in a new tab

Correlation of protein with mRNA levels of GCLC (A) and GCLM (B). Plots were made using the level of protein or mRNA of each gene relative to the average of 6-month-old group without nPM exposure.

Figure 4.

Figure 4

Open in a new tab

Induction of Nrf2-regulated phase II genes, NQO1 and HO-1, in response to nPM exposure in young (A) and old (B) cerebellum, liver and lung. mRNA levels are relative to GUSB. * P<0.05 compared to unexposed (Air), N=6.

Middle-aged mice showed increased basal expression of Nrf2-regulated phase II genes and limited induction by nPM

Basal levels of GCLC, GCLM, NQO1, and HO-1 mRNA and protein were elevated in the cerebellum, liver, and lung of 21- vs 6-month-old mice by 45% to 145% (Table 2). In contrast to the young (Fig.1), middle-aged mice showed impaired induction of GCLC and GCLM at both mRNA and protein levels in the three tissues (Fig. 2). Similarly, NQO1 and HO-1 mRNA levels were not induced by nPM exposure in older mice (Fig. 4B). GCLC (Fig. 3A) and GCLM (Fig. 3B) mRNA and protein levels were highly correlated in each tissue of individual mice across age and treatment.

Table 2.

Age change of phase II enzymes and transcription factors levels Compared to young (100%)

Enzyme Tissue mRNA Protein
GCLC CB 243±36* 182±23*
LV 220±48* 152±19*
LG 174±37* 151±1*
GCLM CB 194±33* 172±27*
LV 178±24* 178±22*
LG 167±31* 171±23*
NQO1 CB 204±27* Na
LV 147±26* Na
LG 211±47* Na
HO-1 CB 179±37* Na
LV 179±12* Na
LG 200±33* Na
Nrf2 CB 221±56* 161±13*
LV 306±76* 151±11*
LG 102±23 158±12*
c-Myc CB na 270±42*
LV na 187±27*
LG na 187±22*
Bach1 CB na 180±16*
LV na 150±21*
LG na 250±19*
Open in a new tab
*

P<0.05 compared with air control of 6 mo.

Figure 2.

Figure 2

Open in a new tab

Induction of Nrf2-regulated phase II genes, GCLC and GCLM, in response to nPM exposure in old mouse cerebellum (A, D), Liver (B, E), Lung (C, F). Top panel (A, B, C) shows induction of mRNAs (relative to unexposed). Bottom panel (D, E, F) shows relative induction of proteins compared to unexposed (calculated from densitometry of western blot, representative blot is shown). * P<0.05 compared to unexposed (Air), N=6.

Phase II regulatory factors: Nrf1, Bach-1, and c-Myc

We examined regulatory mechanisms in phase II genes with the transcription factors: Nrf2, c-Myc, and Bach1. Aging increased Nrf2 mRNA in cerebellum and liver, but not lung (Fig. 5A), whereas Nrf2 protein was higher in all three tissues (Fig. 5B). Chronic nPM exposure increased both Nrf2 mRNA (Fig. 6A) and protein (Fig. 6B) in the cerebellum, liver and lung of 6-month-old mice. In contrast, Nrf2 in aging mice did not respond to nPM in three tissues (Fig. 6). In non-exposed 21-month-old controls, the nuclear content of Nrf2, which reflects Nrf2 activation, followed a similar pattern as total Nrf2 protein, with age-related increase in all tissues (Fig. 7). Following nPM exposure, nuclear Nrf2 was increased all tissues of younger mice. Again, middle-aged mice did not respond (Fig. 7).

Figure 5.

Figure 5

Open in a new tab

Basal expression of Nrf2 in 6-month and 21-month-old mice. (A) mRNA levels (relative to GUSB intrinsic control); (B) protein levels (relative to 6-month-old mice). *, P<0.05 compared with that of 6-month-old mice, N=6. The densitometric quantification is based on the Western blots (representative blot shown).

Figure 6.

Figure 6

Open in a new tab

Induction of Nrf2 in response to nPM exposure. (A) Induction of mRNA (relative to GUSB intrinsic control); (B) Western blot of Nrf2 protein (3 of 6 from each group shown); (C) Induction of Nrf2 protein (relative to unexposed). The densitometric quantification is based on 6 mice in each group. *, P<0.05, comparison between air control and nPM exposure of the same age mice, N=6; #, P<0.05, comparison between nPM exposure of 6-month and 21-month-old mice, N=6.

Figure 7.

Figure 7

Open in a new tab

Change of nuclear Nrf2 protein with age and nPM exposure. (A) Western blot of Nrf2 protein levels in cerebellum, liver, and lung (3 of 6 from each group shown). (B) Densitometric quantification for all 6 mice in each group relative to 6-month-old unexposed mice. *, P<0.05, comparison between basal expression of 6-month and 21-month-old mice, N=6; #, P<0.05, comparison between air and nPM exposure of the same age N=6.

c-Myc and Bach1, which inhibit Nrf2 signaling, were measured in cerebellum (Fig. 8A), liver (Fig. 8B), and lung (Fig. 8C). Basal protein levels of c-Myc and Bach1 were increased with age in all tissues: c-Myc was increased by 170% in cerebellum, 87% in liver, and 90% in lung; Bach1 was increased by 80% in cerebellum, 50% in liver, and 150% in lung. Chronic exposure to nPM increased c-Myc in tissues of 6-month-old mice, but not in the older mice. In contrast, Bach1 was not increased by nPM in tissues of 6-month-old mice, but was induced by nPM in older mice.

Figure 8.

Figure 8

Open in a new tab

Changes of Bach1 and cMyc with age and nPM exposure in the cerebellum (A), liver (B), and lung (C). *, P<0.05 compared with 6-month-old mice, N=6. The upper panel shows Western blots for 3 of the 6 mice from each group. The lower panel shows the densitometric quantification for all 6 mice in each group relative to the average for 6-month-old unexposed mice.

Discussion

We show that inhalation exposure to urban vehicular nPM induces adaptive responses that elevate specific phase II enzymes (GCLC, GCLM, NQO1, HO-1) and involve the change of related regulatory transcription factors (Nrf2, c-Myc, Bach-1) in brain (cerebellum), liver, and lung from young mice. Moreover, basal expression of each of these phase II enzymes and transcription factors is increased with age in the three tissues. However, in contrast to young, nPM exposure did not increase phase II enzymes above their elevated basal level in middle-aged mice.

These findings extend the reported induction of Nrf2 and NQO1 mRNA by nPM (ultrafine particles) in rat liver (Araujo et al 2008). The similar induction in brain, liver, and lung provides the first evidence for a system-wide induction of phase II enzymes and change of related regulatory transcription factors by airborne nPM. The airways are considered to be the major route of entry of airborn particulate matter, to which lung cells would be particularly exposed. Moreover, the liver and cerebellum showed equivalent induction of phase II enzymes and related transcription factors, which implies a systemic and humoral response. Brain responses are particularly interesting and could involve several routes, via the blood brain barrier (BBB) or direct passage through olefactory neurons (Block and Calderon-Garciduenas 2009). As precedent, long-term exposure to urban air pollution exposure caused BBB disruption in young adult brains (Calderon-Garciduenas et al. 2008) and canines (Calderon-Garciduenas et al. 2002). Airborne particulate matter can also enter the brain directly from the nasal mucosa via olfactory neurons (Oberdorster et al. 2005). However, the cerebellum does not directly connect with olfactory neurons. Therefore, nPM may elicit a systemic response that mediates these widespread tissue and cellular effects.

The induction of the Nrf2-regulated phase II detoxifying enzymes is considered a major adaptive response to endogenous and exogenous toxicants (Li et al. 2000; Nguyen et al. 2000; Wild and Mulcahy 2000; Prochaska et al. 1985; Venugopal and Jaiswal 1996; Itoh et al. 1997; Alam et al. 1999; Moinova and Mulcahy 1999; Wild et al. 1999). Basal expression of these genes is in part regulated by Nrf2, as we have shown for HO-1, GCLC and GCLM in the human bronchial epithelial (HBE1) cell line (Zhang and Forman 2008) (Zhang et al. 2007). Besides Nrf2, Bach1 and cMyc in the transcriptional regulation of phase II enzymes and other redox-sensitive pathways need consideration in responses to nPM (Fig. 9). The initiation of these responses by nPM plausibly involves lipid peroxidation at the cell membrane, with ensuing mitochondrial damage, as documented in vitro for monocytes and neurons (Introduction). Electrophillic products of lipid peroxidation can also activate JNK, which is a documented response in brain of nPM exposed rodents (Kleinman et al. 2008). AP-1 is also induced, which can interact with Nrf2. Moreover, nPM exposure also induced NF-kB (Campbell et al. 2005) and proinflammatory cytokines in brain (Campbell et al. 2009; Kleinman et al. 2008; Morgan et al. 2011). The arterial system is also sensitive to nPM, which promotes atherogenic changes (Li et al. 2010; Araujo and Nel 2009). Moreover, chronic nPM exposure increases insulin resistance and alters mitochondria in adipose tissues (Xu et al. 2011). These metabolic and inflammatory responses to nPM could further involve insulin-like signaling pathways with Nrf2 involvement (Tan et al. 2011). The fragmentary data available points to the need for a systematic approach to the air pollution transcriptome, which could reveal shared and tissue-specific pathways of response to the urban air pollution. While the present transcriptional focus is supported by the parallel increases of phase II mRNA and protein (Fig.3), post-translational modifications are also relevant in GCLC activation (Suh et al. 2004).

Figure 9.

Figure 9

Open in a new tab

Adaptive and pathological responses to nPM. We summarize effects of nPM upon cells based upon studies here and in our previous work (Morgan et al. 2011; Liu et al. 2007; Premasekharan et al. 2011). Exposure to nPM causes loss of mitochondrial function; however, at very low doses, particles with iron on their surfaces can induce a small amount of lipid peroxidation that results in lipid raft disruption leading to NF-κB activation of cytokine production. Lipid peroxidation can also produce electrophilic products that can activate both JNK, leading to increased transcription of AP-1 regulated genes, and Nrf2 that increases several phase II genes. Bach1 and c-Myc, which increase during aging, down-regulate Nrf2-induced phase II gene expression.

Two significant changes were observed in middle-aged mice. Basal expression of Nrf2-regulated phase II genes, including GCLC, GCLM, NQO1, and HO-1, was higher in the lungs, cerebellum, and liver of old mice (21 month) than young adults mice (6 month). Consistent with the role of Nrf2 as an inducer of phase II genes, basal Nrf2 expression also increased with age in these tissues. However, c-Myc and Bach1, two transcription factors that inhibit Nrf2 induced transcription, were also increased. These changes could be compensatory responses to the age-related damage from increased oxidative stress and inflammation (Harman 1992; Chung et al. 2011; Gil Del Valle 2010; Grimble 2003). We note the divergence of our findings on increased hepatic GCLC at 21 months from the decrease of GCLC in 27-month old rat liver reported by Suh et al (2004). This divergence could arise from different ages, species, and environment. Ongoing studies address the opposite age changes in liver from these data on aging mice versus our prior studies of aging rats (Suh et al. 2004).

These age-related impairments of phase II enzyme induction during chronic exposure to nPM are consistent with other age-impairments in the induction of detoxifying enzyme induction, e.g. slowed induction of liver NADPH: cytochrome c reductase during acute treatments with phenobarbital in 24 vs 2 mo old rats (Adelman 1971). The lack of induction in aging mice of Nrf2 and Nrf2-regulated phase II genes to nPM suggests a new mechanism in the susceptibility of elderly to airborne pollutant particles (see Introduction) and implies that aging tissues may approach a homeostatic limit in compensation for the oxidative damage of normal aging, which arise even without tangible external toxins or stressors. The age-related increase of Bach1 was further elevated in old in response to nPM, which may partially explain why the phase II enzymes are not induced further. Age-related declines in the inducibility of Nrf2-regulated phase II genes and related transcriptional factors add to the growing role of transcriptional regulatory changes during aging that are shared across tissues. New strategies are needed to improve stress resistance in the elderly.

One consequence of our findings is that they may suggest that therapeutic approaches based on activating Nrf2 may not be as effective in the older individuals as in young adults. This hopefully should not suggest to anyone that as one ages that consuming fruits and vegetables, the main sources of compounds that beneficially activate Nrf2 can be dimininished. Certainly fruits and vegetables offer a lot more than just the so-called antioxidants that activate Nrf2 including micronutrients and roughage. Nonetheless, the results do suggest that approaches, including pharmacological, for helping resist the downside of aging might better focus on the non redox-dependent mechanisms for increasing these enzymes.

Highlights.

  • Inhaled nanoparticles (nPM) induce phase II enzymes systemically in young mice

  • Middle-aged mice had elevated phase II enzymes, but induction by nPM was impaired

  • Nrf2 increased with age and was induced by nPM in young but not middle-aged mice

  • Nrf2 inhibitors, c-Myc and Bach1 increased with age along with depressed induction

  • Depressed enzyme induction by nPM in aging may increase air pollution vulnerability

Table 3.

Induction of phase II enzymes compared with air control (100%)

Gene Tissue mRNA Protein
6-month 21m-month 6-month 21m-month
GCLC CB 174±29* 90±14 176±9* 107±14
LV 188±45* 75±18 167±13* 113±15
LG 255±99* 92±29 165±19* 108±10
GCLM CB 225±90* 93±25 165±11* 104±16
LV 226±29* 118±24 164±16* 97±10
LG 204±82* 103±28 171±23* 109±11
NQO1 CB 339±122* 94±10 na na
LV 171±72* 101±13 na na
LG 147±41* 122±46 na na
HO-1 CB 167±23* 86±18 na na
LV 187±44* 114±46 na na
LG 245±89* 122±44 na na
Open in a new tab
*

P<0.05 compared with air control of 6 mo.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Competing Financial Interests:

The authors declare they have no actual or potential competing financial interests.

References

  1. Alam J, Stewart D, Touchard C, Boinapally S, Choi AM, Cook JL. Nrf2, a Cap'n'Collar transcription factor, regulates induction of the heme oxygenase-1 gene. J Biol Chem. 1999;274(37):26071–26078. doi: 10.1074/jbc.274.37.26071. [DOI] [PubMed] [Google Scholar]
  2. Araujo JA, Barajas B, Kleinman M, Wang X, Bennett BJ, Gong KW, et al. Ambient particulate pollutants in the ultrafine range promote early atherosclerosis and systemic oxidative stress. Circ Res. 2008;102(5):589–596. doi: 10.1161/CIRCRESAHA.107.164970. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Araujo JA, Nel AE. Particulate matter and atherosclerosis: role of particle size, composition and oxidative stress. Part Fibre Toxicol. 2009;6:24. doi: 10.1186/1743-8977-6-24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Block ML, Calderon-Garciduenas L. Air pollution: mechanisms of neuroinflammation and CNS disease. Trends Neurosci. 2009;32(9):506–516. doi: 10.1016/j.tins.2009.05.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bloom DA, Jaiswal AK. Phosphorylation of Nrf2 at Ser40 by protein kinase C in response to antioxidants leads to the release of Nrf2 from INrf2, but is not required for Nrf2 stabilization/accumulation in the nucleus and transcriptional activation of antioxidant response element-mediated NAD(P)H:quinone oxidoreductase-1 gene expression. J Biol Chem. 2003;278(45):44675–44682. doi: 10.1074/jbc.M307633200. [DOI] [PubMed] [Google Scholar]
  6. Calderon-Garciduenas L, Azzarelli B, Acuna H, Garcia R, Gambling TM, Osnaya N, et al. Air pollution and brain damage. Toxicol Pathol. 2002;30(3):373–389. doi: 10.1080/01926230252929954. [DOI] [PubMed] [Google Scholar]
  7. Calderon-Garciduenas L, Solt AC, Henriquez-Roldan C, Torres-Jardon R, Nuse B, Herritt L, et al. Long-term air pollution exposure is associated with neuroinflammation, an altered innate immune response, disruption of the blood-brain barrier, ultrafine particulate deposition, and accumulation of amyloid beta-42 and alpha-synuclein in children and young adults. Toxicol Pathol. 2008;36(2):289–310. doi: 10.1177/0192623307313011. [DOI] [PubMed] [Google Scholar]
  8. Campbell A, Araujo JA, Li H, Sioutas C, Kleinman M. Particulate matter induced enhancement of inflammatory markers in the brains of apolipoprotein E knockout mice. J Nanosci Nanotechnol. 2009;9(8):5099–5104. doi: 10.1166/jnn.2009.gr07. [DOI] [PubMed] [Google Scholar]
  9. Campbell A, Oldham M, Becaria A, Bondy SC, Meacher D, Sioutas C, et al. Particulate matter in polluted air may increase biomarkers of inflammation in mouse brain. Neurotoxicology. 2005;26(1):133–140. doi: 10.1016/j.neuro.2004.08.003. [DOI] [PubMed] [Google Scholar]
  10. Chung HY, Lee EK, Choi YJ, Kim JM, Kim DH, Zou Y, et al. Molecular Inflammation as an Underlying Mechanism of the Aging Process and Age-related Diseases. J Dent Res. 2011 Mar 29; doi: 10.1177/0022034510387794. [DOI] [PubMed] [Google Scholar]
  11. Cullinan SB, Zhang D, Hannink M, Arvisais E, Kaufman RJ, Diehl JA. Nrf2 is a direct PERK substrate and effector of PERK-dependent cell survival. Mol Cell Biol. 2003;23(20):7198–7209. doi: 10.1128/MCB.23.20.7198-7209.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Dhakshinamoorthy S, Jain AK, Bloom DA, Jaiswal AK. Bach1 competes with Nrf2 leading to negative regulation of the antioxidant response element (ARE)-mediated NAD(P)H:quinone oxidoreductase 1 gene expression and induction in response to antioxidants. J Biol Chem. 2005;280(17):16891–16900. doi: 10.1074/jbc.M500166200. [DOI] [PubMed] [Google Scholar]
  13. Finch CE, Pike MC. Maximum life span predictions from the Gompertz mortality model. J Gerontol A Biol Sci Med Sci. 1996;51(3):B183–B194. doi: 10.1093/gerona/51a.3.b183. [DOI] [PubMed] [Google Scholar]
  14. Flurkey KCJ, Harrison DE. The Mouse in Biomedical Research. 2 ed. Burlington, MA: Elsevier; 2007. [Google Scholar]
  15. Gil Del Valle L. Oxidative stress in aging: Theoretical outcomes and clinical evidences in humans. Biomed Pharmacother. 2010 doi: 10.1016/j.biopha.2010.09.010. [DOI] [PubMed] [Google Scholar]
  16. Giudice A, Arra C, Turco MC. Review of molecular mechanisms involved in the activation of the Nrf2-ARE signaling pathway by chemopreventive agents. Methods Mol Biol. 2010;647:37–74. doi: 10.1007/978-1-60761-738-9_3. [DOI] [PubMed] [Google Scholar]
  17. Gould NS, Min E, Gauthier S, Chu HW, Martin R, Day BJ. Aging adversely affects the cigarette smoke-induced glutathione adaptive response in the lung. Am J Respir Crit Care Med. 2010;182(9):1114–1122. doi: 10.1164/rccm.201003-0442OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Grimble RF. Inflammatory response in the elderly. Curr Opin Clin Nutr Metab Care. 2003;6(1):21–29. doi: 10.1097/00075197-200301000-00005. [DOI] [PubMed] [Google Scholar]
  19. Harman D. Role of free radicals in aging and disease. Ann N Y Acad Sci. 1992;673:126–141. doi: 10.1111/j.1749-6632.1992.tb27444.x. [DOI] [PubMed] [Google Scholar]
  20. Hur W, Gray NS. Small molecule modulators of antioxidant response pathway. Curr Opin Chem Biol. 2011;15(1):162–173. doi: 10.1016/j.cbpa.2010.12.009. [DOI] [PubMed] [Google Scholar]
  21. Itoh K, Chiba T, Takahashi S, Ishii T, Igarashi K, Katoh Y, et al. An Nrf2/small Maf heterodimer mediates the induction of phase II detoxifying enzyme genes through antioxidant response elements. Biochem Biophys Res Commun. 1997;236(2):313–322. doi: 10.1006/bbrc.1997.6943. [DOI] [PubMed] [Google Scholar]
  22. Itoh K, Ishii T, Wakabayashi N, Yamamoto M. Regulatory mechanisms of cellular response to oxidative stress. Free Radic Res. 1999;31(4):319–324. doi: 10.1080/10715769900300881. [DOI] [PubMed] [Google Scholar]
  23. Itoh K, Tong KI, Yamamoto M. Molecular mechanism activating Nrf2-Keap1 pathway in regulation of adaptive response to electrophiles. Free Radic Biol Med. 2004;36(10):1208–1213. doi: 10.1016/j.freeradbiomed.2004.02.075. [DOI] [PubMed] [Google Scholar]
  24. Jimenez E, Linares C, Martinez D, Diaz J. Role of Saharan dust in the relationship between particulate matter and short-term daily mortality among the elderly in Madrid (Spain) Sci Total Environ. 2010;408(23):5729–5736. doi: 10.1016/j.scitotenv.2010.08.049. [DOI] [PubMed] [Google Scholar]
  25. Jyrkkanen HK, Kuosmanen SM, Heinaniemi M, Laitinen H, Kansanen E, Mella-Aho E, et al. Novel insights into the regulation of the antioxidant response element mediated gene expression by electrophiles: induction of the transcriptional repressor BACH1 by NRF2. Biochem J. 2011 Aug 3; doi: 10.1042/BJ20110526. [DOI] [PubMed] [Google Scholar]
  26. Kaspar JW, Niture SK, Jaiswal AK. Nrf2:INrf2 (Keap1) signaling in oxidative stress. Free Radic Biol Med. 2009;47(9):1304–1309. doi: 10.1016/j.freeradbiomed.2009.07.035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Kitamuro T, Takahashi K, Ogawa K, Udono-Fujimori R, Takeda K, Furuyama K, et al. Bach1 functions as a hypoxia-inducible repressor for the heme oxygenase-1 gene in human cells. J Biol Chem. 2003;278(11):9125–9133. doi: 10.1074/jbc.M209939200. [DOI] [PubMed] [Google Scholar]
  28. Kleinman MT, Araujo JA, Nel A, Sioutas C, Campbell A, Cong PQ, et al. Inhaled ultrafine particulate matter affects CNS inflammatory processes and may act via MAP kinase signaling pathways. Toxicol Lett. 2008;178(2):127–130. doi: 10.1016/j.toxlet.2008.03.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Levy S, Forman HJ. C-Myc is a Nrf2-interacting protein that negatively regulates phase II genes through their electrophile responsive elements. IUBMB Life. 2010;62(3):237–246. doi: 10.1002/iub.314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Li M, Liu RM, Timblin CR, Meyer SG, Mossman BT, Fukagawa NK. Age affects ERK1/2 and NRF2 signaling in the regulation of GCLC expression. J Cell Physiol. 2006;206(2):518–525. doi: 10.1002/jcp.20496. [DOI] [PubMed] [Google Scholar]
  31. Li N, Sioutas C, Cho A, Schmitz D, Misra C, Sempf J, et al. Ultrafine particulate pollutants induce oxidative stress and mitochondrial damage. Environ Health Perspect. 2003;111(4):455–460. doi: 10.1289/ehp.6000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Li N, Venkatesan MI, Miguel A, Kaplan R, Gujuluva C, Alam J, et al. Induction of heme oxygenase-1 expression in macrophages by diesel exhaust particle chemicals and quinones via the antioxidant-responsive element. J Immunol. 2000;165(6):3393–3401. doi: 10.4049/jimmunol.165.6.3393. [DOI] [PubMed] [Google Scholar]
  33. Li N, Xia T, Nel AE. The role of oxidative stress in ambient particulate matter-induced lung diseases and its implications in the toxicity of engineered nanoparticles. Free Radic Biol Med. 2008;44(9):1689–1699. doi: 10.1016/j.freeradbiomed.2008.01.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Li R, Ning Z, Majumdar R, Cui J, Takabe W, Jen N, et al. Ultrafine particles from diesel vehicle emissions at different driving cycles induce differential vascular pro-inflammatory responses: implication of chemical components and NF-kappaB signaling. Part Fibre Toxicol. 2010;7:6. doi: 10.1186/1743-8977-7-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Liu H, Zhang H, Forman HJ. Silica induces macrophage cytokines through phosphatidylcholine-specific phospholipase C with hydrogen peroxide. Am J Respir Cell Mol Biol. 2007;36(5):594–599. doi: 10.1165/rcmb.2006-0297OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Liu J, Mori A. Stress, aging, and brain oxidative damage. Neurochem Res. 1999;24(11):1479–1497. doi: 10.1023/a:1022597010078. [DOI] [PubMed] [Google Scholar]
  37. Liu R, Choi J. Age-associated decline in gamma-glutamylcysteine synthetase gene expression in rats. Free Radic Biol Med. 2000;28(4):566–574. doi: 10.1016/s0891-5849(99)00269-5. [DOI] [PubMed] [Google Scholar]
  38. Meyer KC. The role of immunity and inflammation in lung senescence and susceptibility to infection in the elderly. Semin Respir Crit Care Med. 2010;31(5):561–574. doi: 10.1055/s-0030-1265897. [DOI] [PubMed] [Google Scholar]
  39. Misra CKS, Shen S, Sioutas C. A high flow rate, very low pressure drop impactor for inertial separation of ultrafine from accumulation mode particles. Journal of Aerosol Science. 2002;33:735–752. [Google Scholar]
  40. Moinova HR, Mulcahy RT. Up-regulation of the human gamma-glutamylcysteine synthetase regulatory subunit gene involves binding of Nrf-2 to an electrophile responsive element. Biochem Biophys Res Commun. 1999;261(3):661–668. doi: 10.1006/bbrc.1999.1109. [DOI] [PubMed] [Google Scholar]
  41. Morgan TE, Davis DA, Iwata N, Tanner JA, Snyder D, Ning Z, et al. Glutamatergic neurons in rodent models respond to nanoscale particulate urban air pollutants in vivo and in vitro. Environ Health Perspect. 2011;119(7):1003–1009. doi: 10.1289/ehp.1002973. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Mori K, Blackshear PE, Lobenhofer EK, Parker JS, Orzech DP, Roycroft JH, et al. Hepatic transcript levels for genes coding for enzymes associated with xenobiotic metabolism are altered with age. Toxicol Pathol. 2007;35(2):242–251. doi: 10.1080/01926230601156286. [DOI] [PubMed] [Google Scholar]
  43. Muhlfeld C, Rothen-Rutishauser B, Blank F, Vanhecke D, Ochs M, Gehr P. Interactions of nanoparticles with pulmonary structures and cellular responses. Am J Physiol Lung Cell Mol Physiol. 2008;294(5):L817–L829. doi: 10.1152/ajplung.00442.2007. [DOI] [PubMed] [Google Scholar]
  44. Nguyen T, Huang HC, Pickett CB. Transcriptional regulation of the antioxidant response element. Activation by Nrf2 and repression by MafK. J Biol Chem. 2000;275(20):15466–15473. doi: 10.1074/jbc.M000361200. [DOI] [PubMed] [Google Scholar]
  45. Ning Z, Geller MD, Moore KF, Sheesley R, Schauer JJ, Sioutas C. Daily variation in chemical characteristics of urban ultrafine aerosols and inference of their sources. Environ Sci Technol. 2007;41(17):6000–6006. doi: 10.1021/es070653g. [DOI] [PubMed] [Google Scholar]
  46. Oberdorster G, Oberdorster E, Oberdorster J. Nanotoxicology: an emerging discipline evolving from studies of ultrafine particles. Environ Health Perspect. 2005;113(7):823–839. doi: 10.1289/ehp.7339. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Osburn WO, Kensler TW. Nrf2 signaling: an adaptive response pathway for protection against environmental toxic insults. Mutat Res. 2008;659(1–2):31–39. doi: 10.1016/j.mrrev.2007.11.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Oyake T, Itoh K, Motohashi H, Hayashi N, Hoshino H, Nishizawa M, et al. Bach proteins belong to a novel family of BTB-basic leucine zipper transcription factors that interact with MafK and regulate transcription through the NF-E2 site. Mol Cell Biol. 1996;16(11):6083–6095. doi: 10.1128/mcb.16.11.6083. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Premasekharan G, Nguyen K, Contreras J, Ramon V, Leppert VJ, Forman HJ. Iron-mediated lipid peroxidation and lipid raft disruption in low-dose silica-induced macrophage cytokine production. Free Radic Biol Med. 2011;51(6):1184–1194. doi: 10.1016/j.freeradbiomed.2011.06.018. [DOI] [PubMed] [Google Scholar]
  50. Prescott GJ, Cohen GR, Elton RA, Fowkes FG, Agius RM. Urban air pollution and cardiopulmonary ill health: a 14.5 year time series study. Occup Environ Med. 1998;55(10):697–704. doi: 10.1136/oem.55.10.697. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Schwartz J. Air pollution and hospital admissions for respiratory disease. Epidemiology. 1996;7(1):20–28. doi: 10.1097/00001648-199601000-00005. [DOI] [PubMed] [Google Scholar]
  52. Prochaska HJ, De Long MJ, Talalay P. On the mechanisms of induction of cancer-protective enzymes: A unifying proposal. Proceedings National Academy of Sciences, USA. 1985;82:8232–8236. doi: 10.1073/pnas.82.23.8232. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Qian Z, He Q, Lin HM, Kong L, Zhou D, Liang S, et al. Part 2. Association of daily mortality with ambient air pollution, and effect modification by extremely high temperature in Wuhan, China. Res Rep Health Eff Inst. 2010;(154):91–217. [PubMed] [Google Scholar]
  54. Reichard JF, Motz GT, Puga A. Heme oxygenase-1 induction by NRF2 requires inactivation of the transcriptional repressor BACH1. Nucleic Acids Res. 2007;35(21):7074–7086. doi: 10.1093/nar/gkm638. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Risher JF, Todd GD, Meyer D, Zunker CL. The elderly as a sensitive population in environmental exposures: making the case. Rev Environ Contam Toxicol. 2010;207:95–157. doi: 10.1007/978-1-4419-6406-9_2. [DOI] [PubMed] [Google Scholar]
  56. Satoh T, Okamoto SI, Cui J, Watanabe Y, Furuta K, Suzuki M, et al. Activation of the Keap1/Nrf2 pathway for neuroprotection by electrophilic [correction of electrophillic] phase II inducers. Proc Natl Acad Sci U S A. 2006;103(3):768–773. doi: 10.1073/pnas.0505723102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Schmucker DL. Aging and drug disposition: an update. Pharmacol Rev. 1985;37(2):133–148. [PubMed] [Google Scholar]
  58. Klotz U. Pharmacokinetics and drug metabolism in the elderly. Drug Metab Rev. 2009;41(2):67–76. doi: 10.1080/03602530902722679. [DOI] [PubMed] [Google Scholar]
  59. Shan Y, Lambrecht RW, Ghaziani T, Donohue SE, Bonkovsky HL. Role of Bach-1 in regulation of heme oxygenase-1 in human liver cells: insights from studies with small interfering RNAS. J Biol Chem. 2004;279(50):51769–51774. doi: 10.1074/jbc.M409463200. [DOI] [PubMed] [Google Scholar]
  60. Shih PH, Yen GC. Differential expressions of antioxidant status in aging rats: the role of transcriptional factor Nrf2 and MAPK signaling pathway. Biogerontology. 2007;8(2):71–80. doi: 10.1007/s10522-006-9033-y. [DOI] [PubMed] [Google Scholar]
  61. Squadrito GL, Cueto R, Dellinger B, Pryor WA. Quinoid redox cycling as a mechanism for sustained free radical generation by inhaled airborne particulate matter. Free Radic Biol Med. 2001;31(9):1132–1138. doi: 10.1016/s0891-5849(01)00703-1. [DOI] [PubMed] [Google Scholar]
  62. Stone V, Johnston H, Clift MJ. Air pollution, ultrafine and nanoparticle toxicology: cellular and molecular interactions. IEEE Trans Nanobioscience. 2007;6(4):331–340. doi: 10.1109/tnb.2007.909005. [DOI] [PubMed] [Google Scholar]
  63. Suh JH, Shenvi SV, Dixon BM, Liu H, Jaiswal AK, Liu RM, et al. Decline in transcriptional activity of Nrf2 causes age-related loss of glutathione synthesis, which is reversible with lipoic acid. Proc Natl Acad Sci U S A. 2004;101(10):3381–3386. doi: 10.1073/pnas.0400282101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Sun J, Brand M, Zenke Y, Tashiro S, Groudine M, Igarashi K. Heme regulates the dynamic exchange of Bach1 and NF-E2-related factors in the Maf transcription factor network. Proc Natl Acad Sci USA. 2004;101(6):1461–1466. doi: 10.1073/pnas.0308083100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Sun J, Hoshino H, Takaku K, Nakajima O, Muto A, Suzuki H, et al. Hemoprotein Bach1 regulates enhancer availability of heme oxygenase-1 gene. EMBO J. 2002;21(19):5216–5224. doi: 10.1093/emboj/cdf516. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Tan Y, Ichikawa T, Li J, Si Q, Yang H, Chen X, et al. Diabetic downregulation of Nrf2 activity via ERK contributes to oxidative stress-induced insulin resistance in cardiac cells in vitro and in vivo. Diabetes. 2011;60(2):625–633. doi: 10.2337/db10-1164. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Venugopal R, Jaiswal AK. Nrf1 and Nrf2 positively and c-Fos and Fra1 negatively regulate the human antioxidant response element-mediated expression of NAD(P)H:quinone oxidoreductase1 gene. Proc Natl Acad Sci USA. 1996;93(25):14960–14965. doi: 10.1073/pnas.93.25.14960. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Wang H, Liu H, Liu RM. Gender difference in glutathione metabolism during aging in mice. Exp Gerontol. 2003;38(5):507–517. doi: 10.1016/s0531-5565(03)00036-6. [DOI] [PubMed] [Google Scholar]
  69. Warnatz HJ, Schmidt D, Manke T, Piccini I, Sultan M, Borodina T, et al. The BTB and CNC homology 1 (BACH1) target genes are involved in the oxidative stress response and in control of the cell cycle. J Biol Chem. 2011;286(26):23521–23532. doi: 10.1074/jbc.M111.220178. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Weiskopf D, Weinberger B, Grubeck-Loebenstein B. The aging of the immune system. Transpl Int. 2009;22(11):1041–1050. doi: 10.1111/j.1432-2277.2009.00927.x. [DOI] [PubMed] [Google Scholar]
  71. Wild AC, Moinova HR, Mulcahy RT. Regulation of gamma-glutamylcysteine synthetase subunit gene expression by the transcription factor Nrf2. J Biol Chem. 1999;274(47):33627–33636. doi: 10.1074/jbc.274.47.33627. [DOI] [PubMed] [Google Scholar]
  72. Wild AC, Mulcahy RT. Regulation of gamma-glutamylcysteine synthetase subunit gene expression: insights into transcriptional control of antioxidant defenses. Free Radic Res. 2000;32(4):281–301. doi: 10.1080/10715760000300291. [DOI] [PubMed] [Google Scholar]
  73. Xia T, Kovochich M, Brant J, Hotze M, Sempf J, Oberley T, et al. Comparison of the abilities of ambient and manufactured nanoparticles to induce cellular toxicity according to an oxidative stress paradigm. Nano Lett. 2006;6(8):1794–1807. doi: 10.1021/nl061025k. [DOI] [PubMed] [Google Scholar]
  74. Xu X, Liu C, Xu Z, Tzan K, Zhong M, Wang A, et al. Long-Term Exposure to Ambient Fine Particulate Pollution Induces Insulin Resistance and Mitochondrial Alteration in Adipose Tissue. Toxicol Sci. 2011 Aug 27; doi: 10.1093/toxsci/kfr211. [DOI] [PMC free article] [PubMed] [Google Scholar]
  75. Zhang H, Court N, Forman HJ. Submicromolar concentrations of 4-hydroxynonenal induce glutamate cysteine ligase expression in HBE1 cells. Redox Rep. 2007;12(1):101–106. doi: 10.1179/135100007X162266. [DOI] [PMC free article] [PubMed] [Google Scholar]
  76. Zhang H, Dickinson DA, Liu RM, Forman HJ. 4-Hydroxynonenal increases gamma-glutamyl transpeptidase gene expression through mitogen-activated protein kinase pathways. Free Radic Biol Med. 2005;38(4):463–471. doi: 10.1016/j.freeradbiomed.2004.10.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  77. Zhang H, Forman HJ. Acrolein induces heme oxygenase-1 through PKC-delta and PI3K in human bronchial epithelial cells. Am J Respir Cell Mol Biol. 2008;38(4):483–490. doi: 10.1165/rcmb.2007-0260OC. [DOI] [PubMed] [Google Scholar]

RESOURCES