Abstract
Species-specific simple sequence repeat (SSR) markers are favored for genetic studies and marker-assisted selection (MAS) breeding for oil palm genetic improvement. This report characterizes 20 SSR markers from an Elaeis oleifera genomic library (gSSR). Characterization of the repeat type in 2000 sequences revealed a high percentage of di-nucleotides (63.6%), followed by tri-nucleotides (24.2%). Primer pairs were successfully designed for 394 of the E. oleifera gSSRs. Subsequent analysis showed the ability of the 20 selected E. oleifera gSSR markers to reveal genetic diversity in the genus Elaeis. The average Polymorphism Information Content (PIC) value for the SSRs was 0.402, with the tri-repeats showing the highest average PIC (0.626). Low values of observed heterozygosity (Ho) (0.164) and highly positive fixation indices (Fis) in the E. oleifera germplasm collection, compared to the E. guineensis, indicated an excess of homozygosity in E. oleifera. The transferability of the markers to closely related palms, Elaeis guineensis, Cocos nucifera and ornamental palms is also reported. Sequencing the amplicons of three selected E. oleifera gSSRs across both species and palm taxa revealed variations in the repeat-units. The study showed the potential of E. oleifera gSSR markers to reveal genetic diversity in the genus Elaeis. The markers are also a valuable genetic resource for studying E. oleifera and other genus in the Arecaceae family.
Keywords: simple sequence repeat (SSR), Elaeis oleifera, genomic library, transferability
1. Introduction
Elaeis oleifera is a species in the oil palm genus along with the commercial Elaeis guineensis and occurs naturally in South-Central America, from Honduras to Colombia and in the Amazon region [1]. This American species is seen as a promising genetic resource for oil palm improvement and is currently used in oil palm hybrid (E. guineensis × E. oleifera) breeding programs. It has attracted the attention of breeders by reason of several interesting agronomic traits: low height increment, resistance to Fusarium wilt and lethal yellowing [2], which can have important economic implications if introgressed into E. guineensis. Beside the agronomic traits, the oil from E. oleifera is highly unsaturated (i.e., high iodine value, or IV) with high linoleic and oleic acids, low palmitic acid and high carotene [3]. A genomic in situ hybridization technique (GISH) using specific DNA probes to distinguish oleifera and guineensis chromosomes has been developed to assist hybrid backcross breeding programs [4].
In plant genetics and breeding studies, DNA-based assays, and especially molecular markers, are known to be efficient tools for genetic diversity assessment, molecular ecology studies, gene mapping as well as marker-assisted selection (MAS) [5]. Among all the available molecular markers, simple sequence repeats (SSR) are still among the most favored, due to their many desirable attributes, which include hypervariability, wide genomic distribution, co-dominant inheritance, a multi-allelic nature and chromosome specific location. In addition, they are easily assayed using PCR [6]. Currently, SSRs also appear to be the most promising molecular marker systems for understanding oil palm population genetic structure [7]. Furthermore, SSR markers which are highly transferable across taxa are advantageous as they save time and cost in developing SSR markers for members of taxa that have not been extensively studied. These SSR markers are also useful tools for comparative genetic studies within the genus. In oil palm, E. guineensis-based SSR markers have been used to construct genetic maps [8,9], and are also actively used to characterize germplasm collections [1].
The Malaysian Palm Oil Board (MPOB) has an extensive collection of germplasm from both species of oil palm. E. guineensis from Africa and E. oleifera maintained as ex-situ collections in Kluang, Johor, Malaysia. Assessing the performance and genetic diversity of the wild material is important for understanding the genetic structure of natural oil palm populations. Furthermore, the information is important for oil palm breeding programs, and also for continued ex-situ conservation of the germplasm in Malaysia. Currently, only the E. guineensis germplasm is well characterized, using various types of molecular markers, such as isozymes [10], restriction fragment length polymorphisms (RFLPs) [11], amplified fragment length polymorphism (AFLP) [12], random amplified polymorphic DNA (RAPD) [13] and SSRs [7,14]. However, the work on E. oleifera has been limited, only involving RAPD [15] and SSR markers developed from E. guineensis [14,16]. Nevertheless, the increasing number of sequence collections available for E. oleifera has made it possible to develop SSR markers from E. oleifera and utilize them to understand the genetics of the species.
Thus, the objectives of this study were to (a) develop and characterize E. oleifera genomic SSR markers from a collection of E. oleifera genomic sequences; (b) evaluate the efficiency of these markers in assessing the genetic diversity in the MPOB E. oleifera germplasm collection; and (c) determine the transferability of E. oleifera SSR markers among selected palm genera and taxa.
2. Results and Discussion
2.1. Characterization of E. oleifera Genomic SSRs
The GeneThresher™ library is a comprehensive collection of gene sequences of oil palm obtained from sequencing of the hypomethylated region of the oil palm genome using methylation filtration technology [17]. As such, the sequences are likely to be located within or close to the genic regions in oil palm. The clear advantage is that the SSR locus may point to a gene of interest and show high levels of polymorphism associated with being genomic-based SSR markers. Of the 2000 E. oleifera GeneThresher™ derived sequences used in this study, 1861 non-redundant sequences (1735 singleton and 126 consensus) were successfully assembled with CAP3 sequence assembly software [18]. A total of 603 SSRs were identified in 472 genomic sequences, suggesting the E. oleifera genomic library is a valuable resource for this genetic marker type.
One hundred and four (22%) of the genomic sequences contained more than one SSR. Mononucleotides were the most abundant repeat type (437 = 72.4%), and showed a strong bias to the A/T repeat-motifs (97.9%) over the C/G repeat motif (Table 1). Feng et al. [5] reported that mononucleotides were generally not very informative and thus were not considered for analysis in this study. With the omission of mononucleotides, the most prevalent repeats were di-nucleotides (63.3%), followed by tri-nucleotides (24.2%), tetra-nucleotides (6%), penta-nucleotides (4.8%), hexa-nucleotides (0.6%) and 1.2% of the hepta-nucleotides. Among the di-nucleotide repeats, the AG/CT (46.7%) and AT/AT motifs (43.8%) were by far the most common, while AC/GT was present in low abundance (9.5%). The abundance of the AG/CT motif has consistently been reported in EST sequences from E. guineensis [7,19,14], peach [20], coffee [21] and rubber [5]. AG/CT SSR may have a higher probability of being linked to important traits [22], based on report by Morgante et al. [23], highlighting the frequent occurrence of this di-repeat motif in the 5′ flanking regions of genes in plants. The two most common tri-nucleotide motifs were AAG/CTT (50%) and AAT/ATT (25%) followed by AGG/CCT (17.5%), AAC/GTT (5%) and ACC/GGT (2.5%). The abundance of the AAG/CTT tri-repeat motif in E. oleifera is similar to that reported for E. guineensis EST-SRR [7,14,19], Arabidopsis thaliana [24], soybean [25], barley [26] as well as coffee [27]. The most abundant tetra- and penta-nucleotide repeat-motifs were AAAT/ATTT and AAAAG/CTTTT at a frequency of 40% and 50%, respectively.
Table 1.
Frequency and distribution of SSRs in 2000 Elaeis oleifera genomic sequences.
| SSR Motif | Number of Repeat Units | Total | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | >15 | ||
| Mononucleotide | |||||||||||||
| A/T | - | - | - | - | - | 101 | 78 | 60 | 37 | 29 | 28 | 95 | 428 |
| C/G | - | - | - | - | - | 2 | 3 | - | 1 | - | - | 3 | 9 |
| Di-nucleotide | |||||||||||||
| AC/GT | - | - | 4 | 2 | 1 | 2 | 1 | - | - | - | - | 10 | |
| AG/CT | - | - | 7 | 8 | 7 | 3 | 9 | 1 | 1 | 6 | 2 | 5 | 49 |
| AT/AT | - | - | 6 | 5 | 5 | 6 | 6 | 2 | 2 | - | 2 | 12 | 46 |
| Tri-nucleotide | |||||||||||||
| AAC/GTT | - | 2 | - | - | - | - | - | - | - | - | - | - | 2 |
| AAG/CTT | 9 | 4 | 3 | - | 1 | 1 | 1 | 1 | - | - | - | 20 | |
| AAT/ATT | 1 | 3 | 2 | 1 | - | 1 | 1 | 1 | - | - | - | 10 | |
| ACC/GGT | - | 1 | - | - | - | - | - | - | - | - | - | - | 1 |
| AGG/CCT | 5 | 2 | - | - | - | - | - | - | - | - | - | - | 7 |
| Tetra-nucleotide | |||||||||||||
| AAAC/GTTT | - | - | - | 1 | - | - | - | - | - | - | - | - | 1 |
| AAAG/CTTT | 1 | - | - | - | - | - | - | - | - | - | - | 1 | |
| AAAT/ATTT | 1 | 3 | - | - | - | - | - | - | - | - | - | 4 | |
| AATT/AATT | - | 1 | - | - | - | - | - | - | - | - | - | 1 | |
| ACAT/ATGT | - | - | - | 1 | - | 1 | - | - | - | - | - | - | 2 |
| AGCT/ATCG | 1 | - | - | - | - | - | - | - | - | - | - | - | 1 |
| Penta-nucleotide | |||||||||||||
| AAAAG/CTTTT | 3 | 1 | - | - | - | - | - | - | - | - | - | - | 4 |
| AAAAT/ATTTT | 3 | - | - | - | - | - | - | - | - | - | - | - | 3 |
| AGGGG/CCCCT | 1 | - | - | - | - | - | - | - | - | - | - | - | 1 |
| Hexa-nucleotide | |||||||||||||
| AGAGGG/CCCTCT | 1 | - | - | - | - | - | - | - | - | - | - | - | 1 |
| Hepta-nukleotide | |||||||||||||
| AAACCCT/ATTTGGG | - | - | - | - | - | - | - | - | - | - | - | 2 | 2 |
| N (Mono-) | - | - | - | - | - | 103 | 81 | 60 | 38 | 29 | 28 | 99 | 437 |
| NN (Di-) | - | - | 17 | 15 | 13 | 11 | 15 | 4 | 3 | 6 | 4 | 17 | 105 |
| NNN (Tri-) | 15 | 12 | 5 | 1 | 1 | 1 | 1 | 2 | 2 | - | - | - | 40 |
| NNNN (Tetra-) | 3 | 4 | - | 2 | - | 1 | - | - | - | - | - | - | 10 |
| NNNNN (Penta-) | 7 | 1 | - | - | - | - | - | - | - | - | - | - | 8 |
| NNNNNN (Heksa-) | 1 | - | - | - | - | - | - | - | - | - | - | - | 1 |
| NNNNNNN(Hepta-) | - | - | - | - | - | - | - | - | - | - | - | 2 | 2 |
| Total | 603 | ||||||||||||
2.2. Primers Designed for E. oleifera gSSR
With exclusion of the 437 mononucleotide repeats, attempts were made to design primer pairs for the 166 identified SSRs. Primer pairs were successfully designed for 144 SSRs (86.7%), of which 63.9% were di-repeats, 24.3% tri-repeats, 4.9% tetra and penta-repeats each, 0.7% hexa-repeats and 1.4% hepta-repeats. The failure to design primers for the remaining sequences (13.3%) was probably due to short (or absence of) flanking regions, or that the sequences submitted did not correspond to the minimum criteria required by the primer design software [7]. Nevertheless, the success rate is high compared to previous work on genomic SSRs of wheat [28] and Sorghum [29], where the success rates were only 51% to 66%. Subsequently, 20 of the 144 E. oleifera-based gSSR primer pairs (Table 2), representing a variety of motifs (di- to penta-repeats) were randomly selected to analyze samples from the oil palm germplasm collection.
Table 2.
Information on the E. oleifera gSSR markers used for germplasm analysis and cross- transferability evaluation.
| Primer ID | Primer Sequence (5′-3′) (F: Forward; R: Reverse) | SSR Motif | Ta (°C) | Amplicon (bp) | Accession No. (ProbeDB) | Allele No. | PIC |
|---|---|---|---|---|---|---|---|
| Di-nucleotide | |||||||
| sMo00018 | F: TTAAATGAGAGAGAGACGAGGAC R: TGGAGCCATGAGAAAGAGTA |
(CT)14 | 54 | 246 | Pr009947963 | 6 | 0.555 |
| sMo00020 | F: CCTTTCTCTCCCTCTCCTTTTG R: CCTCCCTCCCTCTCACCATA |
(AG)15 | 58 | 190 | Pr009947964 | 12 | 0.824 |
| sMo00024 | F: TCACCAAAGCAGAAGAAACA R: GGTGTTGATAATTGCCTGAA |
(AT)28 | 54 | 223 | Pr010315683 | - | - |
| sMo00027 | F: TTACAGTTGAGGCAGTATGTCAAT R: CTGTATGTCAAACCTTCTGCAC |
(TC)14 | 50 | 209 | Pr009947965 | 6 | 0.574 |
| sMo00055 | F: GGCATTTCAGATAACGACAAA R: GCACCCAAGTCTCTCTACCTC |
(GA)11 | 54 | 202 | Pr010315684 | 5 | 0.243 |
| sMo00108 | F: AGCTTCAATTCATACGCAAC R: TGTTATATGTGACTACCAGAGCA |
(AT)19 | 53 | 170 | Pr010315685 | 1 | 0 |
| Mean | 6.0 | 0.549 | |||||
| Tri-nucleotide | |||||||
| sMo00127 | F: GTGGTTTGGGAGAAAGAGTGT R: TGCGGTGGATTAGCATTATT |
(GAA)12 | 56 | 205 | Pr010315686 | - | - |
| sMo00128 | F: TAGCTCCAACAGCTTGCCTTAT R: GGTCCCGTCCTATGATTTATTCT |
(AAT)12 | 56 | 192 | Pr009947966 | 6 | 0.654 |
| sMo00129 | F: TTAGTATTGGGTGTGCATAAGTGG R: GCTTCCAGCTCCTCTTTCTACC |
(TTC)13 | 56 | 229 | Pr009947967 | 8 | 0.786 |
| sMo00130 | F: TAAGCAAAAGATCAGGGCACTC R: GGCTGGTGAAAATAGGTTTACAAAG |
(AAG)11 | 56 | 192 | Pr009947968 | 13 | 0.801 |
| sMo00132 | F: ATAGCCAGAGGGCAAAACTGT R: GCAACACACGGACTCAAAACTA |
(TTA)13 | 56 | 161 | Pr009947969 | 4 | 0.264 |
| Mean | 7.8 | 0.626 | |||||
| Tetra-nucleotide | |||||||
| sMo00134 | F: TCCCAATAGTCGTTACAAACCAG R: GATTAGCAAAAGGGCAAAAAGG |
(ATTA)6 | 56 | 252 | Pr009947970 | 2 | 0.338 |
| sMo00137 | F: AGGAAGGAGAAGGAGATGAACAG R: CTTTGGATTTGAGCAGAGGAAG |
(AAAT)6 | 54 | 151 | Pr010315687 | 3 | 0.141 |
| Mean | 2.5 | 0.240 | |||||
| Penta-nucleotide | |||||||
| sMo00138 | F: AGGGTTGTCGCTCCAATTTAT R: GGCATCTTTTTGACCTGTAGAAG |
(TTTTC)6 | 56 | 190 | Pr009947971 | 5 | 0.498 |
| sMo00140 | F: TTAGATCATTTCCCTTGCTTCG R: CGCTGGTCCTGATAACACATT |
(AAAAT)5 | 56 | 216 | Pr010315688 | 1 | 0 |
| sMo00141 | F: ACTTGACATACAGGTTCCACTGA R: CCTGCTACCTCCTAATTCTATCAAA |
(TTCTT)5 | 56 | 174 | Pr010317029 | 2 | 0.218 |
| sMo00147 | F: TACCCAATCCCACCGAGTTA R: CGTCTCCACTGAACCACAAAA |
(AAAAG)5 | 54 | 240 | Pr010317030 | 3 | 0.225 |
| Mean | 2.75 | 0.314 | |||||
| Compound | |||||||
| sMo00152 | F: GGAACAGAGGACAAGAAAGAAA R: TGTATCAAGCCTCAAGTATCTGG |
(AC)6(AG)11 | 56 | 255 | Pr009947972 | 3 | 0.209 |
| sMo00154 | F: CAAAAGGGTTGTTTGTATACGTG R: TGCATGAATATCCTCTCAAAGTTAC |
(TG)7cgcgcgtgtgcgcgtg(TA)8 | 54 | 161 | Pr010317031 | 8 | 0.349 |
| sMo00161 | F: ACTGTTTCGTCAAGCATTTG R: ATCAAGAGAAGGTCGTGTCAG |
(TG)8(AG)8 | 54 | 163 | Pr010317032 | 1 | 0 |
| Mean | 4.0 | 0.279 | |||||
2.3. Germplasm Characterization: Allelic Polymorphism and Genetic Variation in E. oleifera and E. guineensis
To ascertain the attributes of the E. oleifera-based gSSR markers in characterizing E. oleifera germplasm, 20 primer pairs (markers) were tested on a panel of 119 E. oleifera palms from the germplasm collection. Ten E. guineensis from the Nigerian collection and another 10 from the MPOB advanced breeding material population (Deli dura) were included for comparison. This allowed the study to also determine the ability of the E. oleifera-derived SSR markers to reveal the genetic diversity in the Deli dura material which had undergone several cycles of self-pollination, and also the wild Nigerian materials. This provenance is reported to be the center of diversity for E. guineensis [11].
Eighteen of the 20 primers successfully produced amplicons (Table 2), and 15 of the 18 primers (83.3%) reveal polymorphisms in at least one of the collections analyzed. The remaining three, sMo00108, sMo00140 and sMo00161 were monomorphic in all the samples tested. The high level of detected polymorphism (83.3%) shows the ability of E. oleifera gSSR markers to amplify the target sequences and detect polymorphism in both Elaeis palms.
The E. oleifera gSSRs detected 89 alleles, ranging from 1 to 13 across the Elaeis samples. Of them (alleles), 48.3% and 31.5% of alleles were specific to E. oleifera and E. guineensis, respectively, and 20.2% common in both species. Within the repeats, tri-nucleotides detected more alleles (mean = 7.8 alleles) than the other repeats. It would appear that the tri-nucleotide genomic SSRs show higher average PIC values than di-nucleotide repeats. This is most likely a reflection of the specific region of the genome targeted by the methylation filtration technique. Botstein et al. [30] defined any locus (marker) with PIC > 0.5 as highly polymorphic. All the loci derived from the di- and tri-repeat gSSRs met this criterion, except sMo00055 and sMo00132. This shows that both the repeat types are generally informative in the samples analyzed. However, the mean PIC (0.402) from this study was slightly lower than that previously reported for E. guineensis-derived EST-SSRs (7, mean = 0.53; and 14, mean = 0.65) which were used mainly to analyze E. guineensis germplasm.
Interestingly, the ability of E. oleifera-derived gSSRs to reveal allelic polymorphism and genetic diversity in the Elaeis genus was more efficient than by other tested marker systems. For instance, E. oleifera gSSRs generated more alleles (Ao) in both Elaeis species (means = 2.27–2.66; Table 3), compared to RFLP [11] and isozyme [10,31], which generated Ao < 2.0. Furthermore, the efficiency of the oleifera genomic SSRs in revealing heterozygosity was distinctively higher (mean He = 0.273) than in previous studies on E. guineensis using isozymes (He = 0.184, 10), RFLP (He = 0.135, 15; He = 0.199, 11) and AFLP (He = 0.117, 15).
Table 3.
Summary of observed allele numbers (Ao), percentage polymorphic loci (P), observed and expected heterozygosity (Ho and He) and (Fis) for 14 loci across six oil palm populations.
| Country | N | Ao | P (%) | Ho(SD) | He(SD) | Fis |
|---|---|---|---|---|---|---|
| E. oleifera | ||||||
| Colombia | 29 | 2.56 | 50.0 | 0.200 (0.263) | 0.275 (0.325) | 0.273 * |
| Costa Rica | 34 | 3.00 | 55.6 | 0.160 (0.223) | 0.253 (0.316) | 0.368 * |
| Panama | 34 | 2.89 | 55.6 | 0.193 (0.264) | 0.310 (0.325) | 0.377 * |
| Honduras | 22 | 2.17 | 50.0 | 0.102 (0.197) | 0.210 (0.260) | 0.514 * |
| Mean | 2.66 | 52.8 | 0.164 (0.238) | 0.262 (0.307) | 0.383 | |
| E. guineensis | ||||||
| Deli dura | 10 | 2.07 | 44.4 | 0.118 (0.171) | 0.260 (0.282) | 0.546 * |
| Nigeria | 10 | 2.47 | 50.0 | 0.321 (0.362) | 0.329 (0.305) | 0.024 |
| Mean | 2.27 | 47.2 | 0.220 (0.267) | 0.295 (0.294) | 0.285 | |
P = Percentage of polymorphic loci (0.95 criterion); Fis = Inbreeding coefficient (Wright’s 1965: 1- [Ho/He]).
significant deviation from HWE at P <0.01.
By focusing only on analysis carried out on E. oleifera collections, He revealed by E. oleifera SSR markers (0.262) was slightly lower than those generated by E. guineensis EST-SSR markers (14; He = 0.286). As such, E. oleifera gSSR markers are also additional promising tools for characterizing E. oleifera collections, although the Ao and He values are lower than those generated by E. guineensis gSSRs (16; Ao = 0.535 and He = 0.69). The differences revealed by both the genomic SSR markers were possibly due to the number of samples analyzed and populations evaluated. Billotte et al. [16] analyzed 21 E. oleifera samples (1–2 samples per country), whereas 119 E. oleifera samples (22–34 samples per country) were analyzed in this study. Furthermore, the genomic library utilized in this study was constructed from hypo-methylated regions, the chances of the employed E. oleifera gSSR markers being closely located within the conserved coding regions are higher than in the sequences obtained from a conventional genomic library. This could also explain the lower diversity observed in this study.
Regarding the genetic variation between the two Elaeis species, the heterozygosity in the E. oleifera germplasm varied from 0.102 to 0.200 (mean Ho = 0.164), while E. guineensis generated Ho from 0.118 (Deli dura) to 0.321 (Nigeria) (mean Ho = 0.220). E. oleifera generally had lower diversity, compared to E. guineensis, with higher Ho revealed by the Colombian and Panama palms (Ho = 0.200; Ho = 0.193 respectively). The higher Ho in both collections could be due to human assisted movement of palm samples that was probably accelerated during and subsequent to construction of the Panama Canal in 1914. Some palms could have been brought in from other South American countries, widening the genetic base of E. oleifera in these countries. Furthermore, the He value obtained for E. oleifera (mean = 0.262) was comparable to those obtained by RFLP (He = 0.225) and AFLP (He = 0.298) analyses in screening 241 E. oleifera accessions [15]. Among E. guineensis, He for the Nigerian samples (0.329) was lower than that obtained with E. guineensis EST-SSR markers [7,14], where the reported He values were 0.442 and 0.534 respectively.
The Fis values were positive at all loci in all tested collections with mean Fis ranging from 0.024 (Nigeria) to 0.546 (Deli dura) (Table 3). This reflects the differences in the prospecting areas for the germplasm. The E. guineensis germplasm was collected over widespread areas in Africa, resulting in more heterogeneous collections compared to E. oleifera, which were mostly from scattered isolated populations across four South-Central American countries [32]. This may have encouraged inbreeding, resulting in a relatively homozygous genome for the E. oleifera collections. Furthermore, the extremely high Fis in Deli dura populations compared to the Nigerian and other E. oleifera germplasm supported the low level of genetic diversity of this advanced breeding population which had undergone several cycles of selfing. This also explains the low genetic diversity of Deli dura population (mean He = 0.260) generated by E. oleifera gSSR markers in this study, which was even lower than that revealed by E. guineensis EST-SSR markers (14; mean He = 0.340).
2.4. Genetic Relationship of the Genus Elaeis
The 18 informative E. oleifera genomic SSRs described in this study successfully grouped the six collections of oil palm into two distinct clusters: E. oleifera and E. guineensis (Figure 1). In general, the clusters supported the origins and geographical distributions of the palms, E. oleifera from Latin America and E. guineensis from Africa. Within E. oleifera, the collections from Costa Rica and Panama showed a very close relationship. This is not surprising as Costa Rica and Panama are neighboring countries. The collection from Honduras also fell into the same cluster as Costa Rica and Panama, again probably due to the close proximity of Honduras to Costa Rica and Panama. The collections from Colombia were clearly separate from the other three collections from Central America.
Figure 1.
Unweighted pair group with arithmetic mean (UPGMA) dendrogram reflecting genetic relationship among the Elaeis genus revealed by 18 Elaeis oleifera gSSR markers.
2.5. Cross-Transferability of E. oleifera gSSR Markers
Eleven of the E. oleifera gSSR markers produced clear and prominent banding profiles in both E. guineensis and E. oleifera. These markers were further used to evaluate cross species/genera transferability in the Arecaceae taxa (Table 4). Successful amplification (transferability) of either similar or varying sized fragments was obtained with all the primers in the coconut palms and in at least one of the tested ornamental palms species. As such, the E. oleifera gSSR markers showed 100% transferability to E. guineensis and, more importantly, also perfect (100%) transferability in the tested Cocos nucifera samples. With the ornamental palms, the frequencies of transferability were Euterpe (72.7%) > Oenocarpus (63.6%) > Jessinia (54.5%) > Ptychosperma (54.5%) > Dictyosperma (45.5%) > Cyrtostachys (45.5%). Two markers: sMo00055 (di-repeats) and sMo00137 (penta-repeats), generated clear banding profiles of various sizes in all the samples analyzed, including the ornamental palms.
Table 4.
Cross amplification of E. oleifera gSSR primers in various palm (Arecaceae) species.
| Genus | Elaeis | Cocos | Oenocarpus | Euterpe | Jessenia | Ptychosperma | Cyrtostachys | Dictyosperma | |||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Species | oleifera | guineensis | Nucifera | multicaulis-Spruce | oleracea | bataua | Macarthurii | renda Blume | album | ||||
| SSR locus | Colombia | Costa Rica | Nigeria | Deli dura | Cocos nucifera (Yellow) | Cocos nucifera (Red) | Cocos nucifera (Green) | Oenocarpus multicaulis-Spruce | Euterpe oleracea | Jessenia bataua | Ptychosperma Macarthurii | Cyrtostachys renda Blume | Dictyosperma album |
| sMo00020 | 191 | 200 | 184 | 190 | 210 | 218 | 219 | - | NA | NA | 188 | NA | NA |
| sMo00027 | 212 | 210 | 200 | 200 | 300 | 300 | 300 | 226 | 226 | 224 | NA | 260 | 200 |
| sMo00055 | 200 | 200 | 188 | 188 | 195 | 195 | 195 | 190 | 190 | 190 | 190 | 190 | 190 |
| sMo00129 | 222 | 230 | 204 | 204 | 178 | 178 | 178 | 180 | NA | NA | NA | NA | NA |
| sMo00130 | 192 | 192 | 176 | 184 | 176 | 176 | 176 | 188 | 188 | 188 | - | 208 | 184 |
| sMo00134 | 252 | 252–260 | 252 | 252 | 252–260 | 252–260 | 252–260 | - | 252–260 | - | 252–260 | - | - |
| sMo00137 | 151 | 151 | 154–162 | 162 | 140 | 138 | 140 | 150 | 140 | 151 | 142 | 146 | 142 |
| sMo00138 | 190–206 | 200 | 184–198 | 198 | 208 | 218 | 208 | - | - | NA | 186 | NA | NA |
| sMo00140 | 214 | 214 | 204 | 204 | 184 | 184 | 184 | 204 | 204 | - | - | - | 204 |
| sMo00141 | 176 | 176 | 250–260 | 250–260 | 176 | 176 | 176 | NA | 260 | 260 | NA | NA | NA |
| sMo00154 | 160 | 160 | 238 | 232 | 160 | 160 | 160 | 160 | 160 | 160 | 160 | 160 | NA |
Figures given are base pair size of fragments: Missing sample; NA, not amplifiable/banding pattern not clear.
SSR primers developed for one species are known to often detect homologous sites in related species. The ability of sMo00055 and sMo00137 markers to amplify fragments with similar sizes indicates their efficiency in revealing sequence conservation among the species in the Arecaceae family. In general, cross species transferability differs highly among taxa, especially in flowering plants [33]. The transferability across related species and genus facilitates comparative genetic studies [34]. The successful rate of transfer for SSR has been reported to average 76.4% at the genus level and 35.2% at the family level [35]. The success rate for E. oleifera SSRs averaged 75% at the genus level, comparable to Phyllostachys Pubescens (75.3%), but lower than rice (90%) [36]. Furthermore, all the tested Elaeis-derived gSSR markers were able to amplify PCR products in Cocos, reflecting their capability in characterizing the three different Cocos samples tested. This also suggests the relatively close proximity of E. oleifera to coconut. The high cross-transferability of E. oleifera gSSR markers to Elaeis species and related genera suggests the potential application of these markers in comparative studies across members of the Arecaceae family. High cross-species conservation of SSR loci within genus has also been reported for Olea [37], Picea [38] and Pinus [39].
2.6. Sequence Variability and Molecular Basis of E. oleifera gSSR Markers Fragment Length Polymorphism
Three markers comprising various repeat types (sMo00055/di-repeat, sMo00137/tetra-repeat and sMo00138/penta-repeat) were used to determine the sequence variability in some of the species in Arecaceae family (E. oleifera, E. guinensis, Cocos nucifera, Jessinia bataua and Oenocarpus multicaulis). Amplified PCR fragments of these markers in selected individuals were cloned and sequenced. The amplicons of the three SSR markers were successfully cloned and sequenced. The sequences were aligned with the original sequence from which the primers were designed (Figure 2). In general, sMo00137 gave the highest sequence similarity among the samples analyzed, followed by sMo00138. sMo00055 showed the lowest similarity with highest number of bases interrupted in the flanking region.
Figure 2.
ClustalW alignments of sequences obtained from PCR bands amplified by the E. oleifera gSSR markers (a) sMo00055; (b) sMo00137; and (c) sMo00138 in E. oleifera, E. guineensis, C. nucifera, Jessinia bataua and Oenocarpus multicaulis. Missing data refers to amplicons that were not successfully cloned.
Generally, the sequence data generated by the three selected E. oleifera gSSR loci (sMo00055, sMo00137 and sMo00138) revealed variable numbers of repeat motifs in the SSR regions within the tested samples. This further explains the primary basis of the observed fragment length polymorphism in the Arecaceae family screened in this study. The variations were mainly due to changes in the number of repeat motifs in the SSR region, combined with indels and base substitutions. Similar results were reported by Billotte et al. [16] and Ting et al. [14] who employed E. guineensis SSR and EST-SSR markers, respectively. However, looking specifically at sMo000555, the repeat motif observed in E. oleifera was missing in E. guineensis, and the repeat number was very low in coconut and one of the ornamental palms. Although this locus was successfully amplified in all samples, the lack of repeat conservation in some samples suggests that the amplified fragments may not represent functional SSRs in those species. Nevertheless, the ability of E. oleifera genomic SSRs (sMo00137 and sMo00138) to reveal high inter-species and inter-genera transferability (>90%) supports the close phylogenetic relationship between the species and genera.
3. Experimental Section
3.1. Plant Materials and gSSR Source
The oil palm germplasm collections used in this study are maintained at the MPOB Research Station, Kluang, Johor. A total 149 spear leaves (one per palm) were harvested from the palms in Table 5. Cross-transferability of the E. oleifera gSSR was tested on three coconut (Cocos nucifera) samples and six ornamental palms (Euterpe oleracea, Jessinia bataua, Oenocarpus multicaulis, Ptychosperma macarthurii, Cyrtostachys renda and Dictyosperma album). Genomic DNA was extracted and purified from each spear leaf using the modified CTAB method described by Doyle and Doyle [40]. The E. oleifera genomic library was constructed using GeneThresher™ Technology (17) and the genomic clones and sequences stored at MPOB’s Biological Resource Centre (MBRC).
Table 5.
Palms (family Arecaceae) analyzed using Elaeis oleifera gSSR markers.
| Genus | Species | Full Name | Origin | No. of Palms |
|---|---|---|---|---|
| Elaeis | Oleifera | Elaeis oleifera | Colombia | 29 |
| Costa Rica | 34 | |||
| Panama | 34 | |||
| Honduras | 22 | |||
| Sub-total | 119 | |||
| Elaeis | guineensis | Elaeis guineensis | Nigeria | 10 |
| Deli dura | 10 | |||
| Sub-total | 20 | |||
| Cocos | Nucifera | Cocos nucifera | Solomon Islands | 3 |
| Euterpe | Oleracea | Euterpe oleracea | South America | 2 |
| Jessenia | Bataua | Jessenia bataua | Mart. South America | 1 |
| Oenocarpus | multicaulis-spruce | Oenocarpus multicaulis Spruce | North-western South America, | 1 |
| Ptychosperma | macarthurii | Ptychosperma macarthurii | Northeastern Australia | 1 |
| Cyrtostachys | renda Blume | Cyrtostachys renda Blume | Malaysia, Indonesia | 1 |
| Dictyosperma | Album | Dictyosperma album | Mauritius | 1 |
| Sub-total | 10 | |||
| Total | 149 |
3.2. SSR Identification and Primer Design
A total of 2000 E. oleifera genomic sequences were assembled using the CAP3 assembly program [18] with default parameters. The file containing the sequences was submitted in a FASTA formatted text file. Identification and localization of the SSR markers were performed using MISA software as described by Thiel et al. [26]. The search criteria were: mononucleotides ≥10 repeat units, di-nucleotides ≥7 repeat units and tri-, tetra-, penta- and hexa-nucleotides ≥5 repeat units respectively. Interrupted compound SSRs were also selected where the interval bases interrupting two SSRs were ≤10 repeat units. The relative frequency and distribution of the repeat types in the genomic sequences were estimated. Primer pairs were designed flanking the identified SSRs using PRIMER 3 [41]; all the primers were synthesized by Invitrogen ™ USA.
3.3. SSR Analysis
The forward primer was 5′ end-labeled in 1 μL reaction containing 4.5 μM forward primer, 0.1 μL γ-33p dATP (GE Healthcare Biosciences, UK, 3000Ci/mmol) and 1U T4 polynucleotide kinase (Invitrogen™ USA) for 1 hour at 37 °C. The PCR reaction was subsequently carried out in 10 μL of 1 μL 10X PCR buffer (buffer composition-MgCl2), 15 mM MgCl2, 1 mM dNTPs, 5 μM unlabeled reverse primer, 1 μL labeled forward primer, 0.5 U Taq DNA polymerase and 50 ng template DNA. PCR was performed in a Perkin Elmer 9600 thermocycler as follows: denaturation at 95 °C for 3 min, 35 cycles at 95 °C for 30 s, 52–56 °C for 30 s (depending on the primers requirement), 72 °C for 30 s and a final extension at 72 °C for 5 min. The PCR reaction was stopped by addition of 10 μL formamide dye (0.3% bromophenol blue, 0.3% xylene cyanol, 10 mM EDTA pH 8.0, 97.5% deionized formamide). A total 5 μL of the mixture was denatured at 90 °C for 3 min, chilled on ice, and separated in a 6.0% polyacrylamide gel containing 7 M urea in 0.5 X TBE buffer at constant power of 1600V for 3 hours. The gel was then dried and exposed to X-ray film (Kodak) for 3–4 days at −80 °C. The size of each allele was determined using the 100–330 bp AFLP DNA ladder (Invitrogen™ USA).
3.4. Data Analysis
Only fragments that could be clearly scored were used in the data analysis. The genotyped data were analyzed using POPGENE version 1.32 [42]. The genetic diversity parameters analyzed for included: percentage of polymorphic loci (0.95 criterion) (P), expected and observed heterozygosity (He and Ho) in the collections used and fixation indices (Fis). Chi squared tests were performed for each locus for deviation of the genotypes from the Hardy-Weinberg equilibrium (HWE). The allelic polymorphism information content (PIC) for each gSSR marker and distance matrix [43] between the populations were calculated using the PowerMarker V3.25 software [44]. The unweighted pair-group method with arithmetic averaging (UPGMA) [45] dendrogram was constructed from the distance matrix [43] imported from PowerMarker V3.25 using MEGA4 [46].
3.5. Cross-Transferability Amplification
Eleven E. oleifera gSSR markers that produced clear banding profiles in both E. guineensis and E. oleifera samples were further used to study cross species and genus amplification within Arecaceae family. The markers were tested against three Cocos nucifera varieties and six ornamental palms (Table 5). The SSR analysis, as described above, was carried out at least twice to confirm the transferability of the primers.
3.6. Sequencing of Cloned SSR-PCR Products for Alignment and Phenetic Analysis
The amplicons generated by three selected E. oleifera gSSR markers (sMo00055, sMo00137 and sMo00138) in the E. oleifera, E. guineensis, Cocos nucifera, Jessinia bataua and Oenocarpus multicaulis samples were excised from the agarose gel and purified. The purified fragments were cloned into pCR2.1-TOPO vector (TOPO TA cloning kit, Invitrogen™ USA) and sequenced using the ABI PRISM 377 automated DNA sequencer. The sequences were aligned and compared using CLUSTALW multiple sequence alignment tool employing BIOEDIT sequence alignment editor version 7.0.0 [47]. The sequences were also compared to the original genomic sequence containing the SSR.
4. Conclusions
A set of E. oleifera gSSR markers developed were found to be valuable genetic resources for understanding the genetic diversity of E. oleifera and E. guineensis. The study indicates that E. oleifera-derived SSR markers were more efficient in revealing the genetic diversity of E. oleifera than E. guineensis EST-SSR markers. The sequence data showed their ability to amplify DNA, not only in the two oil palm species, but also in coconut and other selected ornamental palms, thus verifying the ability of SSRs to amplify across species and genera in the Arecaceae family. Furthermore, the variability in allele sizes and sequences among the species reflected the mutational processes that had taken place at both the repeat and flanking regions. An expanded study using all the available SSR markers on a larger set of samples (from both species of oil palm) would provide a clearer picture on the genetic diversity of the germplasm available at MPOB
Acknowledgments
The authors wish to thank the Director-General of MPOB for permission to publish this article. Special thanks to Jayanthi Nagappan, Ting Ngoot Chin, Maizura Ithnin and Chang Kwong Choong for their valuable comments on the manuscript.
References
- 1.Teh C.K. M.Sc. Thesis. Universiti Kebangsaan Malaysia; Kuala Lumpur, Malaysia: 2010. Genetic Diversity of Central and South American Wild Oil Palm (E. oleifera) Populations Using Microsatellite Markers. [Google Scholar]
- 2.Hardon J.J., Tan G.Y. Interspecific hybrids in the Elaeis. I. Cross-ability, cytogenetics and fertility of F1 hybrids of E. guineensis × E. oleifera. Euphytica. 1969;18:372–379. [Google Scholar]
- 3.Choo Y.M., Yusof B. Elaeis oleifera palm for the pharmaceutical industry. PORIM Inf. Ser. 1996;42:1–4. [Google Scholar]
- 4.Madon M., Clyde M.M., Cheah S.C. Application of genomic in situ hybridization (GISH) on Elaeis hybrids. J. Oil Palm Res. 1999:74–80. [Google Scholar]
- 5.Feng S.P., Li W.G., Huang H.S., Wang J.Y., Wu Y.T. Development, characterization and cross-species/genera transferability of EST-SSR markers for rubber tree (Hevea brasiliensis) Mol. Breed. 2009;28:85–97. [Google Scholar]
- 6.Powell W., Morgante M., Andre C., Hanafey M., Vogel J., Tingey S., Rafalski A. The comparison of RFLP, RAPD, AFLP and SSR (microsatellite) markers for germplasm analysis. Mol. Breed. 1996;2:225–238. [Google Scholar]
- 7.Singh R., Noorhariza M.Z., Ting N.C., Rozana R., Tan S.G., Low L.E.T., Ithnin M., Cheah S.C. Exploiting an oil palm EST the development of gene-derived and their exploitation for assessment of genetic diversity. Biologia. 2008;63:1–9. [Google Scholar]
- 8.Billotte N., Marseillac N., Risterucci A.M., Adon B., Brotteir P., Baurens F.C., Singh R., Herran A., Asmady H., Billot C., et al. Microsatellite-based high density linkage map in oil palm (Elaeis guineensis Jacq.) Theor. Appl. Genet. 2005;110:754–765. doi: 10.1007/s00122-004-1901-8. [DOI] [PubMed] [Google Scholar]
- 9.Billotte N., Jourjon M.F., Marseillac N., Berger A., Flori A., Asmady H., Adon B., Singh R., Nouy B., Potier F., et al. QTL detection by multi-parent linkage mapping in oil palm (Elaeis guineensis Jacq.) Theor. Appl. Genet. 2010;120:1673–1687. doi: 10.1007/s00122-010-1284-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Hayati A., Wickneswari R., Maizura I., Rajanaidu N. Genetic diversity of oil palm (Elaeis guineensis Jacq.) germplasm collections from Africa: Implications for improvement and conservation of genetic resources. Theor. Appl. Genet. 2004;108:1274–1284. doi: 10.1007/s00122-003-1545-0. [DOI] [PubMed] [Google Scholar]
- 11.Maizura I., Rajanaidu N., Zakri A.H., Cheah S.C. Assessment of genetic diversity in oil palm (Elaeis guineensis Jacq.) using Restriction Fragment Length Polymorphism (RFLP) Genet. Resour. Crop Evol. 2006;53:187–195. [Google Scholar]
- 12.Kularatne R.S. Ph.D. Dissertation. Universiti Kebangsaan Malaysia; Kuala Lumpur, Malaysia: 2000. Assessment of Genetic Diversity in Natural oil Palm (Elaeis guineensis Jacq.) Populations using Amplified Fragment Length Polymorphism Markers. [Google Scholar]
- 13.Rajanaidu N., Maizura I., Cheah S.C. Rajanaidu N., Ariffin D. Screening of Oil Palm Natural Populations Using RAPD and RFLP Molecular Marker. Proceeding of the International Symposium Oil Palm Genetics Resources Utilization; Kuala Lumpur, Malaysia. 8–10 June 2000; Kuala Lumpur, Malaysia: Malaysian Palm Oil Board; 2000. pp. AA1–28. [Google Scholar]
- 14.Ting N.C., Noorhariza M.Z., Rozana R., Low L.E.T., Ithnin M., Cheah S.C., Tan S.G., Singh R. SSR mining in oil palm EST database: Application in oil palm germplasm diversity studies. J. Genet. 2010;89:135–145. doi: 10.1007/s12041-010-0053-7. [DOI] [PubMed] [Google Scholar]
- 15.Barcellos E., Amblard P., Berthaud J., Seguin M. Genetic diversity and relationship in American and African oil palm as revealed by RFLP and AFLP molecular markers. Pesq. Agropec. Bras. Brasilia. 2002;37:1105–1114. [Google Scholar]
- 16.Billotte N., Risterucci A.M., Barcelos E., Noyer J.L., Amblard P., Baurens F.C. Development, characterisation and across-taxa utility of oil palm (Elaeis guineensis Jacq.) microsatellite markers. Genome. 2001;44:413–425. [PubMed] [Google Scholar]
- 17.Budiman M.A., Rajinder S., Low E.T.L., Nunberg A., Citek R., Rohlfing T., Bedell J.A., Lakey N.D., Martienssen R.A., Cheah S.C. Sequencing of the Oil Palm Genespace. Proceeding of the 2005 PIPOC International Palm Oil Congress (Agriculture); Sunway Pyramid Convention Centre, Petaling Jaya, Malaysia. 25–29 September 2005; Kuala Lumpur, Malaysia: Malaysian Palm Oil Board; 2005. pp. 628–639. [Google Scholar]
- 18.Huang X., Madan A. CAP3: A DNA sequence assembly program. Genome Res. 1999;9:868–877. doi: 10.1101/gr.9.9.868. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Low E.T.L., Halimah A., Boon S.H., Elyana M.S., Tan C.Y., Ooi L.C.L. Oil palm (Elaeis guineensis Jacq.) tissue culture ESTs: Identifying genes associated with callogenesis and embryogenesis. BMC Plant Biol. 2008;8 doi: 10.1186/1471-2229-8-62. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Jung S., Abbott A., Jusudurai C. Frequency, type, distribution of simple sequence repeats in Rosaceae ESTs. Funct. Integr. Genomics. 2005;5:136–143. doi: 10.1007/s10142-005-0139-0. [DOI] [PubMed] [Google Scholar]
- 21.Aggarwal R.K., Hendre P.S., Varshney R.K., Bhat P.R., Krishnakumar V., Singh L. Identification, characterization and utilization of EST-derived genic microsatellite markers for genome analyses of coffee and related species. Theor. Appl. Genet. 2007;114:359–372. doi: 10.1007/s00122-006-0440-x. [DOI] [PubMed] [Google Scholar]
- 22.Gong L., Stift G., Kofler R., Pachner M., Lelley T. Microsatellites for the genus Cucurbita and an SSR-based genetic linkage map of Cucurbita pepo L. Theor. Appl. Genet. 2008;117:37–48. doi: 10.1007/s00122-008-0750-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Morgante M., Hanafey M., Powell W. Microsatellites are preferentially associated with nonrepetitive DNA in plant genomes. Nat. Genet. 2002;30:194–200. doi: 10.1038/ng822. [DOI] [PubMed] [Google Scholar]
- 24.Cardle L., Ramsay L., Milbourne D., Macaulay M., Marshall D., Waugh R. Computational and experimental characterization of physically clustered simple sequence repeats in plants. Genetics. 2000;156:847–854. doi: 10.1093/genetics/156.2.847. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Gao L.F., Tang J., Li H., Jia J. Analysis of microsatellites in major crops assessed by computational and experimental approaches. Mol. Breed. 2003;113:163–185. [Google Scholar]
- 26.Thiel T., Michalek W., Varshney R.K., Graner A. Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.) Theor. Appl. Genet. 2003;106:411–422. doi: 10.1007/s00122-002-1031-0. [DOI] [PubMed] [Google Scholar]
- 27.Poncet V., Rondeau M., Tranchant C., Cayrel A., Hamon S., de Kochko A., Hamon P. SSR mining in coffee tree EST databases: Potential use of EST-SSRs as markers for the Coffea genus. Mol. Genet. Genomics. 2006;276:436–449. doi: 10.1007/s00438-006-0153-5. [DOI] [PubMed] [Google Scholar]
- 28.Pestsova E., Ganal M.W., Roder M.S. Isolation and mapping of microsatellite marker specific for the D genome of bread wheat. Genome. 2000;43:689–697. [PubMed] [Google Scholar]
- 29.Bhattramakki D., Dong J., Chhabra K., Hart G.E. An integrated SSR and RFLP linkage map of Sorghum bicolor (L.) Moench. Genome. 2000;43:988–1002. [PubMed] [Google Scholar]
- 30.Botstein D., White R.L., Skolnick M., Davis R.W. Construction of genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet. 1980;32:314–331. [PMC free article] [PubMed] [Google Scholar]
- 31.Purba A.R., Noyer J.L., Baudouin L., Perrier X., Hamon S., Lagoda P.J.L. A new aspect of genetic diversity of Indonesian oil palm (Elaeis guineensis Jacq.) revealed by isoenzyme and AFLP markers and its consequences for breeding. Theor. Appl. Genet. 2000;101:956–961. [Google Scholar]
- 32.Rajanaidu N. Elaeis oleifera Collection in Central and South America. Proceeding of the International Workshop on Oil Palm Germplasm and Utilization; Selangor, Malaysia. 26–27 March 1986; Kuala Lumpur, Malaysia: Palm Oil Research Institute Malaysia; 1986. pp. 84–94. [Google Scholar]
- 33.Barbara T., Palma-Silva C., Paggi G.M., Bered F., Fay M.F.C., Lexer C. Cross-species transfer of nuclear microsatellite markers: Potential and limitations. Mol. Ecol. 2007;18:3759–3767. doi: 10.1111/j.1365-294X.2007.03439.x. [DOI] [PubMed] [Google Scholar]
- 34.Roa A.C., Chavarriaga-Aguirre P., Duque M.C., Maya M.M., Bonierbale M.W., Iglesias C., Tohme J. Cross-species amplication of cassava (Manihot esculenta) (Euphorbiaceae) microsatellites: Allelic polymorphism and degree of relationship. Am. J. Bot. 2000;87:1647–1655. [PubMed] [Google Scholar]
- 35.Rossetto M. Sourcing of SSR Markers from Related Plant Species. In: Henry R.J., editor. Plant Genotyping—The DNA Fingerprinting of Plant. CABI Publishing; New York, NY, USA: 2001. pp. 211–224. [Google Scholar]
- 36.Wu K.S., Tanksley S.D. Abundance, polymorphism and genetic mapping of microsatellites in rice. Mol. Gen. Genet. 1993;241:225–235. doi: 10.1007/BF00280220. [DOI] [PubMed] [Google Scholar]
- 37.Sefc K.M., Lopes M.S., Mendon D., Dos Santos M.R., da Camara Machado M.L., da Camara Machado A. Identification of microsatellite loci in olive (Olea europaea) and their characterization in Italian and Iberian olive trees. Mol. Ecol. 2000;9:1171–1173. doi: 10.1046/j.1365-294x.2000.00954.x. [DOI] [PubMed] [Google Scholar]
- 38.Hodgetts R.B., Aleksiuk M.A., Brown A., Clarke C., Macdonald E., Nadeem S., Khasa D. Development of microsatellite markers for white spruce (Picea glauca) and related species. Theor. Appl. Genet. 2001;102:1252–1258. [Google Scholar]
- 39.Liewlaksaneeyanawin C., Ritland C.E., El-Kassaby Y.A., Ritland K. Single-copy, species-transferable microsatellite markers developed from loblolly pine ESTs. Theor. Appl. Genet. 2004;109:361–369. doi: 10.1007/s00122-004-1635-7. [DOI] [PubMed] [Google Scholar]
- 40.Doyle J.J., Doyle J.L. Isolation of plant DNA from fresh tissue. Focus. 1990;12:13–15. [Google Scholar]
- 41.Rozen S., Skaletsky H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol. Biol. 2000;132:365–386. doi: 10.1385/1-59259-192-2:365. [DOI] [PubMed] [Google Scholar]
- 42.Yeh F.C., Boyle T.J.B. Population genetic analysis of co-dominant and dominant markers and quantitative traits. Belg. J. Bot. 1997;129:157. [Google Scholar]
- 43.Nei M., Takezaki N. Estimation of genetic distances and phylogenetic trees from DNA analysis. Proceedings of the 5th World Congress on Genetics Applied to Livestock Production; Guelph, Canada. 7–12 August 1994; Guelph, Canada: University of Guelph; 1994. pp. 405–412. [Google Scholar]
- 44.Liu K., Muse S.V. PowerMarker: An integrated analysis environment for genetic marker analysis. Bioinformatics. 2005;21:2128–2129. doi: 10.1093/bioinformatics/bti282. [DOI] [PubMed] [Google Scholar]
- 45.Sneath P.H.A., Sokal R.R. Numerical Taxonomy: The Principles and Practice of Numerical Classification. W. H. Freeman; San Francisco, CA, USA: 1973. [Google Scholar]
- 46.Tamura K., Dudley J., Nei M., Kumar S. MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 2007;24:1596–1599. doi: 10.1093/molbev/msm092. [DOI] [PubMed] [Google Scholar]
- 47.Hall T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999;41:95–98. [Google Scholar]