Abstract
Separate aminoacyl transfer centers related to the small …GUNNN..: NNNU ribozyme seem possible at the frequent GU sequences dispersed throughout an RNA tertiary structure. In fact, such activity is easily detected and varies more than 2 orders in rate, probabably being faster at sites with less structural constraint. Analysis of a particular constrained active site in an rRNA transcript suggests that its difficulty lies not in substrate strand association, but in binding and/or group transfer from the aminoacyl precursor. Efficient aminoacyl transfer requires accurate complementarity between large or small ribozymes and oligoribonucleotide substrates, even when only three or four base pairs link the two. Thus, multi-site active ribozymal superstructures might have coordinated an RNA metabolism, including aiding an early translation apparatus.
Keywords: adenylate, aminoacylation, enzyme, oligonucleotide, rRNA
Introduction
Significance of RNA-RNA interactions
There is now much evidence in support of the emergence of coded protein biosynthesis (translation) from the activities of small RNAs, without apparent need for other kinds of catalysts.1 A principal role for RNA activities may also extend to an even earlier time in evolution, that of the first replicators.2 A rationale for such versatility includes the fact that RNA and ribozymes are inherently well-suited for active associations; only small complementary tracts within different RNA molecules need be dedicated to interactions that encode a specific composite RNA structure.
An experimental demonstration of this aptitude can be based on the trans-aminoacylating ribozyme:substrate GUGGC:GCCU.3-5 Here a ribozymic aminoacyl transfer center can potentially be created from very abundant elements: wherever the frequent dinucleotide 5′ GU 3′ occurs in a larger RNA. That is, only a 5′ GU sequence in the ribozyme and the 3′ U of the substrate are true active site nucleotides.3 Other nucleotides serve only to juxtapose the ribozyme with its oligonucleotide substrate by base pairing.3 Therefore, wherever a 5′ ..GUNNN.. 3′ potential ribozyme sequence appears and a 5′..NNNU substrate is supplied in trans (N is complementary to N) a potential ribozyme exists.
Results
Observing the activity: model active centers
To model the behavior of predicted RNA reaction centers within a larger structure, we tested the GUGGC:GCCU aminoacylation reaction (Fig. 1, 1). We constructed ribozymes of increasing length under varied, but simple, structural constraint on a central ribozyme sequence (Fig. 1, 2–7). Figure 1 plots apparent total second order rate constants (based on total oligonucleotide substrate concentration) for the aminoacyl transfer reaction between PheAMP and RNA at pH 7 and 4°, corrected for hydrolytic decay of the PheAMP substrate. Structures for the ribozyme strand at the top were drawn by BayesFold.6 The apparent second order rates shown (± standard error of the mean, sem) potentially reflect both chemical effects (e.g., on RNA reactivity) and effects on ribozyme-substrate affinity (strand and PheAMP associations).
Figure 1. Effect of ribozyme structure Reactions #1 through #7: synthetic oligonucleotides create the ribozyme sequence GUGGC (potentially reactive with the substrate GCCU) in different structural contexts. Red nucleotides at the top are active center, blue nucleotides function in substrate pairing. Apparent second order rate constants (with standard error of the mean, sem, bars) for total aminoacyl-RNA synthesis3,5are presented after correction for PheAMP decay and background at 4° and pH 7.
Figure 1 displays one complication when internal GU sequences of larger RNAs are utilized as ribozymes. The aminoacyl transfer reaction is fastest with short ribozymes (at the top of Figure 1, active site nt are red, substrate pairing sequences are blue). Addition of one additional 5′ and 3′ nucleotide to GUGGC ribozyme to make a 7-mer has no significant effect on aminoacylation velocity (Fig. 1, sequence 2). However, reaction velocity declines markedly as the sequence containing GUGGC is lengthened to 11 nucleotides with possible internal structure (3). Aminoacyl transfer is slower yet and sensitive to small differences in structure when the ribozyme sequence is within a potential hairpin loop (4–7). For example, activity declines progressively when the hairpin is closed with 3, 4 or 5 potential pairs (4–6), presumably reflecting a parallel decline in the frequency of the looped ribozyme’s active configuration. As a further example of reactivity closely tracking structure; while maintaining a potential 5 pair helix, reactivity increases when the loop flanking the ribozyme is opened from 7 to 11 nucleotides (sequence 7 vs. 6).
Thus, though total aminoacylation slows 30-fold with increased loop constraint from surrounding sequences, activity remains detectable. In fact, aminoacylated product accumulation appears to be a sensitive monitor of structure at the site of the ribozyme, perhaps usable for this purpose in other experiments. Accordingly, these results suggest that higher order structure within larger RNAs is a likely complication, but observable reactions are consistent with measureable catalysis at a substantial fraction of ..GU.. sites within a larger RNA.
Centers within a large RNA
To observe reactions within larger RNA directly we employed three nested transcribed fragments based on the sequence of E. coli 23S rRNA domain IV. rRNA transcripts 251, 366, and 1076 nucleotides long are shown in their canonical ribosomal fold7 in Figure 2, and in enlarged detail in Figures S1 and S2. These potential ribozyme-containing transcripts are nested; rRNA251 overlaps the 5′ section of rRNA1076, and rRNA366 overlaps the 3′ of the large rRNA1076 transcript. Complementary 5-mer RNA substrates were supplied for GUNNNN sequences at various positions marked by red arrowheads (standard E. coli rRNA numbering shown in black in Fig. 2).7

Figure 2. Fragments of 23S rRNA. Complementary oligonucleotide reactions are compared with reactions using transcripts based on fragments of E. coli 23S RNA (termini are shown as black triangles) incubated with complementary substrate ribopentamers. The standard nucleotide position of the G in each potential rRNA GUNNNN ribozyme is indicated by a red triangle in panel A. The large potential ribozymic transcripts are named for their sizes; that is, rRNA1076 is the long transcript containing all rRNA sites, nominally 1076 nucleotides long.
Panel A of Figure 3 shows that the initial products, where a larger RNA transcript is incubated with UCCCU oligonucleotide substrate (S1022) and PheAMP, resemble those previously discussed. That is, phe-oligoRNA and short peptidyl-oligoRNAs4 are produced. As might also be anticipated, the large transcript (here rRNA251) is the ribozyme, required for extensive aminoacyl transfer to UCCCU.
Figure 3. Reactions of the rRNA transcripts compared with oligonucleotide reactions. (A) Dependence of reaction on rRNA transcript ribozyme. Products of rRNA fragment rRNA251 incubated with [32P]UCCCU and PheAMP (60 min, 4°) parallel those characterized before.4 (B)Apparent second order rate constants for reaction between oligonucleotide ribozymes or rRNA transcripts and oligonucleotide substrates are shown (with sem shown at the top), grouped by oligonucleotide substrate: left-to-right - S1022, S1112, S1930 and S1945. In each set of four, the left-hand point is the small complementary oligonucleotide ribozyme. R1022 is the minimal complementary oligonucleotide ribozyme for S1022, then rRNA251, rRNA366 and rRNA1076, the corresponding larger transcripts shown in Figure 2, follow in each sub-panel. Rates are in excess of uncatalyzed acylation background (0.06 ± 0.006 M−1 min−1, mean ± sem; 7 measurements), whose rate has been subtracted. Expanded drawings of the rRNA loci are shown in Supplementary Figures.
Several such GU centers in these rRNA transcripts (Figs. 2 and 3) were detectably active, though apparent rate constants relative to unhindered small oligonucleotide ribozymes containing the same sequences (leftward point in each group, Fig. 3B) were lowered by 75- to 500-fold, presumably with faster reactions presumably reflecting lesser local structural constraint in the large ribozyme.
Active ribozymic sites in rRNA transcripts approach the velocities of the simple structured models in Figure 1; the best showed about 3-fold lower reactivity than the small GUGGC ribozyme constrained in a 7-membered hairpin loop (compare Fig. 1, 6 and Fig. 3B, S1022). However, activity measured at rRNA sites ranges down to barely above the spontaneous acylation background (lowest in Fig. 3B). The penalty paid for a complex ribozyme structure need not continuously increase with ribozyme size. That is, transcripts rRNA 251 and rRNA366 are both nested within the 1076 nucleotide rRNA, which covers all potential reaction sites (Fig. 2). As comparisons of apparent rate constants for the smaller rRNA and larger rRNA in Figure 3B show, reactivity in all cases is similar for the smaller and larger rRNA transcripts containing the same sites (middle, Fig. 3B). Thus structural inhibition is determined locally, by sequences within a few hundred nucleotides of the active center. This is somewhat reminiscent of Figure 1, where the loop structure penalty is roughly the same for all potential hairpins.
Thus, multiple GU…. aminoacyl transfer sites appear to be observable in a larger RNA, though there are reactive, probably favorably structured sites as well as those that appear unreactive, probably less favorably structured, ranging down to sites with experimentally insignificant activity.
Selectivity of small oligonucleotide substrates among oligonucleotide ribozymes
Our discussion thus far, however, implicitly assumes that action of a substrate ribooligonucleotide can be attributed to its complementary site sequence within a large RNA, though it associates via only three or four nucleotide pairs. One might question the selectivity of such a limited interaction.
To test specificity, a set of parallel reactions for all smaller oligonucleotides is shown in Figure 4, where all pairwise combinations of these 6-mer ribozymes and 5-mer substrates are tested. A credible paired ribozyme-substrate structure is shown above each gel lane. Each lane exhibits a dominant band of 5′ [32P]substrate oligonucleotide at the bottom (fastest-moving) position. Such unacylated substrate is the only substantial band in each leftward lane from each set of five, serving as a control, always incubated without ribozyme.
Figure 4. Reactions of substrate oligonucleotides (Snnnn) with ribozyme oligonucleotides (Rnnnn). All combinations of hexanucleotide ribozymes and pentanucleotide substrates are incubated. Above the lanes are plausible structures, shown linked to the relevant gel lanes containing the cognate reaction products, shown after fractionation on a 10% acrylamide acid gel.
The other four lanes of each set, ranged to the right of the no enzyme control, represent incubations that contained all reactants: ribozyme, oligonucleotide substrate and PheAMP. Each lane containing products is linked by a line to the relevant co-structure above. Significant product formation (bands migrating slower than 32P substrate) is not observed unless the oligonucleotide ribozyme is complementary to the oligonucleotide substrate, and aminoacylated products are observed for all completely complementary combinations.
The most interesting case is that of S1945 (substrates are denoted SNNNN) and R1112 (potential ribozymes are RNNNN; lower right, Fig. 4) where even three G-C pairs proximal to active site nucleotides do not yield observed activity. However, the similar combination (upper right), S1112 and R1945, which has the same three active-site-proximal nucleotide pairs but stacks G on each strand, is partially active. This latter example is the only activity observed among partially cognate pairs—its activity is understandable in light of successful ribozyme reactions in combinations capable of only three G-C base pairs (eg, as shown in Fig. 1 and in refs. 4 and 5). Lack of product for three base pairs at lower right may be due to self-pairing in the ribozyme, or other destabilizing factors. However, in every case the aminoacylation reaction requires a complementary ribozyme:substrate sequence adjacent to the GU of the active center.
Selectivity of small oligonucleotides acting within a large RNA
However, we also wish to use small ribozymes imbedded in large RNAs. These may pose a more rigorous challenge to specificity, in that such reactions offer the full variety of an RNA tertiary structure for unexpected oligonucleotide substrate interactions. These data are in Figure 3B, where each set of four measurements for a given oligonucleotide substrate includes a larger rRNA ribozyme control that contains no normal complementary ribozyme sequence. For each substrate oligonucleotide, the non-complementary combination yields the lowest activity (bottom, Fig. 3B).
S1022 and S1112 are complementary to the 5′ region of rRNA251 and rRNA1076 transcripts (Fig. 2A). S1930 and S1945 are complementary only to the 3′ region of the rRNA, as found in rRNA366 and rRNA1076 transcripts. These apparent rate constants are measured against a background of aminoacylation at a spontaneous rate of 0.06 ± 0.006 M−1 min−1, which has been subtracted. Three of four non-complementary combinations show insignificant reaction over this background. The fourth is slowed to about 6% reactivity (relative to potentially complementary rRNA251). This may in fact be at a slower, partially complementary site (rRNA366 is shown in Fig. S2). Thus every oligonucleotide is most reactive by far with rRNA transcripts containing its complementary site.
Complete deletion of sites in a large RNA
Finally, both exact complements for UCCCU substrate (S1022; Fig. S1) were removed from a large transcript (based on rRNA1076) by mutagenesis (and the sequences were confirmed by sequencing). With no complementary site for the substrate S1022, reactivity with UCCCU and PheAMP subsequently fell to background values (like the lowest in Fig. 3B, but data not shown). Thus, in both 6-mer (Fig. 4) and the largest transcribed ribozymes (Fig. 3B), aminoacyl transfer activity predominantly occurs at sites predicted from simple base pairing of the NNNN of a GUNNNN potential ribozyme sequence.
Canonical measurements of large RNA activity
We wished to compare ribozymic sites of identical sequence in a large and small RNA, measuring standard Michaelis-Menten quantities. We therefore prepared a mutated form of rRNA251 (nucleotide changes G1036C, G1037A: confirmed by sequencing; see Fig. S1) that has only one site complementary to 5′ UCCCU 3′ (the looped site in Fig. S1). The mutated rRNA transcript (single potential ribozyme at nt 1022, Fig. S1) and oligonucleotide R1022, GUGGGA ribozyme were then compared by measuring aminoacyl transfer velocities under [UCCCU] and [PheAMP] variation.5 Michaelis-Menten behavior was usually observed, and implications of this analysis are shown in Table 1, where calculated underlying kcat and KM and their standard errors (calculated from a bi bi ordered mechanism,5 see Methods) are given.
Table 1. Aminoacylation of UCCCU by single-site rRNA and GUGGGA.
| System | kcat min−1 | KM,S μM | KM,PheAMP mM | kcat/KM,PheAMP M−1 min−1 | |
|---|---|---|---|---|---|
| UCCCU:GUGGGA |
0.13 ± 0.009 |
5.8 ± 2.8 |
1.2 ± 0.6 |
107 ± 50 |
Ratio kcat/KM,PheAMP |
| UCCCU:rRNA | - | 0.32 ± 0.06 | - | 0.56 ± 0.04 | 190 ± 90 |
At pH 7.0 and 4° in 0.35 M Hepes, 100 mM KCl, 20 mM MgCl2. kcat is the first-order rate for aminoacyl transfer in UCCCU:GUGGGA:PheAMP, KM,S is the Michaelis constant for pairing of ribozyme and oligoribonucleotide substrate sequences, KM,PheAMP is the Michaelis constant for pairing of preassembled UCCCU:GUGGGA with PheAMP.
The kinetic constants for the small oligonucleotide ribozyme resemble those of the prototype oligonucleotide ribozyme, GCCU:GUGGC, already published,5 though KM,PheAMP is lower for this complex. In contrast, the larger rRNA ribozyme could not be saturated with the largest practical concentrations of PheAMP. In this, the only experimental exception to Michaelis-Menten behavior; velocity with the single-site rRNA transcript increased linearly with [PheAMP]. Therefore, we compare kcat/KM for PheAMP with the same enzymatic constant for the smaller, fully-characterized UCCCU/GUGGGA system. As indicated in the rightmost column of the Table 1, the large RNA’s active site is hindered by about two orders with respect to the same site formed by minimal oligonucleotides, in approximate agreement with less complete measurements of apparent second order rate constants above.
Moreover, interaction between the active site in the large ribozyme and UCCCU oligonucleotide substrate appears sound, or perhaps even superior (lower KM,S), conceivably due to preconfiguration of the ribozyme sequence for substrate oligonucleotide pairing. Accordingly, here inhibition by RNA structure appears not at all in the RNA:RNA interaction, but selectively as inhibition of interaction with PheAMP or inhibition of rapid aminoacyl transfer, or both (lowered kcat/KM, PheAMP).
Discussion
Aminoacyl-RNA synthesis from adenylates is a long-recognized capability of pure small RNAs.8 These data show that tiny GUGGC-like aminoacylation centers could be collected in permissively structured regions of a larger RNA. More generally, such collective ribozymes could participate in a larger translation apparatus, as modeled here by aminoacyl-RNA production at widely-separated rRNA loci.
This might be of evolutionary interest because ribozymes can elaborate active quaternary structures at relatively small evolutionary cost; that is, such structures could appear under small selection pressures. For example, such complexes seem ideal for substrate and product channeling along electrostatic pathways, formed by exploiting the highly anionic RNA backbone. Electrostatic channeling likely carries a charged intermediate 40 Å between the active sites of dihydrofolate reductase and thymidylate synthetase.9 Similar channeling might speed reactions attending the cationic amino group of carboxyl-activated amino acids, the latter being probable reactants during the RNA origins of translation.1
Strikingly, these ribooligomers usually show efficient aminoacyl transfer only when a complementary ribozyme is available. To be precise, these data (Figs. 3B and 4) show ribozyme activity (including substrate binding) at μM strand concentrations (compare Methods), where few mistaken reaction sites are utilized. We are accustomed to significant triplet-triplet interactions on tRNAs,10 dependent on the special structural context of an anticodon hairpin.11 However, the present data are a reminder that free, linear triplets and quadruplets display biochemically useful affinities and specificities. Thus, we emphasize the possible biochemical utility of such triplets and quadruplets: it appears that ribozymes always have an intrinsic, specific enzyme-substrate interaction available for any molecule that can be covalently linked to a three or four-nucleotide cofactor. Because both ribozyme assembly and acquisition of substrates requires only three or four nucleotide pairs, a metabolic network of ribozyme reactions linked by short oligomers, specifically deploying even reactants that do not intrinsically interact well with RNA, seems readily conceivable.
Materials and Methods
Aminoacylation reactions
rRNA-like transcripts were heated to 65° for 3′ and slow cooled to room temperature in the presence of reaction buffer. Then substrate RNA was added and incubated for another 15′. This solution was transferred to 4° and the reaction was initiated by the addition of PheAMP. Timed samples were removed and quenched in acidic loading dye and dry ice.
Acylation of different composed oligonucleotide structures
Aminoacylation conditions were: 100 mM Hepes, pH 7.0, 100 mM KCl and 100 mM NaCl, 5 mM MgCl2 and 5 mM CaCl2, 4°, 1.5 mM PheAMP, ribozyme 16.3 μM, substrate 0.83 μM.
Acylation of oligonucleotides by rRNA transcripts
Aminoacylation conditions were: 350 mM Hepes, pH 7.0, 100 mM KCl, 20 mM MgCl2, 8 mM PheAMP, 0.8–1.2 μM ribozyme, approximately 0.2 μM substrate, pH 7 and 4°. High buffer concentrations are required to prevent pH decrease at elevated PheAMP concentrations, when it is varied.
UCCCU and PheAMP variation with single-site rRNA ribozyme gave leastsquares values (± standard errors) of kcat/KM)appPheAMP = 0.331 ± 0.008 M−1 min−1 (reaction linear in [PheAMP] at all practical concentrations), KappM,S = 3.2 ± 0.7 × 10−6 M and kappcat,S = 0.054 ± 0.007 min−1. These observed quantities were used to calculate tabulated values, which are the underlying values characteristic of the mechanism (see Kinetic Analysis, below).
Acylation of pentamer oligonucleotide substrates with hexamer oligonucleotide enzymes
Aminoacylation conditions were: 350 mM Hepes, pH 7.0, 100 mM KCl, 20 mM MgCl2, 8.6 mM PheAMP, 0.8 μM ribozyme, 0.1 μM substrate, 2 min at pH 7 and 4°.
Quantitative acylation velocities for UCCCU
UCCCU was varied to 10.1 μM in the presence of 0.46 μM rRNA transcript, 9.4 mM PheAMP at 4°. PheAMP was varied to 15.2 mM in the presence of 0.46 μM rRNA transcript and 0.1 μM UCCCU. UCCCU was varied to 10 μM in the presence of 0.46 μM GUGGGA and 7.1 mM PheAMP. PheAMP was varied to 15.2 mM in the presence of 0.46 μM GUGGGA and 0.1 μM UCCCU.
Values from leastsquares Eadie-Hofstee plots (± standard errors) used to derive tabulated values were KappM, PheAMP = 11.4 ± 1.4 mM, kcat = 0.13 ± 0.009 min−1, KappM,S = 8.3 ± 0.7 × 10−7 M, kappcat,S = 0.11 ± 0.004 min−1.
Gel analysis of reactions
Reaction samples were analyzed in 12% PAGE, 6 M Urea, 0.1M sodium acetate, pH 5.2 gels (40 cm) for about 16 h at 4°. Gels were dried and analyzed with a Bio-Rad Molecular phosphorimager.
Kinetic analysis
“Apparent rates” are approximate second order rate constants (k below; units of M−1 min−1) based on ribozyme-substrate oligonucleotide assembly that is assumed to be complete, and PheAMP concentrations assumed to decay3 at 0.024 min−1.
The rate constant giving the best least squares error at several times (product based on acid gel phosphorimages) is quoted. Hydrolytic decay of PheAMP substrate was compensated by analyzing all kinetics vs. a decay-corrected time, tcorr:
where kdecay was 0.024 min−1.
For complete Michaelis-Menten analysis, a bisubstrate ordered mechanism is used:
![]() |
where total transfer of Phe to UCCCU is measured and the three underlying kinetic constants are from apparent quantities (and their standard errors) from Eadie-Hofstee plots5 of velocity at six different initial concentrations of UCCCU or PheAMP. Using the superscript “apparent” to imply experimental values from separate Eadie-Hofstee plots where [UCCCU] (at 7.1 mM PheAMP) and [PheAMP] (at 0.1 μM UCCCU) are varied (at 0.46 μM GUGGGA):
![]() |
and true kcat is that observed on saturation with PheAMP.
rRNA partial transcripts
rRNA fragments were generated by synthesizing cDNA to E. coli rRNA as follows: 0.1 μg/μl of E. coli total RNA (Invitrogen), 0.7 μM 3′ DNA oligo (either TACCCAACAACGCATAAGC for rRNA251 or TTCACTGAGTCTCGGGTGGAGACAGC for rRNA366 and rRNA1076), 1 mM each dNTP, 2U/μl RnaseOut (Invitrogen), 1U/μl AMV Reverse Transcriptase (Life Sciences, Inc.) and buffer provided by the company.
For preparation of PCR DNA, DNA oligos TAATACGACTCACTATAGGAGACACACGGCGGGTGC (T7 promoter in bold italics), TACCCAACAACGCATAAGC and corresponding cDNA was used for rRNA251; TAATACGACTCACTATAGAGAGAACTCGGGTGAAGGA, TTCACTGAGTCTCGGGTGGAGACAGC with cDNA366 for rRNA366; and TAATACGACTCACTATAGGAGACACACGGCGGGTGC, TTCACTGAGTCTCGGGTGGAGACAGC with cDNA366 for rRNA1076. T7 transcripts of rRNA251, rRNA366 and rRNA1076 were synthesized using above PCR DNA and all RNAs were PAGE purified.
Mutated rRNA
Mutagenized rRNA1037 was prepared similarly, except that DNA oligos TAATAC GACTCACTATAG AAA CAA CCC AGA CCG CCA GCT AAG GTC CCA AAG TCA TGG TTA AGT CAG AAA CG A TGT CAG AAG GC and TTCACTGAGTCTCGGGTGGAGACAGC (mutated nucleotides are in bold, underlined) with cDNA366 was used to make PCR DNA. This transcript has no complementary sites for S1022. RNA transcripts that have single mutation were prepared by using DNA oligos—either TAATAC GACTCACTATAGAAA CAA CCC AGA CCG CCA GCT AAG GTC CCA AAG TCA TGG TTA AGT GGG AAA CG A TGT CAG AAG GC or TAA TAC GAC TCA CTA TAG AAA CAA CCC AGA CCG CCA GCT AAG GTC CCA AAG TCA TGG TTA AGT CAG AAA CG A TG .
Oligonucleotides
All small RNAs were synthesized by Dharmacon (Thermo Fisher).
Other operations
Synthesis of PheAmp has been described.8 Substrate RNAs were labeled at the 5′ end using T4 Polynucleotide Kinase4 (New England Biolabs) and PAGE purified in 15% denaturing gel. Excised RNA was extracted in water, filtered [Costar Spinex Centrifuge Tube filter (0.22 μm cellulose acetate)] and lyophilized to dryness (2–3 h).
Supplementary Material
Supplementary PDF file supplied by authors.
Footnotes
Previously published online: www.landesbioscience.com/journals/rnabiology/article/18039
References
- 1.Yarus M. On translation by RNAs alone. Cold Spring Harb Symp Quant Biol. 2001;66:207–15. doi: 10.1101/sqb.2001.66.207. [DOI] [PubMed] [Google Scholar]
- 2.Yarus M. Getting past the RNA world: the Initial Darwinian Ancestor. Cold Spring Harb Perspect Biol. 2011;3 doi: 10.1101/cshperspect.a003590. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Chumachenko NV, Novikov Y, Yarus M. Rapid and simple ribozymic aminoacylation using three conserved nucleotides. J Am Chem Soc. 2009;131:5257–63. doi: 10.1021/ja809419f. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Turk RM, Chumachenko NV, Yarus M. Multiple translational products from a five-nucleotide ribozyme. Proc Natl Acad Sci USA. 2010;107:4585–9. doi: 10.1073/pnas.0912895107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Turk RM, Illangasekare M, Yarus M. Catalyzed and spontaneous reactions on ribozyme ribose. J Am Chem Soc. 2011;133:6044–50. doi: 10.1021/ja200275h. [DOI] [PubMed] [Google Scholar]
- 6.Knight R, Birmingham A, Yarus M. BayesFold: rational secondary folds that combine thermodynamic, covariation, and chemical data for aligned RNA sequences. RNA. 2004;10:1323–36. doi: 10.1261/rna.5168504. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Cannone JJ, Subramanian S, Schnare MN, Collett D’Souza LM, Du Y, et al. The comparative RNA web (CRW) site: an online database of comparative sequence and structure information for ribosomal, intron, and other RNAs. BMC Bioinformatics. 2002;3:JR. 2. doi: 10.1186/1471-2105-3-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Illangasekare M, Sanchez G, Nickles T, Yarus M. Aminoacyl-RNA synthesis catalyzed by an RNA. Science. 1995;267:643–7. doi: 10.1126/science.7530860. [DOI] [PubMed] [Google Scholar]
- 9.Miles EW, Rhee S, Davies DR. The molecular basis of substrate channeling. J Biol Chem. 1999;274:12193–6. doi: 10.1074/jbc.274.18.12193. [DOI] [PubMed] [Google Scholar]
- 10.Uhlenbeck OC. Complementary oligonucleotide binding to transfer RNA. J Mol Biol. 1972;65:25–41. doi: 10.1016/0022-2836(72)90489-5. [DOI] [PubMed] [Google Scholar]
- 11.Romby P, Giege R, Houssier C, Grosjean H. Anticodon-anticodon interactions in solution. Studies of the self-association of yeast or Escherichia coli tRNAAsp and of their interactions with Escherichia coli tRNAVal. J Mol Biol. 1985;184:107–18. doi: 10.1016/0022-2836(85)90047-6. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Supplementary PDF file supplied by authors.





