Skip to main content
NCBI home page
Nucleic Acids Research logoLink to Nucleic Acids Research
. 1988 Feb 11;16(3):833–847. doi: 10.1093/nar/16.3.833

alpha-DNA. VII. Solid phase synthesis of alpha-anomeric oligodeoxyribonucleotides.

F Morvan 1, B Rayner 1, J P Leonetti 1, J L Imbach 1
PMCID: PMC334722  PMID: 3344220

Abstract

An efficient procedure for the synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of alpha-nucleoside phosphoramidites and alpha-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 alpha-deoxynucleotide units in length. After HPLC purification, a 15-mer: alpha-d(CCTCTCGTTCTTTAC) and a 20-mer: alpha-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses.

Full text

PDF
833

Images in this article

845Image
on p.845

Selected References

These references are in PubMed. This may not be the complete list of references from this article.

  1. Agris C. H., Blake K. R., Miller P. S., Reddy M. P., Ts'o P. O. Inhibition of vesicular stomatitis virus protein synthesis and infection by sequence-specific oligodeoxyribonucleoside methylphosphonates. Biochemistry. 1986 Oct 7;25(20):6268–6275. doi: 10.1021/bi00368a065. [DOI] [PubMed] [Google Scholar]
  2. Billiau A. Redefining interferon: the interferon-like antiviral effects of certain cytokines (interleukin-1, interferon-beta 2, interferon-gamma) may be indirect or side effects. Antiviral Res. 1987 Sep;8(2):55–70. doi: 10.1016/0166-3542(87)90077-5. [DOI] [PubMed] [Google Scholar]
  3. Chow F., Kempe T., Palm G. Synthesis of oligodeoxyribonucleotides on silica gel support. Nucleic Acids Res. 1981 Jun 25;9(12):2807–2817. doi: 10.1093/nar/9.12.2807. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Gautier C., Morvan F., Rayner B., Huynh-Dinh T., Igolen J., Imbach J. L., Paoletti C., Paoletti J. Alpha-DNA. IV: Alpha-anomeric and beta-anomeric tetrathymidylates covalently linked to intercalating oxazolopyridocarbazole. Synthesis, physicochemical properties and poly (rA) binding. Nucleic Acids Res. 1987 Aug 25;15(16):6625–6641. doi: 10.1093/nar/15.16.6625. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Le Doan T., Perrouault L., Helene C., Chassignol M., Thuong N. T. Targeted cleavage of polynucleotides by complementary oligonucleotides covalently linked to iron-porphyrins. Biochemistry. 1986 Nov 4;25(22):6736–6739. doi: 10.1021/bi00370a002. [DOI] [PubMed] [Google Scholar]
  6. Lemaitre M., Bayard B., Lebleu B. Specific antiviral activity of a poly(L-lysine)-conjugated oligodeoxyribonucleotide sequence complementary to vesicular stomatitis virus N protein mRNA initiation site. Proc Natl Acad Sci U S A. 1987 Feb;84(3):648–652. doi: 10.1073/pnas.84.3.648. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Miyoshi K., Miyake T., Hozumi T., Itakura K. Solid-phase synthesis of polynucleotides. II. Synthesis of polythymidylic acids by the block coupling phosphotriester method. Nucleic Acids Res. 1980 Nov 25;8(22):5473–5489. doi: 10.1093/nar/8.22.5473. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Morvan F., Rayner B., Imbach J. L., Chang D. K., Lown J. W. alpha-DNA-III. Characterization by high field 1H-NMR, anti-parallel self-recognition and conformation of the unnatural hexadeoxyribonucleotides alpha-[d(CpApTpGpCpG)] and alpha-[d(CpGpCpApTpG)]. Alpha-oligodeoxynucleotides as potential cellular probes for gene control. Nucleic Acids Res. 1987 May 26;15(10):4241–4255. doi: 10.1093/nar/15.10.4241. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Morvan F., Rayner B., Imbach J. L., Chang D. K., Lown J. W. alpha-DNA. I. Synthesis, characterization by high field 1H-NMR, and base-pairing properties of the unnatural hexadeoxyribonucleotide alpha-[d(CpCpTpTpCpC)] with its complement beta-[d(GpGpApApGpG)]. Nucleic Acids Res. 1986 Jun 25;14(12):5019–5035. doi: 10.1093/nar/14.12.5019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Morvan F., Rayner B., Imbach J. L., Lee M., Hartley J. A., Chang D. K., Lown J. W. alpha-DNA-V. Parallel annealing, handedness and conformation of the duplex of the unnatural alpha-hexadeoxyribonucleotide alpha-[d(CpApTpGpCpG)] with its beta-complement beta-[d(GpTpApCpGpC)] deduced from high field 1H-NMR. Nucleic Acids Res. 1987 Sep 11;15(17):7027–7044. doi: 10.1093/nar/15.17.7027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Morvan F., Rayner B., Imbach J. L., Thenet S., Bertrand J. R., Paoletti J., Malvy C., Paoletti C. alpha-DNA II. Synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides containing the four usual bases and study of their substrate activities for nucleases. Nucleic Acids Res. 1987 Apr 24;15(8):3421–3437. doi: 10.1093/nar/15.8.3421. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Rosenthal A., Schwertner S., Hahn V., Hunger H. D. Solid-phase methods for sequencing of nucleic acids I. Simultaneous sequencing of different oligodeoxyribonucleotides using a new, mechanically stable anion-exchange paper. Nucleic Acids Res. 1985 Feb 25;13(4):1173–1184. doi: 10.1093/nar/13.4.1173. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Smith C. C., Aurelian L., Reddy M. P., Miller P. S., Ts'o P. O. Antiviral effect of an oligo(nucleoside methylphosphonate) complementary to the splice junction of herpes simplex virus type 1 immediate early pre-mRNAs 4 and 5. Proc Natl Acad Sci U S A. 1986 May;83(9):2787–2791. doi: 10.1073/pnas.83.9.2787. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Toulmé J. J., Krisch H. M., Loreau N., Thuong N. T., Hélène C. Specific inhibition of mRNA translation by complementary oligonucleotides covalently linked to intercalating agents. Proc Natl Acad Sci U S A. 1986 Mar;83(5):1227–1231. doi: 10.1073/pnas.83.5.1227. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Zamecnik P. C., Goodchild J., Taguchi Y., Sarin P. S. Inhibition of replication and expression of human T-cell lymphotropic virus type III in cultured cells by exogenous synthetic oligonucleotides complementary to viral RNA. Proc Natl Acad Sci U S A. 1986 Jun;83(12):4143–4146. doi: 10.1073/pnas.83.12.4143. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Nucleic Acids Research are provided here courtesy of Oxford University Press

RESOURCES