Skip to main content
Proceedings of the National Academy of Sciences of the United States of America logoLink to Proceedings of the National Academy of Sciences of the United States of America
. 2012 Apr 16;109(18):7079–7084. doi: 10.1073/pnas.1120174109

Snapshot of virus evolution in hypersaline environments from the characterization of a membrane-containing Salisaeta icosahedral phage 1

Antti P Aalto a,1, David Bitto b, Janne J Ravantti a, Dennis H Bamford a, Juha T Huiskonen b, Hanna M Oksanen a,2
PMCID: PMC3344969  PMID: 22509017

Abstract

The multitude of archaea and bacteria inhabiting extreme environments has only become evident during the last decades. As viruses apply a significant evolutionary force to their hosts, there is an inherent value in learning about viruses infecting these extremophiles. In this study, we have focused on one such unique virus–host pair isolated from a hypersaline environment: an icosahedral, membrane-containing double-stranded DNA virus—Salisaeta icosahedral phage 1 (SSIP-1) and its halophilic host bacterium Salisaeta sp. SP9-1 closely related to Salisaeta longa. The architectural principles, virion composition, and the proposed functions associated with some of the ORFs of the virus are surprisingly similar to those found in viruses belonging to the PRD1–adenovirus lineage. The virion structure, determined by electron cryomicroscopy, reveals that the bulk of the outer protein capsid is composed of upright standing pseudohexameric capsomers organized on a T = 49 icosahedral lattice. Our results give a comprehensive description of a halophilic virus–host system and shed light on the relatedness of viruses based on their virion architecture.

Keywords: virus structure, PRD1-like viruses, ORFan


Viruses are the most abundant depositories of nucleic acid-encoded information in the biosphere, and they outnumber their hosts by at least an order of magnitude. It has been suggested that viruses were the first compartmentalized, self-replicating entities on Earth, and that the last universal common ancestor was already infected by numerous viruses using a variety of assembly principles (1–3). As it is impossible to directly observe the early stages of emergence of life, present day viruses can help to delineate the plausible evolutionary pathways that led from the primordial soup to the amazing diversity in which life is manifested today. A prerequisite to this approach is to carefully sample different ecological niches and attempt to characterize the organisms dwelling in them (4).

Organisms inhabiting hypersaline environments are called halophilic (for “salt loving”). There are many ways to define halophilic organisms, but often they can be classified as growing optimally at 50 g/L of salt or higher or tolerating at least 100 g/L of salt. Extremely halophilic organisms can tolerate salt concentrations approaching saturation (∼360 g/L) (5). Although hypersaline environments support organisms from all domains of life, their inhabitants have been poorly studied. Importantly, life in extreme environments has been suggested to reflect conditions on the “early” Earth, encouraging the study of extremophiles to understand evolution (6).

The vast majority of halophilic viruses described to date infect archaea, and they fall into a number of morphotypes with capsid architectures ranging from tailed and tailless icosahedrally symmetric viruses to pleomorphic viruses lacking well-defined shapes (7, 8). In contrast, very little is known about halophilic viruses that infect bacterial hosts (9–12). This bias stems from the fact that bacteria from hypersaline environments have remained understudied (13). However, during the last few decades the number of known halophilic bacterial species has increased rapidly, due to more thorough sampling and the introduction of metagenomic approaches (5). Consequently, to better understand the rules and interactions that constitute the virus–host ecology and evolution in hypersaline biotopes, bacterial viruses and their hosts have to be brought into the limelight.

In this study, we introduce a halophilic icosahedral virus, Salisaeta icosahedral phage 1 (SSIP-1), which exemplifies a tailless bacteriophage thriving in a hypersaline environment. The SSIP-1 capsid consists mainly of pseudohexameric capsomers following a T = 49 triangulation and encloses a membrane, whose lipids are selectively derived from the host. The membrane further encloses a circular dsDNA genome. Sequencing of the genome and subsequent bioinformatics and proteomic analyses of the virion proteins revealed several previously unidentified genes, ORFans. The life cycle of SSIP-1 was determined to be lytic. However, the discovery of putative integrase and repressor/antirepressor genes suggests that there may also be a temperate phase in the life cycle. The discovery of SSIP-1 adds a piece to the puzzle of icosahedral tailless viruses with an inner membrane. These viruses form the PRD1–adenovirus structural lineage whose members share upright double β-barrel major capsid proteins (MCPs) and a similar virion architecture (1, 14–19). Such viruses infect cells belonging to bacteria, archaea, or eukaryotes supporting the view that these viruses are ancient and share a common origin. PRD1-like viruses can clearly be divided into those having an MCP with the canonical double β-barrel fold [e.g., PM2 (20), vaccinia virus (21), PRD1 (15), PBCV-1 (22), STIV (23), and adenovirus (24)] and to those with a more complex capsid arrangement with two MCPs [SH1 (25), P23-77 (26), and HHIV-2 (27)]. So far, the latter group has been found infecting only organisms from extreme conditions.

Results and Discussion

SSIP-1 Is a Virulent Bacteriophage Infecting Rod-Shaped Salisaeta sp. SP9-1 from High Salinity.

During our search for new prokaryotes and their viruses from extremely halophilic environments (11), a single virus isolate designated SSIP-1 and its host bacterium Salisaeta sp. SP9-1 (SP for Sedom ponds) were found in a water sample from experimental ponds at Sedom, Israel, where water from the Dead Sea is diluted with water from the Red Sea. These mesocosms simulate the environmental effects of regulating the levels of the Dead Sea with seawater (28).

SP9-1 cultures displayed a bright red color and their turbidity increased more rapidly as the salinity of the growth medium was lowered (Fig. S1A). A partial 16S rRNA gene sequence of SP9-1 is highly similar (99.6%) to that of Salisaeta longa (11). S. longa is a Gram-negative, rod-shaped, halophilic bacterium (Bacteroidetes) previously isolated from the Sedom ponds (29). Indeed, only a few differences could be detected in the whole-cell protein patterns of SP9-1 and S. longa (Fig. S1B). Moreover, under the electron microscope, SP9-1 (Fig. 1A) displayed a similar morphology to that of S. longa (Fig. 1B).

Fig. 1.

Fig. 1.

SSIP-1 is a lytic bacteriophage infecting Salisaeta sp. SP9-1. (A and B) Thin-section electron microscopic image of (A) SP9-1 and (B) Salisaeta longa. White areas are holes caused by the high salt concentration. (Scale bar in B, 1 μm for A and B.) (C) SSIP-1 life cycle. Optical density of SSIP-1 infected [using a multiplicity of infection (MOI) of 10; open circles] and uninfected (closed circles) SP9-1 cultures was observed for 30 h. At 6 h to 17 h postinfection (p.i.) samples were collected, the bacteria pelleted by centrifugation, and the supernatants assayed for infective viruses (gray bars). (D) Thin-section electron microscopic images of SSIP-1 infected SP9-1 cell at 17 h p.i. containing virus particles (arrows). (Scale bar, 200 nm.) (E) Binding of SSIP-1 on SP9-1 (closed circles) and S. longa (open circles). For control, no cells were added (triangles). After the removal of bound viruses and cells, the supernatants were assayed for infective free viruses (n = 3). Error bars indicate SEM. (F) SSIP-1 was incubated at the indicated salt water (SW, % wt/vol) buffers for 3 h (closed circles), 1 d (open circles), and 7 d (triangles), and the infectivity was assayed.

The growth phase of the host has an effect on the plating efficiency (EOP): using logarithmic and stationary phase cultures the EOPs were 2 × 109 and 4 × 108 pfu/mL, respectively. Furthermore, SSIP-1 was unable to induce plaque formation in any of the other halophilic bacteria tested, including S. longa, Salisaeta sp. SP10-1, and five Salinibacter strains (Table S1). In the single-step growth experiment, the turbidity of the SSIP-1–infected SP9-1 culture started to decline after 15 h postinfection (p.i.) (Fig. 1C). At the same time infectious viruses began to accumulate in the supernatant, indicating that in these conditions SSIP-1 lyses its host. Electron micrographs of thin-sectioned SSIP-1–infected SP9-1 cells supported these findings by revealing virus-sized particles accumulating within ruptured cells at 17 h p.i. (Fig. 1D). SSIP-1 bound specifically, but rather slowly, onto SP9-1 cells with an approximate adsorption rate of 7.0 × 10−9 mL/min (Fig. 1E). SSIP-1 was unable to bind onto S. longa, suggesting that the receptor seems to be specific to SP9-1 despite the close relatedness between the two species (Fig. 1E and Fig. S1B).

Optimal salinity was critical for SSIP-1 virion and its life cycle. The infectivity of SSIP-1 decreased dramatically when the virus was exposed to lowered salinity (Fig. 1F). The virus particles remained infectious in 9% (wt/vol) salt water (SW) (see composition in Table S2) for 3 h. However, for longer periods, higher salinity [18% (wt/vol) SW; Table S2] was needed to retain infectivity. Moreover, SSIP-1 was unable to produce plaques when the salt concentration of the growth medium was lowered below 19% (wt/vol) SW (Table S2), although the virion remains infectious in these conditions. The EOP also increased with the increasing salinity. These results are in concert with a model where low salinity affects the adsorption of the virus onto the host by impairing receptor binding. It is also feasible that the low salinity modifies the biophysical properties of the host cell membrane or the functions of some of the enzymes critical for virus entry or exit.

Predicted Functions of SSIP-1 ORFs Suggest Sophisticated Nucleic Acid Chemistry and the Ability to Integrate into the Host Genome.

The SSIP-1 genome is a nonmethylated, circular, dsDNA molecule of 43,788 bp with a GC content of 57.2% (Fig. 2 and Fig. S1C). The second adenine (underlined) of the unique EcoRV cleavage site (5′-GATATC-3′) was assigned as the first nucleotide. We included all of the ORFs that encode a protein longer than 40 aa. In the following text, an ORF that is confirmed by proteomics (see below) to encode for a gene product (gp) is referred to as a gene. In total, there are 57 nonoverlapping and tightly packed ORFs putatively encoding polypeptides with variable sizes (48–2,320 residues) and having GC contents between 47.5 and 67.4% (Fig. 2 and Table S3). The ORFs and genes are organized in blocks with alternating directions (at least four operons), suggesting temporal transcription regulation during different stages of the virus life cycle (Fig. 2). Thirteen of the hypothetical proteins have predicted transmembrane helices (Table S3).

Fig. 2.

Fig. 2.

The genome of SSIP-1 is a circular dsDNA molecule with 57 predicted ORFs. Inner graph indicates the GC profile of the genome. Predicted ORFs and genes (1–57) are seen on the outer circle. ORFs in the forward and reverse directions are colored in blue and green, respectively. Gene products that have been confirmed to be structural proteins of the virion are marked in red (Fig. 3C and Table S7). Unique restriction enzyme cleavage sites are indicated in the outermost circle. Tandem repeat sequences were located in ORF 27 (3.5× GAGTGGAACACCCGCGGAACAGT, 4.6× GGAACAGTCGT), ORF 29 (2.2× CTCCGCCAGCAGAAGAAAGAG), and ORF 52 (2.4× CGGTGGTGGCGGCGGTAATCCCGGCGGTGGCTA). (Numbers before the tandem repeat sequences indicate how many times the corresponding sequence is repeated.) Red lollipops indicate predicted terminator sequences and putative σ70-promoter regions are shown by gray arrows.

Most of the SSIP-1 ORFs (38 of 57) were ORFans i.e., ORFs that have no detectable sequence similarity to other sequences in the databases (30, 31). As more and more viral genomes are being sequenced, the abundance of ORFans seems to be becoming a rule rather than an exception (31). Viruses have traditionally been regarded as pickpockets of cellular genes, and the presence of viral ORFs having no apparent homologs has been thought to be an indication of insufficient sampling of the sequence space. However, it has recently been suggested that ORFans may actually represent genes that are of “viral origin,” which emphasizes the possibility that viruses are a major driving force of evolution (3).

We obtained highly significant homology scores for 19 ORFs (Table S3). The predicted functions of many of these ORFs were related to nucleic acid chemistry, e.g., (i) DNA invertase, resolvase, and transposase; (ii) RNA polymerase σ70 subunit; and (iii) AAA ATPase or primase homologs were detected (Table S3). The structural protein gp40 harbors the canonical Walker A and B motifs and signatures of the P9/A32-specific motif found in the packaging proteins of tailless membrane-containing icosahedral viruses, e.g., PRD1 (32–34). The giant virion structural protein gp43 (262 kDa) contains several distinct domains that reveal similarities to DNA methyltransferase, type I site-specific DNase, and the chromosome partitioning protein ParB (Table S3). These data suggest that SSIP-1 is capable of participating in RNA and DNA metabolism. Gene 43 is considerably larger than any of the other ORFs within the genome and could be an example of horizontal gene transfer. As no DNA or RNA polymerase could be found within the SSIP-1 genome, it is possible that gp43 might be a sophisticated molecular machine important for the replication and/or transcription of the genome.

A few putative genes seem to have predicted functions in virus entry or exit (lysozyme g and an endoglucanase-related protein; Table S3). Although SSIP-1 obeys a strictly virulent lifestyle in SP9-1 (Fig. 1C), the SSIP-1 genome contains genes homologous to a phage repressor, an antirepressor, a putative integrase, and site-specific recombinase (Table S3). It can be envisioned that these proteins, together with other unidentified components, enable the virus to integrate into the host genome. To detect possible host genome integration, we performed colony PCR on uninfected SP9-1 and S. longa cultures using several SSIP-1–specific oligos, but were unable to detect any evidence of the presence of SSIP-1. It is conceivable that integration of SSIP-1 takes place in specific conditions or with another host. An alternative scenario is that the recombination machinery of SSIP-1 has undergone mutations and is no longer functional.

Analysis of Putative Moron-Like Elements.

It seems that horizontal gene transfer is possible between viruses infecting phylogenetically distant hosts that inhabit completely different ecological niches as demonstrated, e.g., head–tail viruses ΦCh1 and ΦH (35). We noticed that SSIP-1 ORF 25 is strikingly similar (63.7% similarity; Table S3) to P23-77 ORF 3 [National Center for Biotechnology Information (NCBI) ID: YP_003169710]. P23-77 is a tailless icosahedral, internal membrane-containing dsDNA bacteriophage that infects Thermus thermophilus growing optimally above 70 °C (26). SSIP-1 ORF 25 is located (together with ORF 24) in an area of the genome that is flanked by ORF-free sequences (Fig. 2). The area is moron-like (a recent genetic addition) (36, 37), because the GC content of this region is much lower than its neighboring ORFs (Table S3). Also other SSIP-1 ORFs have considerably lower GC contents than their neighbors (e.g., ORFs 2, 16, and 32; Table S3). To emphasize the possibility that SSIP-1 could have moron-like regions with their own promoter and termination sites enabling autonomous transcription (36), we analyzed the genome for Rho-independent transcription terminators, σ70-promoter regions and tandem repeat sequences that might function as recognition sites for site-specific nucleases or integrases. Nine potential terminator sequences were predicted, and a high confidence value was assigned to four of these (Table S4). Intriguingly, three of the plausible terminators are located downstream of the operons containing ORFs 13, 23, and 29, whereas the fourth lies in between genes 46 and 47 (Fig. 2). Indeed, SSIP-1 ORF 25 is surrounded by putative transcription terminators (Table S4). Also, many of the tandem repeats found within the genome are located around this area, which might suggest a predisposition for recombination events (Fig. 2). In addition, this area contains the predicted gene coding for the phage antirepressor. Four distinct σ70-promoter sequences were located, two of which lie upstream of putative ORFs 3 and 15 (Table S5). Although some of the promoters might be functional, it is probable that SSIP-1 mostly employs transcription factors that are different from σ70. Most of the putative moron-like elements existed as single ORFs in the part of the SSIP-1 genome that contains the genes encoding for nonstructural proteins. This suggests that several (recent) sequential recombination events have shaped the genome and probably offered selective benefit for the virus.

Internal Membrane of SSIP-1 Virion Originates from Halophilic Host Lipids.

SSIP-1 virions were purified to near homogeneity by rate zonal and equilibrium centrifugations (Table S6) yielding particles with a specific infectivity of 1.2 × 1012 pfu/mg of protein. The low density of the purified virions (1.35 g/mL in CsCl; Fig. 3A) suggested the presence of lipids (38), which was confirmed by lipid extraction and TLC (Fig. 3B). No major differences in the lipid compositions could be detected between SP9-1, S. longa, or Salinibacter ruber (13) (Fig. 3B). The membranes of S. longa and S. ruber consist mostly of phosphatidylcholine, phosphatidylethanolamine, cardiolipin, glycolipid, and sulfonolipids (39, 40). In addition, phosphatidylglycerol and phosphatidylserine are present in S. ruber but not in S. longa. The sulfonolipids (halocapnines) are characteristic of halophilic members of Bacteroidetes and might in part support the halophilic lifestyle of these organisms (39). The lipid pattern of SSIP-1 was qualitatively similar to that of SP9-1, indicating that the virus membrane is derived from the host (Fig. 3B). However, SSIP-1 seems to display a certain degree of selectivity in its lipid incorporation (Fig. 3B). This phenomenon has been observed also in bacteriophage Bam35, in which the transmembrane protein complexes modulate the viral internal membrane curvature and thickness, providing a possible mechanism for lipid selectivity during virion assembly (41). Such a mechanism may also function in SSIP-1.

Fig. 3.

Fig. 3.

Lipids and structural proteins of SSIP-1. (A) SSIP-1 purified to near homogeneity. Graph indicates absorbance (open circles), density (closed circles), and infectivity (bars) of the CsCl gradient equilibrium centrifugation fractions from the final purification step. Only the virus band-containing fractions are shown. (B) Extracted polar lipids of SSIP-1, Salisaeta sp. SP9-1, Salisaeta longa and Salinibacter ruber were analyzed by TLC followed by iodine vapor staining. Major lipid bands that differ quantitatively between SP9-1 and SSIP-1 are indicated by arrows. (C) SSIP-1 was analyzed by SDS-PAGE. “M” is a molecular marker (Fermentas; SM0661). Major protein bands that were subjected to N-terminal protein sequences are indicated by an asterisk and the ones subjected to mass spectrometry are indicated by a hashmark. Major capsid proteins (MCPs) are indicated by arrows. Gene products (gp) determined by proteomics are given (Table S7 and Fig. 2).

The genes coding for the structural proteins of SSIP-1 (Fig. 3C and Table S7) were mostly located in the same genomic region (Fig. 2). The two most intense protein species (∼25 kDa) in the virion corresponded to the proteins gp45 and gp46. The calculated masses and the abundance suggest that they represent the MCPs (Figs. 2 and 3C). Six of the structural proteins (gp1, gp34, gp37, gp40, gp41, and gp43) gave a significant BLAST score to other sequences (Table S3). However, no homologs were detected for the MCPs gp45 and gp46, nor are these proteins homologous to each other. It is possible that in this case, sequence-based methods are unsuitable for detecting homologous proteins, as only their folds, but not the primary sequence, seem to be conserved. However, when the crystal structures are solved they may well reveal similarities to other viruses (16, 17).

Structure of the SSIP-1 Virion Reveals a T = 49 Capsid Arrangement.

We used electron cryomicroscopy and 3D image reconstruction to determine the structure of the SSIP-1 virion (Fig. 4). High salinity hampers electron cryomicroscopy by reducing contrast. However, samples plunge-frozen immediately after diluting to 9% SW (see composition in Table S2) had enough contrast for imaging. Furthermore, the structural integrity of the virions was retained (Figs. 1F and 4A).

Fig. 4.

Fig. 4.

Icosahedral reconstruction of the SSIP-1 virion. (A) Electron micrograph of SSIP-1 virions vitrified at 9% (wt/vol) salt water (SW) buffer (see composition in Table S2). Three spikes are indicated with black arrowheads (Scale bar, 50 nm.) (B) Central slice through an icosahedral reconstruction. Inset shows a radially averaged density profile. DNA (D), membrane (M), capsid (C), and spikes (S) are indicated. Twofold, threefold, and fivefold axes of icosahedral symmetry are indicated by an ellipse, a triangle, and a pentagon, respectively. Three concentric layers of DNA are indicated with asterisks. Lipid bilayer is interrupted by transmembrane densities at the threefold axes of symmetry (triangle). (C) Radially colored isosurface representation of the reconstruction with an arbitrary handedness is rendered at 2σ above the mean density. Color bar shows radial coloring. Inset shows a model lattice exemplifying the T = 49 icosahedral triangulation. Geometrical arrangement of the capsomers is given by the relationship T = h2 + hk + k2, where h and k define the lattice point. Here h = 7, k = 0. The two frontmost fivefold vertices are in red. (D–F) Six times magnified close-ups of the reconstruction taken along the (D) twofold, (E) threefold, and (F) fivefold axes of symmetry.

Icosahedral reconstruction calculated using 2,747 particles yielded a structure of the virion at 12.5-Å resolution (Fig. 4 B–F and Fig. S2A). The dimensions of the viral capsid are 106 nm (vertex to vertex), 97 nm (facet to facet), and 95 nm (edge to edge). The capsid exhibits icosahedral symmetry and the capsomers are organized on a T = 49 icosahedral lattice (h = 7, k = 0; Fig. 4C). A thin fiber-like density (at least 10 nm in length) was occasionally seen extending from icosahedral vertices (Fig. 4A). However, these were less pronounced in the icosahedral reconstruction than in the original images, possibly due to flexibility. Six-coordinated capsomers (8 per asymmetric unit, 480 in total) make up most of the capsid shell. Only the 12 icosahedral vertexes are occupied by 5-coordinated capsomers, termed “pentons.” Interestingly, there are two types of 6-coordinated capsomers, “capped” and “uncapped.” Most of the capsomers (7 per asymmetric unit, 420 in total) display a trimeric cap feature on top of a base with sixfold or pseudosixfold symmetry (Fig. 4 D–E). Fitting of the canonical double β-barrel capsid protein of bacteriophage PM2 (20) to the SSIP-1 icosahedral lattice (Fig. S2B) reveals a tight fit supporting the presence of a hexagonal building block in the base of these capsomers as seen previously in PRD1-like viruses (15). The cap feature is lacking in the 5 capsomers surrounding the penton, termed “peripentonal” capsomers (1 per asymmetric unit, 60 in total) (Fig. 4F). Instead, six lobes forming most of the density are evident. Furthermore, the shape of these peripentonal capsomers appears asymmetric or threefold rather than sixfold.

The capsid encloses a lipid core, which is 80 nm in diameter (Fig. 4B). The lipid core harbors the dsDNA genome, engulfed by the membrane. Several weak densities, especially under the icosahedral vertices and possibly corresponding to peripheral or integral membrane proteins, are sandwiched between the lipid bilayer and the capsid. Notable exceptions are the icosahedral twofold positions, at which such densities are absent. At these positions, the capsomers, one at each side of the twofold axis of symmetry, are kinked toward the membrane and may interact directly with it (Fig. 4 B and D). The membrane is ∼5 nm thick and interrupted at some locations by densities, possibly corresponding to transmembrane regions of lipid core proteins. Three concentric shells of DNA with an average spacing of 2.0 nm were detected under the membrane (Fig. 4B). The average packing density of the DNA was calculated to be 0.29 bp/nm3.

Evolutionary Perspectives.

Several icosahedral, tailless dsDNA viruses have been proposed to belong to the same structural virus lineage with PRD1 (for a recent review, ref. 14). Instead of their respective host or genome type, the classification is based on the fold of their MCPs and virion architecture. Common to all PRD1-like viruses is their icosahedral capsid composed of capsomers with pseudohexameric bases. In addition, the icosahedral vertices are occupied by penton proteins and extended vertex structures. The capsid covers a lipid bilayer enclosing the dsDNA genome. The only exception is adenovirus, where the membrane is absent. The six-coordinated capsomers consist of six vertical β-barrels, which in PRD1 are in the form of a trimer of double β-barrels (15). However, recent findings suggest that the lineage of PRD1-like viruses is divided into two subgroups, those with one MCP, such as PRD1, and those with two (P23-77, SH1, and HHIV-2) (25–27). Interestingly, thermophilic P23-77 infects bacteria, whereas extremely halophilic SH1 and HHIV-2 infect archaea. The SSIP-1 structure (Fig. 4 B and C) shares all those common features with PRD1-type viruses. Additionally, SSIP-1 harbors two MCPs akin to P23-77, SH1, and HHIV-2, although the T = 49 capsid arrangement is specific to SSIP-1. On the basis of these similarities, SSIP-1 is a putative member of the PRD1-like viruses, but belonging to the extremophilic subgroup with two MCPs.

Over 1031 viruses reside in the biosphere exceeding the number of their hosts by an order of magnitude. They exert a massive selective pressure on their hosts on a global scale (42–44), which means that strong evolutionary forces shape the viral and host genomes. However, the known virion structures are based on a limited number of architectural principles (1, 14, 16–19) and consequently the enormous sequence diversity is reduced to a limited structure space. How many different viral structural lineages might there be? In our recent global search of some 50 independently acquired unique viruses, we discovered only 1 unique structural type not previously described (11). Obviously sampling of more viral structures is the only way forward to test our hypothesis. Here, we have taken a small step forward to bring more order to the viral universe.

Materials and Methods

Viruses, Bacteria, Media, and Growth Conditions.

SSIP-1 (11) and bacteria (Table S1) were grown aerobically at 37 °C in modified growth media (MGM) with varying salt concentrations (45). SSIP-1 grown on Salisaeta sp. SP9-1 was purified by rate zonal and equilibrium centrifugation. For details, see SI Materials and Methods, Viruses, Bacteria, Media, and Growth Conditions and SI Materials and Methods, Propagation and Purification of SSIP-1.

Life Cycle of SSIP-1.

Logarithmically growing Salisaeta sp. SP9-1 (1.2 × 108 cfu/mL) collected by centrifugation (5,112 × g, 15 min, 20 °C) was infected by resuspending the cells in the same volume of SSIP-1 virus stock (22 °C) to obtain a multiplicity of infection (MOI) of ∼10. Four hours postinfection the cells were collected (see above) and resuspended in fresh media to remove unbound viruses. A noninfected control culture was treated similarly. Parallel with turbidity measurements (OD550), samples were taken for transmission electron microscopy and free viruses were assayed at 1-h intervals. To determine the number of free viruses, the cells were removed by centrifugation (13,800 × g, 5 min, 22 °C), and the viruses in the supernatant were determined by plaque assay. For a detailed description of the EM analysis and adsorption assay, see SI Materials and Methods, Thin-Section Electron Microscopy and SI Materials and Methods, Adsorption Assays.

Protein and Lipid Analysis.

The proteins were resolved by SDS polyacrylamide electrophoresis (SDS-PAGE) using polyacrylamide or modified polyacrylamide-tricine-SDS gels (46, 47), and the structural proteins were either identified by N-terminal sequencing performed by degradative Edman chemistry or mass spectrometry (Protein Chemistry Core Laboratory, Institute of Biotechnology, University of Helsinki). For details, see SI Materials and Methods, Protein Identification. Extracted lipids were analyzed by TLC as described in SI Materials and Methods, Lipid Analysis.

Sequencing and Annotation of SSIP-1 Genome.

The genome of SSIP-1 was sequenced by conventional Sanger sequencing (LGC Genomics), and analyzed using Geneious software (48). For a detailed description, see SI Materials and Methods, Sequencing and Annotation of SSIP-1 Genome.

Colony PCR.

The possible integration of SSIP-1 into bacterial genomes was studied by a modified colony PCR method using SP9-1 and S. longa cultures at different growth phases as templates. Purified SSIP-1 genome and mQ-H2O were used as positive and negative controls, respectively. See SI Materials and Methods, SSIP-1 Colony PCR for primer sequences.

Electron Cryomicroscopy and Icosahedral Reconstruction of SSIP-1 Virions.

Micrographs of plunge-frozen samples in 9% (wt/vol) SW were recorded using a 300-kV transmission electron microscope (F30 Polara; FEI), operated at 59,000× nominal magnification and at liquid nitrogen temperature in low-dose conditions on a CCD camera (Ultrascan 4000; Gatan) leading to a calibrated pixel size of 2.0 Å. A low-resolution initial model of the virion was calculated from class averages in IMAGIC (Image Science) and the reconstruction was refined in EMAN (49), using 3,564 virion images. The resolution was determined using Fourier shell correlation at 0.5 threshold. For a detailed description, see SI Materials and Methods, Electron Cryomicroscopy and Icosahedral Reconstruction of SSIP-1 Virions.

Supplementary Material

Supporting Information

Acknowledgments

The authors thank S. Korhonen and S. Storman for technical assistance, B. Fartmann for sequencing, N. Kalkkinen and G. Rönnholm for their help with the protein identification, and A. Oren for providing the halophilic strains. This work was supported by the Academy of Finland Centre of Excellence Program in Virus Research Grant 11296841 (to D.H.B.), Academy Professor (Academy of Finland) Funding Grants 256197 and 256518 (to D.H.B.), the Academy of Finland Grants 130750 and 218080 (to J.T.H) and 127665 (to H.M.O.), and the Wellcome Trust Core Award Grant (090532/Z/09/Z to the Wellcome Trust Centre for Human Genetics). We also thank University of Helsinki for the support to the Instruct Associate Centre for Virus Production and Purification (The European Strategy Forum on Research Infrastructures) used in this study.

Footnotes

The authors declare no conflict of interest.

*This Direct Submission article had a prearranged editor.

Data deposition: The sequences reported in this paper have been deposited in the GenBank database (accession no. JN880423) and the Electron Microscopy Data Bank at the European Bioinformatics Institute (accession no. EMD-2061).

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1120174109/-/DCSupplemental.

References

  • 1.Bamford DH. Do viruses form lineages across different domains of life? Res Microbiol. 2003;154:231–236. doi: 10.1016/S0923-2508(03)00065-2. [DOI] [PubMed] [Google Scholar]
  • 2.Jalasvuori M, Bamford JK. Structural co-evolution of viruses and cells in the primordial world. Orig Life Evol Biosph. 2008;38:165–181. doi: 10.1007/s11084-008-9121-x. [DOI] [PubMed] [Google Scholar]
  • 3.Forterre P, Prangishvili D. The origin of viruses. Res Microbiol. 2009;160:466–472. doi: 10.1016/j.resmic.2009.07.008. [DOI] [PubMed] [Google Scholar]
  • 4.Holmes EC. What does virus evolution tell us about virus origins? J Virol. 2011;85:5247–5251. doi: 10.1128/JVI.02203-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Oren A. Microbial life at high salt concentrations: Phylogenetic and metabolic diversity. Saline Syst. 2008;4:2. doi: 10.1186/1746-1448-4-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Martin W, Baross J, Kelley D, Russell MJ. Hydrothermal vents and the origin of life. Nat Rev Microbiol. 2008;6:805–814. doi: 10.1038/nrmicro1991. [DOI] [PubMed] [Google Scholar]
  • 7.Pina M, Bize A, Forterre P, Prangishvili D. The archeoviruses. FEMS Microbiol Rev. 2011;35:1035–1054. doi: 10.1111/j.1574-6976.2011.00280.x. [DOI] [PubMed] [Google Scholar]
  • 8.Roine E, Oksanen HM. Viruses from the hypersaline environment. In: Ventosa A, Oren A, Ma Y, editors. Halophiles and Hypersaline Environments. Berlin: Springer; 2011. pp. 153–172. [Google Scholar]
  • 9.Kauri T, Ackermann HW, Goel U, Kushner DJ. A bacteriophage of a moderately halophilic bacterium. Arch Microbiol. 1991;156:435–438. [Google Scholar]
  • 10.Kukkaro P, Bamford DH. Virus-host interactions in environments with a wide range of ionic strengths. Environ Microbiol Reports. 2009;1:71–77. doi: 10.1111/j.1758-2229.2008.00007.x. [DOI] [PubMed] [Google Scholar]
  • 11.Atanasova NS, Roine E, Oren A, Bamford DH, Oksanen HM. Global network of specific virus-host interactions in hypersaline environments. Environ Microbiol. 2012;14:426–440. doi: 10.1111/j.1462-2920.2011.02603.x. [DOI] [PubMed] [Google Scholar]
  • 12.Calvo C, de la Paz AG, Bejar V, Quesada E, Ramos-Cormenzana A. Isolation and characterization of phage F9-11 from a lysogenic Deleya halophila strain. Curr Microbiol. 1988;17:49–53. [Google Scholar]
  • 13.Antón J, et al. Salinibacter ruber gen. nov., sp. nov., a novel, extremely halophilic member of the Bacteria from saltern crystallizer ponds. Int J Syst Evol Microbiol. 2002;52:485–491. doi: 10.1099/00207713-52-2-485. [DOI] [PubMed] [Google Scholar]
  • 14.Abrescia NGA, Bamford DH, Grimes JM, Stuart DI. Structure unifies the viral universe. Annu Rev Biochem. 2012;81 doi: 10.1146/annurev-biochem-060910-095130. in press. [DOI] [PubMed] [Google Scholar]
  • 15.Benson SD, Bamford JK, Bamford DH, Burnett RM. Viral evolution revealed by bacteriophage PRD1 and human adenovirus coat protein structures. Cell. 1999;98:825–833. doi: 10.1016/s0092-8674(00)81516-0. [DOI] [PubMed] [Google Scholar]
  • 16.Bamford DH, Grimes JM, Stuart DI. What does structure tell us about virus evolution? Curr Opin Struct Biol. 2005;15:655–663. doi: 10.1016/j.sbi.2005.10.012. [DOI] [PubMed] [Google Scholar]
  • 17.Krupovic M, Bamford DH. Virus evolution: How far does the double beta-barrel viral lineage extend? Nat Rev Microbiol. 2008;6:941–948. doi: 10.1038/nrmicro2033. [DOI] [PubMed] [Google Scholar]
  • 18.Krupovic M, Bamford DH. Double-stranded DNA viruses: 20 families and only five different architectural principles for virion assembly. Curr Opin Virol. 2011;1:118–124. doi: 10.1016/j.coviro.2011.06.001. [DOI] [PubMed] [Google Scholar]
  • 19.Abrescia NGA, et al. What does it take to make a virus: The concept of the viral “self”. In: Stockley PG, Twarock R, editors. Emerging Topics in Physical Virology. London: Imperial College Press; 2010. pp. 35–58. [Google Scholar]
  • 20.Abrescia NG, et al. Insights into virus evolution and membrane biogenesis from the structure of the marine lipid-containing bacteriophage PM2. Mol Cell. 2008;31:749–761. doi: 10.1016/j.molcel.2008.06.026. [DOI] [PubMed] [Google Scholar]
  • 21.Bahar MW, Graham SC, Stuart DI, Grimes JM. Insights into the evolution of a complex virus from the crystal structure of vaccinia virus D13. Structure. 2011;19:1011–1020. doi: 10.1016/j.str.2011.03.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Nandhagopal N, et al. The structure and evolution of the major capsid protein of a large, lipid-containing DNA virus. Proc Natl Acad Sci USA. 2002;99:14758–14763. doi: 10.1073/pnas.232580699. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Rice G, et al. The structure of a thermophilic archaeal virus shows a double-stranded DNA viral capsid type that spans all domains of life. Proc Natl Acad Sci USA. 2004;101:7716–7720. doi: 10.1073/pnas.0401773101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Rux JJ, Kuser PR, Burnett RM. Structural and phylogenetic analysis of adenovirus hexons by use of high-resolution x-ray crystallographic, molecular modeling, and sequence-based methods. J Virol. 2003;77:9553–9566. doi: 10.1128/JVI.77.17.9553-9566.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Jäälinoja HT, et al. Structure and host-cell interaction of SH1, a membrane-containing, halophilic euryarchaeal virus. Proc Natl Acad Sci USA. 2008;105:8008–8013. doi: 10.1073/pnas.0801758105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Jaatinen ST, Happonen LJ, Laurinmäki P, Butcher SJ, Bamford DH. Biochemical and structural characterisation of membrane-containing icosahedral dsDNA bacteriophages infecting thermophilic Thermus thermophilus. Virology. 2008;379:10–19. doi: 10.1016/j.virol.2008.06.023. [DOI] [PubMed] [Google Scholar]
  • 27.Jaakkola ST, et al. Closely related archaeal Haloarcula hispanica icosahedral viruses HHIV-2 and SH1 have nonhomologous genes encoding host recognition functions. J Virol. 2012 doi: 10.1128/JVI.06666-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Oren A, et al. Biological effects of dilution of Dead Sea brine with seawater: Implications for the planning of the Red Sea - Dead Sea “Peace Conduit”. J Mar Syst. 2004;46:121–131. [Google Scholar]
  • 29.Vaisman N, Oren A. Salisaeta longa gen. nov., sp. nov., a red, halophilic member of the Bacteroidetes. Int J Syst Evol Microbiol. 2009;59:2571–2574. doi: 10.1099/ijs.0.010892-0. [DOI] [PubMed] [Google Scholar]
  • 30.Fischer D, Eisenberg D. Finding families for genomic ORFans. Bioinformatics. 1999;15:759–762. doi: 10.1093/bioinformatics/15.9.759. [DOI] [PubMed] [Google Scholar]
  • 31.Comeau AM, et al. Exploring the prokaryotic virosphere. Res Microbiol. 2008;159:306–313. doi: 10.1016/j.resmic.2008.05.001. [DOI] [PubMed] [Google Scholar]
  • 32.Gorbalenya AE, Koonin EV. Viral proteins containing the purine NTP-binding sequence pattern. Nucleic Acids Res. 1989;17:8413–8440. doi: 10.1093/nar/17.21.8413. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Strömsten NJ, Bamford DH, Bamford JKH. In vitro DNA packaging of PRD1: A common mechanism for internal-membrane viruses. J Mol Biol. 2005;348:617–629. doi: 10.1016/j.jmb.2005.03.002. [DOI] [PubMed] [Google Scholar]
  • 34.Walker JE, Saraste M, Runswick MJ, Gay NJ. Distantly related sequences in the alpha- and beta-subunits of ATP synthase, myosin, kinases and other ATP-requiring enzymes and a common nucleotide binding fold. EMBO J. 1982;1:945–951. doi: 10.1002/j.1460-2075.1982.tb01276.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Klein R, et al. Natrialba magadii virus phiCh1: First complete nucleotide sequence and functional organization of a virus infecting a haloalkaliphilic archaeon. Mol Microbiol. 2002;45:851–863. doi: 10.1046/j.1365-2958.2002.03064.x. [DOI] [PubMed] [Google Scholar]
  • 36.Hendrix RW, Lawrence JG, Hatfull GF, Casjens S. The origins and ongoing evolution of viruses. Trends Microbiol. 2000;8:504–508. doi: 10.1016/s0966-842x(00)01863-1. [DOI] [PubMed] [Google Scholar]
  • 37.Juhala RJ, et al. Genomic sequences of bacteriophages HK97 and HK022: Pervasive genetic mosaicism in the lambdoid bacteriophages. J Mol Biol. 2000;299:27–51. doi: 10.1006/jmbi.2000.3729. [DOI] [PubMed] [Google Scholar]
  • 38.Porter K, et al. SH1: A novel, spherical halovirus isolated from an Australian hypersaline lake. Virology. 2005;335:22–33. doi: 10.1016/j.virol.2005.01.043. [DOI] [PubMed] [Google Scholar]
  • 39.Baronio M, Lattanzio VM, Vaisman N, Oren A, Corcelli A. The acylhalocapnines of halophilic bacteria: Structural details of unusual sulfonate sphingoids. J Lipid Res. 2010;51:1878–1885. doi: 10.1194/jlr.M004804. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Lattanzio VM, Baronio M, Oren A, Russell NJ, Corcelli A. Characterization of polar membrane lipids of the extremely halophilic bacterium Salinibacter ruber and possible role of cardiolipin. Biochim Biophys Acta. 2009;1791:25–31. doi: 10.1016/j.bbalip.2008.10.003. [DOI] [PubMed] [Google Scholar]
  • 41.Laurinmäki PA, Huiskonen JT, Bamford DH, Butcher SJ. Membrane proteins modulate the bilayer curvature in the bacterial virus Bam35. Structure. 2005;13:1819–1828. doi: 10.1016/j.str.2005.08.020. [DOI] [PubMed] [Google Scholar]
  • 42.Suttle CA. Marine viruses—major players in the global ecosystem. Nat Rev Microbiol. 2007;5:801–812. doi: 10.1038/nrmicro1750. [DOI] [PubMed] [Google Scholar]
  • 43.Bergh O, Børsheim KY, Bratbak G, Heldal M. High abundance of viruses found in aquatic environments. Nature. 1989;340:467–468. doi: 10.1038/340467a0. [DOI] [PubMed] [Google Scholar]
  • 44.Srinivasiah S, et al. Phages across the biosphere: Contrasts of viruses in soil and aquatic environments. Res Microbiol. 2008;159:349–357. doi: 10.1016/j.resmic.2008.04.010. [DOI] [PubMed] [Google Scholar]
  • 45.Nuttall SD, Dyall-Smith ML. HF1 and HF2: Novel bacteriophages of halophilic archaea. Virology. 1993;197:678–684. doi: 10.1006/viro.1993.1643. [DOI] [PubMed] [Google Scholar]
  • 46.Schägger H, von Jagow G. Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Anal Biochem. 1987;166:368–379. doi: 10.1016/0003-2697(87)90587-2. [DOI] [PubMed] [Google Scholar]
  • 47.Olkkonen VM, Bamford DH. Quantitation of the adsorption and penetration stages of bacteriophage ϕ 6 infection. Virology. 1989;171:229–238. doi: 10.1016/0042-6822(89)90530-8. [DOI] [PubMed] [Google Scholar]
  • 48.Drummond AJ, et al. 2011 Geneious v5.4. [Google Scholar]
  • 49.Ludtke SJ, Baldwin PR, Chiu W. EMAN: Semiautomated software for high-resolution single-particle reconstructions. J Struct Biol. 1999;128:82–97. doi: 10.1006/jsbi.1999.4174. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supporting Information

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences

RESOURCES