Skip to main content
NCBI home page
PLOS One logoLink to PLOS One
. 2012 May 10;7(5):e36756. doi: 10.1371/journal.pone.0036756

The Genome Characteristics and Predicted Function of Methyl-Group Oxidation Pathway in the Obligate Aceticlastic Methanogens, Methanosaeta spp

Jinxing Zhu 1,2, Huajun Zheng 3, Guomin Ai 1, Guishan Zhang 1, Di Liu 4, Xiaoli Liu 1, Xiuzhu Dong 1,*
Editor: Arnold Driessen5
PMCID: PMC3349665  PMID: 22590603

Abstract

In this work, we report the complete genome sequence of an obligate aceticlastic methanogen, Methanosaeta harundinacea 6Ac. Genome comparison indicated that the three cultured Methanosaeta spp., M. thermophila, M. concilii and M. harundinacea 6Ac, each carry an entire suite of genes encoding the proteins involved in the methyl-group oxidation pathway, a pathway whose function is not well documented in the obligately aceticlastic methanogens. Phylogenetic analysis showed that the methyl-group oxidation-involving proteins, Fwd, Mtd, Mch, and Mer from Methanosaeta strains cluster with the methylotrophic methanogens, and were not closely related to those from the hydrogenotrophic methanogens. Quantitative PCR detected the expression of all genes for this pathway, albeit ten times lower than the genes for aceticlastic methanogenesis in strain 6Ac. Western blots also revealed the expression of fwd and mch, genes involved in methyl-group oxidation. Moreover, 13C-labeling experiments suggested that the Methanosaeta strains might use the pathway as a methyl oxidation shunt during the aceticlastic metabolism. Because the mch mutants of Methanosarcina barkeri or M. acetivorans failed to grow on acetate, we suggest that Methanosaeta may use methyl-group oxidation pathway to generate reducing equivalents, possibly for biomass synthesis. An fpo operon, which encodes an electron transport complex for the reduction of CoM-CoB heterodisulfide, was found in the three genomes of the Methanosaeta strains. However, an incomplete protein complex lacking the FpoF subunit was predicted, as the gene for this protein was absent. Thus, F420H2 was predicted not to serve as the electron donor. In addition, two gene clusters encoding the two types of heterodisulfide reductase (Hdr), hdrABC, and hdrED, respectively, were found in the three Methanosaeta genomes. Quantitative PCR determined that the expression of hdrED was about ten times higher than hdrABC, suggesting that hdrED plays a major role in aceticlastic methanogenesis.

Introduction

Methanogenic Archaea are the only organisms known to produce abundant CH4 for energy metabolism. Therefore, they exert a significant ecological impact on global carbon cycling. Cultured methanogens are categorized into four metabolic types based on methanogenic precursors, including hydrogenotrophic, methylotrophic, aceticlastic and methanol plus H2 methanogenesis [1]. Since an estimated two-thirds of the methane in nature is from acetate [2], aceticlastic methanogenesis makes a major contribution to global methane production. So far, the methanogens utilizing acetate for methanogenesis are confined to the order Methanosarcinales. The genus Methanosarcina (Msr.) consists of the most metabolically diverse methanogenic species, most of them conduct three types of methanogenic metabolism [3]. In general, Methanosarcina strains have large genomes, e.g. 5.8 Mb for Msr. acetivorans, 4.8 Mb for Msr. barkeri and 4.1 Mb for Msr. mazei [4], [5], [6], and are about two times larger than other sequenced methanogen genomes.

In contrast, species of the other genus of aceticlastic methanogens Methanosaeta are obligately aceticlastic. As specialists, Methanosaeta strains possess a higher affinity for acetate than Methanosarcina stains and are favored in environments with low concentrations of acetate [7]. Hence, they are deemed the principal players in aceticlastic methanogenesis in nature.

Thus far, only three Methanosaeta species have been cultured. M. harundinacea is a mesophilic species isolated from an upflow anaerobic sludge blanket reactor treating beer-manufacturing wastewater in Beijing [8]. To gain insight into the genetic background of the aceticlastic methanogens, the complete genome of M. harundinacea 6Ac was sequenced and compared to that of the two other species. In addition to the other common genome characteristics among the three species, unexpectedly the methyl-group oxidation pathway was present in all three genomes. In methylotrophic methanogens, this pathway provides reducing equivalents for methanogenesis [9]. It also plays a role in the anaerobic oxidation of methane [10], [11]. To understand the possible function of the pathway, in this study, the expression of the genes in the pathway was tested in M. harundinacea 6Ac. The gene expression and the preliminary physiological study suggest that the methyl-group oxidation pathway can be used to generate the extra reducing equivalents in the obligate aceticlastic methanogens.

Results and Discussion

General genome features of Methanosaeta species

In this study, the complete genome of Methanosaeta harundinacea 6Ac, which contains a single circular chromosome and a circular plasmid designated as pH 6AC, was obtained. The chromosome is 2,559,043 bp in length with an average G+C content of 60.6% (Figure 1). It contains one rRNA operon (5S, 16S, and 23S), a distinct 7S rRNA gene, and 39 tRNA genes (Table 1). There are 2,353 coding sequences (CDSs) with an average length of 937 bp in the chromosome, representing 85% of the entire genome. Of the protein-coding genes, 69.7% of the CDSs (1,640) were assigned to the functional categories of Cluster of Orthologous Groups (COG). Approximately 22.4% (528/2,353) of the chromosomal gene products are hypothetical proteins, accounting for the majority of the M. harundinacea-specific genes (226/305) when compared with other available Methanosarcinales genomes. The plasmid pH 6AC is 11,991 bp in length and carries 18 predicted ORFs, with 16 of these encoding hypothetical proteins.

Figure 1. Circular representation of the M. harundinacea genome.

Figure 1

Open in a new tab

The circles show (innermost to outermost): (1) GC skew; (2) G+C content; (3) genes included in the genome of M. harundinacea but not in the genomes of M. concilii and M. thermophila; (4) genes involved in methane metabolism; (5) genes found in all the three Methanosaeta genomes; (6) core genes found in the methanogen genomes sequenced; (7) RNA genes, including tRNA (red) and rRNAs (yellow); (8) genes on the plus and minus strand, respectively. All the genes were colored by functional categories according to COG classification.

Table 1. General genome features of the aceticlastic methanogens, Methanosaeta spp. and Methanosarcina spp.

General Msa. harundinacea Msa. concilii Msa. thermophila Msr. acetivorans Msr. barkeri Msr. mazei
GenBank accession no. CP003117 NC_015416 NC_008553 NC_003552 NC_007355 NC_00391
Size (bp) 2,559,043 3,008,626 1,879,471 5,751,492 4,837,408 4,096,345
G+C content (%) 60.63 51 53.5 42.7 39.2 41.5
Protein-coding genes 2,353 2,906 1,781 4,540 3,698 3,371
Coding Regions (%) 81 83 82 74 70 75
rRNA operons 1 2 2 3 3 3
tRNA genes 39 44 48 59 62 57
Plasmid 1 1 0 1 1 0
Open in a new tab

Abbreviations: Msa., Methanosaeta; Msr., Methanosarcina.

A genome sequence comparison analysis for the three Methanosaeta strains, M. concilii GP6, M. thermophila PT, and M. harundiacea 6Ac, did not reveal an obvious colinearity. However, a remarkable difference among the three Methanosaeta species was observed in terms of the genome sizes, resulting in the difference in gene content (Table 1), with M. thermophila PT having the smallest genome, and M. concilii having more genes in category of DNA replication, recombination and repair, which is contributed by the multiple copies of the genes in this category. The coding regions in the three genomes of the Methanosaeta strains (>80%) account for the higher percentage of total genes compared to those of the Methanosarcina strains (70–75%).

Comparison of the gene function categories among the three species (Table 2) showed that while the two mesophilic strains contain similar gene numbers in each functional category, the thermophilic one has remarkably reduced gene numbers in cell motility and secretion, defense systems, and post-translational modification (PTM). This is probably consistent with its hot niche, where the biodiversity is relatively lower.

Table 2. Gene numbers in each functional category present in the three genomes of Methanosaeta.

Category of Function M. harundinacea M. concilii M. thermophila
Amino acid transport and metabolism 137 148 107
Carbohydrate transport and metabolism 55 58 47
Cell division and chromosome partitioning 16 19 10
Cell envelope biogenesis, outer membrane 58 85 57
Cell motility and secretion 11 14 5
Coenzyme metabolism 127 130 106
Defense mechanisms* 30 32 15
DNA replication, recombination, and repair 104 266 97
Energy production and conversion 165 164 122
General function prediction only 291 318 191
Inorganic ion transport and metabolism 136 160 94
Intracellular trafficking and secretion 16 25 14
Lipid metabolism 24 29 22
Nucleotide transport and metabolism 59 53 48
Posttranslational modification 93 100 58
Secondary metabolites biosynthesis 16 19 11
Signal transduction mechanisms 37 33 30
Transcription 85 104 65
Translation, ribosomal structure and biogenesis 157 152 145
Unknown Function 274 307 188
No homolog 439 592 244
Open in a new tab
*

, Proteins in this category could enable an organism to resist exogenous compounds and genetic materials, thus prevent environment damages and maintain the genetic stability [33], [45].

A suite of genes for the methyl-group oxidation pathway present in the Methanosaeta genomes

It has been long determined that Methanosaeta strains are obligately aceticlastic methanogens, acetate being the exclusive substrate for CH4 formation and energy biosynthesis. However, an entire suite of genes for methyl-group oxidation pathway was found in the three genomes. Two types of formylmethanofuran dehydrogenase, tungsten formylmethanofuran dehydrogenase (Fwd) and the molybdenum isoenzyme (Fmd), were found. As shown in Figure 2, M. thermophila possesses only the tungsten formylmethanofuran dehydrogenase genes, implying that the tungsten formylmethanofuran dehydrogenase is essential for these methanogens. This assumption could be supported by the observation of Hochheimer et al. [12] that the tungsten enzymes are constitutively expressed, while the molybdenum ones show a molybdate-induced expression in two thermophilic methanogens Methanothermobacter wolfeii and Methanothermobacter thermoautotrophicus.

Figure 2. Gene organizations of formylmethanofuran dehydrogenase (fmd or fwd) in the genomes of M. harundinacea (A), M. concilii (B), and M. theromphila (C) compared with those in the genomes of Msr. mazei (D), Msr. barkeri (E) and Msr. acetivorans (F).

Figure 2

Open in a new tab

Like the genes in hydrogenotrophic methanogens, only one gene copy is present for each of formylmethanofuran-tetrahydromethanopterin formyltransferase (Ftr), N5N10-methenyl-tetrahydromethanopterin cyclohydrolase (Mch), F420-dependent N5N10-methylene-tetrahydromethanopterin dehydrogenase (Mtd), and F420-dependent N5N10-methylene- tetrahydromethanopterin reductase (Mer).

To gain an insight into the gene organization for methyl-group oxidation pathways in the Methanosaeta genome, we found that genes for the formylmethanofuran dehydrogenase complex were arranged differently in the three strains. While the three operons for the Fwd complex in M. harundinacea 6Ac are arrayed in a similar pattern to those of Methanosarcina spp., only two fmd/fwd operons were present in M. concilii and M. thermophila, with additional fwdE genes scattered on the chromosomes (Figure 2).

Based on the protein phylogenetic analysis, we found that genes encoding Fwd, Mtd, Mch, and Mer, from the three Methanoseata strains were closely related with those from the methylotrophic methanogens, which branched off from those of the hydrogenotrophic methanogens (Figure 3A). However, other proteins that functioned in different methanogenic pathways did not form similar clades (Figure 3B). The different phylogenetic clustering patterns for the proteins can be attributed to their varied roles, such as Fwd, Mtd, Mch, and Mer in the methylotrophic methanogens mainly act in methyl oxidation, while in the hydrogenotrophic methanogens they are involved in CO2 reduction to methane formation.

Figure 3. Phylogeny of enzymes from the pathway of methanogenesis.

Figure 3

Open in a new tab

A. representative enzymes from the C-1 branch. B. other representative enzymes. a. Formylmethanofuran-tetrahydromethanopterin formyltransferase (Ftr), b. N5N10-methenyl-tetrahydromethanopterin cyclohydrolase (Mch), c. F420-dependent N5N10-methylene-tetrahydromethanopterin dehydrogenase (Mtd), d. and F420-dependent N5N10-methylene- tetrahydromethanopterin reductase (Mer), e. methyltetrahydrosarcinapterin: CoM methyltransferase A (MtrA), f. MtrH. Protein sequences were aligned with ClustalX [43] and phylogenetic analysis was performed with MEGA [44] using the neighbor-joining algorithm. Bootstrap support was obtained from neighbor-joining (first value), maximum-parsimony (second value) and maximum-likelihood (third value) methods based on 1000 replicates. The accession number of each reference sequence is shown in table S2. Framed sequences refer to those involved in the methyl methanogenesis pathway. The bar represents 10% estimated sequence divergence.

Genes encoding the proteins involved in methyl-group oxidation pathway expressed but at relatively low levels

To examine whether the genes for methyl-group oxidation pathway were expressed during growth, transcription of the genes in M. harundinacea 6Ac was detected by means of quantitative PCR. The assay showed that the transcript abundances were at an average level of about 14% equivalence to that of the N5-methyl-H4SPT: CoM methyltransferase (mtr) genes (Table 3), but were 1.58 times above the average levels of the total genes based on microarray data (unpublished data). Furthermore, Western blot also determined the expression of the C subunit of Fwd and Mch in the acetate-growing culture of M. harundinacea 6Ac (Figure 4). Therefore, an active methyl-group oxidation pathway was present in strain 6Ac even during aceticlastic growth.

Table 3. Transcript abundance of the genes for methyl-group oxidation pathway in M. harundinacea 6Ac estimated by QPCR.

Gene Gene product Relative Expression*
Mhar_0751 Acs 15.6±1.7
Mhar_0789 CdhA 14.6±1.3
Mhar_2323 CdhD 12.4±1.2
Mhar_0495 McrB 131±9
Mhar_0498 McrA 128±11
Mhar_2090 MtrE 15.6±2.2
Mhar_2091 MtrD 14.3±1.6
Mhar_2092 MtrC 15.7±1.8
Mhar_2093 MtrB 14.9±1.6
Mhar_2094 MtrA 14±1.2
Mhar_2095 MtrF 13.5±1.1
Mhar_2096 MtrG 14.8±1.4
Mhar_2097 MtrH 16±1.6
Mhar_0792 HdrE 7±0.6
Mhar_0793 HdrD 13±0.7
Mhar_0604 HdrB 2.1±0.3
Mhar_0605 HdrC 1.7±0.2
Mhar_0607 HdrA 2.5±0.3
Mhar_0373 FwdC 3.6±0.6
Mhar_0374 FwdA 2.8±0.5
Mhar_0375 FwdB 0.8±0.1
Mhar_0376 FwdD 0.7±0.1
Mhar_1283 FwdB 2.1±0.3
Mhar_1284 FwdD 2.4±0.3
Mhar_1285 FwdC 0.8±0.1
Mhar_1286 FwdA 4.3±0.7
Mhar_1287 FwdF 3.4±0.5
Mhar_1288 FwdE 1.1±0.2
Mhar_1285 FwdC 0.8±0.1
Mhar_1286 FwdA 4.3±0.7
Mhar_1287 FwdF 3.4±0.5
Mhar_1288 FwdE 1.1±0.2
Mhar_2214 Ftr 1.4±0.2
Mhar_2174 Mch 1.7±0.3
Mhar_1470 Mtd 1.0±0.2
Mhar_0856 Mer 3.4±0.6
Open in a new tab
*

, copy number of gene/copies of 16S rRNA gene×105.

Figure 4. Western blot assays for FwdC (A), Mch (B) and McrA (C).

Figure 4

Open in a new tab

Lane 1, 5 and 9, 0.2 µg purified FwdC, Mch and McrA as the positive control; lane 2, 6 and 10, 10 µg cell extract from the pre-exponential phase culture; lane 3, 7 and 11, 10 µg cell extract from the exponential phase culture; lane 4, 8 and 12, 5 µg cell extract from the stationary phase culture. The molecular masses of subunit FwdC, Mch and McrA are about 27.5 kDa, 34 kDa, and 61 kDa, respectively. The migrations of molecular mass standards are shown on the left of pictures.

Methyl-group oxidation pathway could act as a methyl oxidation shunt of acetate in Methanosaeta strains

To reveal the possible function of the methyl-group oxidation pathway in the obligate aceticlastic methanogens, 13CH4 or NaH13CO3 was added to cultures of strain 6Ac to determine if trace methane oxidation or production occurred. However, neither the 13CO2 in the 13CH4 supplemented culture nor the 13CH4 in the NaH13CO3 supplemented culture was detected after 60 days of incubation. These tests indicated that the methyl-group oxidation pathway in M. hurandiacea 6Ac was not used for trace methane oxidation or production. Cultures were then supplemented with 1-13C-labeled acetate or 2-13C-labeled acetate. Upon acetate depletion by incubation at 37°C for 60 days, as expected in the [1-13C] acetate-culture only labeled 13CO2 but not 13CH4 was found. Surprisingly, in the [2-13C] acetate-culture, 13CH4 and 13CO2 were both detected. The generated 13CO2 accounted for about 1% of the methyl carbon of acetate (Table 4). This suggested that 1% methyl carbon of acetate was oxidized to CO2 through methyl-group oxidation pathway in the obligate aceticlastic Methanosaeta strains. This oxidative carbon flux shunt, like in methylotrophic methanogenesis, was probably used by Methanosaeta strains to generate essential reducing equivalents such as reduced ferredoxin or reduced F420 for other biological processes, e.g. cell biomass synthesis. This hypothesis is supported by the fact that Msr. barkeri and Msr. acetivorans fail to grow on acetate upon inactivation of mch, which is required for methyl group oxidation [13].

Table 4. Percentage of 13C-labeled acetate, 13C-labeled CO2 and 13C-labeled CH4 formation in the 60-day cultures in a medium with 5% 13C-labeled acetate, NaHCO3 or CH4.

Labeled substances added acetate CO2 CH4
[13C/(12C+13C), (%)]
Control 1.0706±0.0004 1.0779±0.0008 1.0648±0.0006
13CH4 1.0713±0.0006 1.0774±0.0007 4.6393±1.5682
13CH3COO2 − 5.0329±0.2512 1.1072±0.0203 5.1261±0.5427
CH3 13COO2 − 4.7927±0.3382 4.2723±0.7236 1.0661±0.0005
H13CO3 − 1.0715±0.0007 4.0664±0.8178 1.0706±0.0007
Open in a new tab

Characteristics of the genes involved in aceticlastic methanogenesis pathways in Methanosaeta strains

Acetate in undissociated form (pKa = 4.75, 25°C) is believed to diffuse freely across the cytoplasmic membrane of bacteria [14]. However, under neutral pH, in which Methanosaeta strains grow optimally, acetate is present in a dissociated state, thus, a transport protein is necessary. A putative acetate transporter, the Ady2 gene (Mhar_0433), was present in the three Methanosaeta genomes and has been identified as an active acetate transporter in Saccharomyces cerevisiae based on microarray analyses of an ady2Δ strain [15].

It is believed that the first reaction, i.e. acetate activation to acetyl-CoA, is a rate-limiting reaction for aceticlastic methanogenesis [16], [17]. Acetate activation is accomplished through different reactions in the two types of aceticlastic methanogens, i.e. Methanosaeta strains use AMP-forming acetyl-CoA synthetase (ACS), while Methanosarcina spp. employ the combined actions of acetate kinase (AK) and phosphotransacetylase (PTA). Surprisingly, three to five acs gene homologs were identified in the genomes of Methanosaeta spp., and most of them were organized in tandem (Figure 5). Quantitative PCR assay showed that the three acs genes in M. harundinacea 6Ac were expressed differentially. The abundance of acs2 (Mhar_0751) and acs3 (Mhar_0752) transcripts were about nine fold higher than those of acs1 (Mhar_0749) (Table 3). This suggests that acs2 and acs3 might be the key proteins for aceticlastic methanogenesis, while acs1 may be more highly expressed under growth conditions not examined here. As biochemically characterized, following the acetate activation step, Methanosarcina and Methanosaeta employ the same enzymes in the remaining reactions in aceticlastic methanogens. The corresponding genes encoding the proteins involved in those reactions are all present in the three Methanosaeta genomes; these include the genes for the carbon monoxide dehydrogenase/acetyl-CoA decarbonylase complex (CODH/ACDS), methyltetrahydrosarcinapterin: CoM methyltransferase (Mtr), methyl-CoM methylreductase (Mcr), and heterodisulfide reductase (Hdr).

Figure 5. Organization of acs genes in M. concilii (A), M. thermophila (B), and M. harundinacea (C).

Figure 5

Open in a new tab

Closest homologs between species are indicated by the identical patterns.

Differential expression of two operons encoding two types of heterodisulfide reductase

As in the Methanosarcinales genomes, two gene classes of coenzyme B-coenzyme M heterodisulfide reductase, hdrABC and hdrED, are present in the genomes of Methanosaeta strains. Quantitative PCR assay showed that the transcript abundances of hdrED are about ten times higher than those of hdrABC in strain 6AC (Table 3), indicating that hdrED is the primary Hdr in methanogenesis in M. harundinacea 6AC. According to that HdrA1B1C1 is used specifically in the methylotrophic methanogenesis pathway in Methanosarcina acetivorans [18], we hypothesize that hdrED and hdrABC obtain reducing equivalents from CODH and the methyl-group oxidation in Methanosaeta strains, respectively; and those obtain from methyl-group oxidation by hdrABC can be used to compensate the biosynthesis-consumed reducing equivalents.

An fpo operon for a truncate electron transport complex possibly functions in the reduction of CoM-CoB heterodisulfide

In Methanosarcina species, a heterodisulfide reductase is involved in releasing coenzyme M and coenzyme B from the heterodisulfide using reduced ferredoxin as electron donor as well as energy conservation in acetate metabolism [19]. To implement this biochemical reaction, Msr. mazei and Msr. barkeri employ the Ech complex and F420 non-reducing hydrogenase, while Msr. acetivorans uses the Rnf-like complex [20]. However, neither the genes for Ech nor the Rnf-like complex were found in the three Methanosaeta genomes; instead, a gene cluster comprised of 11 genes (Mhar_1410-Mhar_1420) for a F420H2 dehydrogenase (Fpo) complex was present in the three genomes.

The F420H2 dehydrogenase complex (Fpo) functions specifically in methylotrophic methanogenesis in Methanosarcina spp. and the obligate methylotrophic methanogens, like Methanohalophilus mahii [21]. However, no gene for the FpoF subunit was found in the three genomes. This cytoplasmic protein accepts reducing equivalents from F420H2. Welte and Deppenmeier (2011) determined that M. thermophila uses reduced ferredoxin to reduce coenzyme M-coenzyme B heterodisulfide and proposed that M. thermophila uses the Fd: heterodisulfide oxidoreductase encoded by an Fpo operon as the energy-conserving system [22]. The activity of Fd: heterodisulfide oxidoreductase was also detected in the membrane fraction of an Msr. mazei Δ ech mutant [23], implying that other protein complexes, like the Fpo complex, may complete the activity in place of Ech.

Materials and Methods

DNA extraction

Methanosaeta harundinacea 6AcT ( = JCM 13211, CGMCC 1.5026, and DSM 17206) was isolated from a UASB reactor in our lab, the strain information and growth conditions were described previously [7]. Cells were harvested by centrifugation at 15,000×g for 15 min at 4°C from 1000 ml culture. The cell pellets were frozen at −80°C. Then the frozen cell pellets were placed into a sterile, pre-cooled mortar and put into liquid N2. After the liquid N2 had evaporated, the cells were ground to a powder with a rod. Upon being ground 5 times, the genomic DNA was extracted using the TIANamp Bacteria DNA Kit (TIANGEN Biotech, Beijing, China). The genomic DNA was quantified on 0.8% agarose gel stained with ethidium bromide and spectrophotometrically assessed.

Genome sequencing, assembly, and gap closure

The genome sequence of Methanosaeta harundinacea 6AcT was determined using the Roche GS 454 system [24]. 220,740 reads containing up to 52,294,588 bases (averaged read length as 236 bp), were obtained resulting in a 26-fold coverage of the genome. Assembly was performed using the GS de novo Assembler software (http://www.454.com/) producing 62 contigs ranging from 500 bp to 160,686 bp (the N50 contig size is 92,019 bp). The relationship of the contigs was determined by multiplex PCR [25]. Gaps were then closed by sequencing the PCR products using ABI 3730xl capillary sequencers. Phred, Phrap, and Consed software packages (http://www.phrap.org/phredphrapconsed.html) were used for the final assembly and editing. Low quality regions of the genome were resequenced.

Genome analysis and annotation

Putative CDSs were identified by GeneMark [26] and Glimmer [27]. Peptides shorter than 30 aa were eliminated. Sequences from the intergenic regions were compared to GenBank's non-redundant (nr) protein database [28] to detect pseudogenes and to identify genes missed by the Glimmer or GeneMark prediction. Insert sequences were first detected using the IS Finder database (http://www-is.biotoul.fr/is.html) with default parameters selected manually. Transfer RNA genes were predicted by tRNAScan-SE [29], while ribosomal DNAs (rDNAs) and other RNA genes were identified by comparing the genome sequence to the rRNA database [30] using the Infernal program [31]. Functional annotation of CDSs was performed through searching against the nr protein database using BLASTP [32]. The protein set was also searched against the COG (http://www.ncbi.nlm.nih.gov/COG/) [33] and KEGG (Kyoto encyclopedia of genes and genomes; http://www.genome.jp/kegg/) [34] databases for further function assignment. The criteria used to assign function to a CDS were (1) a minimum cutoff of 40% identity and 60% coverage of the protein length and (2) at least two best hits among the COG, KEGG, or nr protein database. A search for gene families in the genome was performed by BLASTCLUST. Subcellular localization of the proteins was predicted by the PSORTb program (v2.0.1) [35]. The TatP 1.0 server (v2.0) [36] and TATFIND 1.2 program [37] were used to detect the potential substrates of the Tat secretion system.

Data availability

The sequence and annotation of the M. harundinacea chromosome and the plasmid were submitted to the GenBank database under accession numbers CP003117 and CP003118, respectively.

RNA isolation and qRT-PCR

M. harundinacea 6Ac was grown in conditions described previously [8]. The cells were harvested for RNA isolation during the logarithmic growth phase at an OD600 nm of 0.35–0.45. Total RNA was extracted using TRIzol® Reagent (Invitrogen) according to the manufacturer's instructions, modifications of the method included grinding in liquid nitrogen before TRIzol reagent was added. RNA was further purified by following the RNA cleanup protocol of the RNeasy Mini Kit (Qiagen). Contaminating DNA was digested twice with 0.1–0.2 U·µl−1 DNase I (Promega), according to the manufacturer's instructions, including 0.4–0.8 U·µl−1 RNasin (Promega) in the reaction. RNA was purified for a second time using the RNeasy Mini Kit prior to cDNA synthesis. 210–350 ng RNA and 500 ng random hexamers (Promega) were incubated for 10 min at 70°C, and subsequently cooled on ice. Synthesis of cDNA was performed in 1 mM of each dNTP (Promega), 16 U·µl−1 M-MLV reverse transcriptase (RNase H Minus, Point Mutation, Promega), 1.6 U·µl−1 RNasin Inhibitor (Promega) and one fold concentrated first strand buffer (Promega) for 10 min at room temperature, followed by 50 min at 45°C. Real-time PCR oligonucleotide primers (Table S1) were designed using the software Beacon Designer 5.0 (Premier Biosoft, Palo Alto, USA) to obtain maximal amplification efficiency and sensitivity. The specificity of primers was verified by evaluating the qPCR melting curve and PCR products by DNA gel electrophoresis. For quantification of gene expression, a DNA fragment including the target gene was amplified by PCR and quantified using a UV800 spectrophotometer (Beckman). These fragments were then serially diluted 10-fold (10−3–10−9) to be used for the standard curve, which was performed in triplicate.

Transcript quantification was performed using an ABI 7000 SDS® (Applied Biosystems™) with SYBR Green supermix (TAKARA, Dalian, China) using the following thermocycling program: 40 cycles of 95°C for 10 s and 60°C for 30 s. The copy number in each cDNA sample was calculated according to the calibration curve generated by the PCR products including the target gene.

Western blot for the proteins participating in methyl-group oxidation pathway

For antibody production, FwdC, Mch, and McrD were heterologously produced in E. coli DH5α. The fwdC (Mhar_0373), mch (Mhar_2174), and mcrD (Mhar_0496) genes were cloned into pET-28a. PCR amplification was performed using Pfu DNA polymerase (Promega, Madison, USA). The fwdC, mch, and mcrD PCR fragments were generated with the primers 5′- GGGTGGTCCATATGAGGGAGATCA -3′ and 5′- TGTCAAAGCTTCAGGCCTCCAGGGA-3′; 5′-AAACATATGCTAGACTACGCCGAT-3′ and 5′- ATAAAGCTTAACCTTCACGGTTGG-3′; 5′-AATACATATGGTCACTAAATCA- GACACG-3′ and 5′- GAATTCATGTGTCACCGCCTG- 3′, respectively. The resulting construct was checked by sequencing (Biosune, Beijing, China). Then protein production was induced and purified as described previously [38]. Polyclonal antibodies against FwdC, McrD, and Mch were prepared at the Laboratory Animal Center, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, by injecting rats with the three purified recombinant proteins.

M. harundinacea 6Ac cells at different growth phases were harvested by centrifugation at 12,000×g and washed three times with PBS buffer. Cell suspensions were lysed by sonication and centrifuged at 21,000×g to obtain the cell fractions. Supernatant fractions were used as all protein of cell extract. The fractions were subjected to SDS-PAGE on a 12% gel and then transferred to nitrocellulose membranes (Amersham, Little Chalfont, UK). Western blot and immunodetection were performed as described previously [39]. The non-specific binding of antibodies was blocked by incubation with Tris-buffered saline and Tween-20 (TBST) with 5% skim milk. Membranes were then probed with a 1,000-fold dilution of the following polyclonal antibodies: rat anti-FwdC, rat anti-Mch, and rat anti-McrD. Bound antibodies were visualized using goat anti-rat IgG (Cwbio, China) conjugated to horseradish peroxidase (HRP), followed by enhanced chemiluminescence (Amersham) according to manufacturer's instructions

Incorporation of 13C-labeled acetate, methane, and bicarbonate

M. harundinacea was cultured in basal medium omitting NaHCO3 containing 50 mM acetate by following the procedure previously described [8]. The 13C labeled acetate or 13C labeled bicarbonate was added to the culture at a final concentration of 5% (w/w) of non-labeled substrate. Cells were cultured in 100-ml serum vials containing 50 ml of medium (pH 7.0 at 25°C) under an atmosphere of N2 and incubated at 37°C. Methane and acetate were determined by gas chromatograph GC-14B (Shimadzu) and CO2 was determined by gas chromatograph GC-14C (Shimadzu) [8], [40]. The stable isotope composition was determined by Trace GC/IsoLink/Delta V Advantage GC/IRMS (Thermo Fisher Scientific, Bremen, Germany) [41], [42].

Supporting Information

Table S1

The primers used in this study.

(DOC)

Click here for additional data file. (49.5KB, doc)
Table S2

The accession numbers of the proteins included in Figure 3 .

(DOC)

Click here for additional data file. (156KB, doc)

Footnotes

Competing Interests: The authors have declared that no competing interests exist.

Funding: Funding was provided by the National Natural Science Foundation of China under grant no. 30621005 and 30830007 (www.nsfc.gov.cn). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Deppenmeier U, Lienard T, Gottschalk G. Novel reactions involved in energy conservation by methanogenic archaea. FEBS letters. 1999;457:291–297. doi: 10.1016/s0014-5793(99)01026-1. [DOI] [PubMed] [Google Scholar]
  • 2.Ferry JG. Methane from acetate. J Bacteriol. 1992;174:5489–5495. doi: 10.1128/jb.174.17.5489-5495.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Welander PV, Metcalf WW. Loss of the mtr operon in Methanosarcina blocks growth on methanol, but not methanogenesis, and reveals an unknown methanogenic pathway. Proc Natl Acad Sci USA. 2005;102:10664–10669. doi: 10.1073/pnas.0502623102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Galagan JE, Nusbaum C, Roy A, Endrizzi MG, Macdonald P, et al. The genome of M. acetivorans reveals extensive metabolic and physiological diversity. Genome Res. 2002;12:532–542. doi: 10.1101/gr.223902. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Maeder DL, Anderson I, Brettin TS, Bruce DC, Gilna P, et al. The Methanosarcina barkeri Genome: Comparative Analysis with Methanosarcina acetivorans and Methanosarcina mazei Reveals Extensive Rearrangement within Methanosarcinal Genomes. J Bacteriol. 2006;188:7922–7931. doi: 10.1128/JB.00810-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Deppenmeier U, Johann A, Hartsch T, Merkl R, Schmitz RA, et al. The genome of Methanosarcina mazei: Evidence for lateral gene transfer between bacteria and archaea. J Mol Microbiol Biotechnol. 2002;4:453–461. [PubMed] [Google Scholar]
  • 7.Huser BA, Wuhrmann K, Zehnder AJB. Methanothrix soehngenii gen. nov. sp. nov., a new acetotrophic non-hydrogen-oxidizing methane bacterium. Arch Microbiol. 1982;132:1–9. doi: 10.1007/BF00407022. [DOI] [PubMed] [Google Scholar]
  • 8.Ma K, Liu X, Dong X. Methanosaeta harundinacea sp. nov., a novel acetate-scavenging methanogen isolated from a UASB reactor. Int J Syst Evol Microbiol. 2006;56:127–131. doi: 10.1099/ijs.0.63887-0. [DOI] [PubMed] [Google Scholar]
  • 9.Deppenmeier U, Müller V, Gottschalk G. Pathways of energy conservation in methanogenic archaea. Arch Microbiol. 1996;165:149–163. [Google Scholar]
  • 10.Moran JJ, House CH, Freeman KH, Ferry JG. Trace methane oxidation studied in several Euryarchaeota under diverse conditions. Archaea. 2005;1:303–309. doi: 10.1155/2005/650670. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Orphan VJ, House CH, Hinrichs KU, McKeegan KD, DeLong EF. Multiple archaeal groups mediate methane oxidation in anoxic cold seep sediments. Proc Natl Acad Sci USA. 2002;99:7663–7668. doi: 10.1073/pnas.072210299. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Hochheimer, A, Hedderich R, Thauer RK. The formylmethanofuran dehydrogenase isoenzymes in Methanobacterium wolfei and Methanobacterium thermoautotrophicum: induction of the molybdenum isoenzyme by molybdate and constitutive synthesis of the tungsten isoenzyme. Arch Microbiol. 1998;170:389–393. doi: 10.1007/s002030050658. [DOI] [PubMed] [Google Scholar]
  • 13.Guss AM, Mukhopadhyay B, Zhang JK, Metcalf WW. Genetic analysis of mch mutants in two Methanosarcina species demonstrates multiple roles for the methanopterin-dependent C-1 oxidation/reduction pathway and differences in H2 metabolism between closely related species. Mol Microbiol. 2005;55:1671–1680. doi: 10.1111/j.1365-2958.2005.04514.x. [DOI] [PubMed] [Google Scholar]
  • 14.Harold F. Conservation and transformation of energy by bacterial membranes. Bacteriol Rev. 1972;36:172–230. doi: 10.1128/br.36.2.172-230.1972. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Paiva S, Devaux F, Barbosa S, Jacq C, Casal M. Ady2p is essential for the acetate permease activity in the yeast Saccharomyces cerevisiae. Yeast. 2004;21:201–210. doi: 10.1002/yea.1056. [DOI] [PubMed] [Google Scholar]
  • 16.Aceti DJ, Ferry JG. Purification and characterization of acetate kinase from acetate-grown Methanosarcina thermophila. Evidence for regulation of synthesis. J Biol Chem. 1988;263:15444–15448. [PubMed] [Google Scholar]
  • 17.Terlesky KC, Barber MJ, Aceti DJ, Ferry JG. EPR properties of the Ni-Fe-C center in an enzyme complex with carbon monoxide dehydrogenase activity from acetate-grown Methanosarcina thermophila. Evidence that acetyl-CoA is a physiological substrate. J Biol Chem. 1987;262:15392–15395. [PubMed] [Google Scholar]
  • 18.Buan NR, Metcalf WW. Methanogenesis by Methanosarcina acetivorans involves two structurally and functionally distinct classes of heterodisulfide reductase. Mol Microbiol. 2010;75:843–853. doi: 10.1111/j.1365-2958.2009.06990.x. [DOI] [PubMed] [Google Scholar]
  • 19.Feist AM, Scholten JCM, Palsson B, Brockman FJ, Ideker T. Modeling methanogenesis with a genome-scale metabolic reconstruction of Methanosarcina barkeri. Mol Syst Biol. 2006;2:2006.0004. doi: 10.1038/msb4100046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Li Q, Li L, Rejtar T, Lessner DJ, Karger BL, et al. Electron transport in the pathway of acetate conversion to methane in the marine archaeon Methanosarcina acetivorans. J Bacteriol. 2006;188:702–710. doi: 10.1128/JB.188.2.702-710.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Spring S, Scheuner C, Lapidus A, Lucas S, Glavina DRT, et al. Archaea; 2010. The genome sequence of Methanohalophilus mahii SLP(T) reveals differences in the energy metabolism among members of the Methanosarcinaceae inhabiting freshwater and saline environments. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Welte C, Deppenmeier U. J bacteriol: Adv Clin Path. In press; 2011. Membrane-bound electron transport in Methanosaeta thermophila. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Welte C, Kallnik V, Grapp M, Bender G, Ragsdale S, et al. Function of Ech hydrogenase in ferredoxin-dependent, membrane-bound electron transport in Methanosarcina mazei. J bacteriol. 2010;192:674–678. doi: 10.1128/JB.01307-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Margulies M, Egholm M, Altman WE, Attiya S, Bader JS, et al. Genome sequencing in open microfabricated high density picoliter reactors. Nature. 2005;437:376–380. doi: 10.1038/nature03959. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Tettelin H, Radune D, Kasif S, Khouri H, Salzberg SL. Optimized multiplex PCR: efficiently closing a whole-genome shotgun sequencing project. Genomics. 1999;62:500–507. doi: 10.1006/geno.1999.6048. [DOI] [PubMed] [Google Scholar]
  • 26.Lukashin AV, Borodovsky M. GeneMark. hmm: new solutions for gene finding. Nucleic Acids Res. 1998;26:1107–1115. doi: 10.1093/nar/26.4.1107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Delcher AL, Harmon D, Kasif S, White O, Salzberg SL. Improved microbial gene identification with GLIMMER. Nucleic Acids Res. 1999;27:4636–4641. doi: 10.1093/nar/27.23.4636. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Emanuelsson O, Brunak S, von Heijne G, Nielsen H. Locating proteins in the cell using TargetP, SignalP and related tools. Nat Protoc. 2007;2:953–971. doi: 10.1038/nprot.2007.131. [DOI] [PubMed] [Google Scholar]
  • 29.Lowe TM, Eddy SR. tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 1997;25:0955–0964. doi: 10.1093/nar/25.5.955. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Wuyts J, Perri?re G, Van de Peer Y. The European ribosomal RNA database. Nucleic Acids Res. 2004;32:D101–D103. doi: 10.1093/nar/gkh065. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Nawrocki EP, Kolbe DL, Eddy SR. Infernal 1.0: inference of RNA alignments. Bioinformatics. 2009;25:1335–1337. doi: 10.1093/bioinformatics/btp157. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Altschul SF, Madden TL, Sch ffer AA, Zhang J, Zhang Z, et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 1997;25:3389–3402. doi: 10.1093/nar/25.17.3389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Tatusov RL, Koonin EV, Lipman DJ. A genomic perspective on protein families. Science. 1997;278:631–637. doi: 10.1126/science.278.5338.631. [DOI] [PubMed] [Google Scholar]
  • 34.Kanehisa M, Goto S. KEGG: Kyoto encyclopedia of genes and genomes. Nucl Acids Res. 2000;28:27–30. doi: 10.1093/nar/28.1.27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Gardy JL, Laird M, Chen F, Rey S, Walsh C, et al. PSORTb v. 2.0: expanded prediction of bacterial protein subcellular localization and insights gained from comparative proteome analysis. Bioinformatics. 2005;21:617–623. doi: 10.1093/bioinformatics/bti057. [DOI] [PubMed] [Google Scholar]
  • 36.Bendtsen J, Nielsen H, Widdick D, Palmer T, Brunak S. Prediction of twin-arginine signal peptides. BMC Bioinformatics. 2005;6:167. doi: 10.1186/1471-2105-6-167. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Dilks K, Rose R, Hartmann E, Pohlschroder M. Prokaryotic utilization of the twin-arginine translocation pathway: a genomic survey. J Bacteriol. 2003;185:1478–1483. doi: 10.1128/JB.185.4.1478-1483.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Li J, Cai S, Luo Y, Dong X. Three feruloyl esterases in Cellulosilyticum ruminocola H1 act synergistically to hydrolyze esterified polysaccharides. Appl Environ Microbiol. 2011;77:6141–6147. doi: 10.1128/AEM.00657-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Egwuagu CE, Charukamnoetkanok P, Gery I. Thymic expression of autoantigens correlates with resistance to autoimmune disease. J Immunol. 1997;159:3109–3112. [PubMed] [Google Scholar]
  • 40.Zhu J, Liu X, Dong X. Methanobacterium mobile sp. In: nov, nov Methanobacteriumflexilesp, Basin isolatedfromthelakesedimentofQaidam., editors. China. Int J Syst Evol Microbiol: Adv Clin Path. In press; 2011. [Google Scholar]
  • 41.Hattori R, Yamada K, Shibata H, Hirano S, Tajima O, et al. Measurement of the isotope ratio of acetic acid in vinegar by HS-SPME-GC-TC/C-IRMS. J Agric Food Chem. 2010;58:7115–7118. doi: 10.1021/jf100406y. [DOI] [PubMed] [Google Scholar]
  • 42.Serra F, Janeiro A, Calderone G, Rojas J, Rhodes C, et al. Inter-laboratory comparison of elemental analysis and gas chromatography combustion isotope ratio mass spectrometry (GC-C-IRMS). Part I: δ13C measurements of selected compounds for the development of an isotopic Grob-test. J Mass Spectrom. 2007;42:361–369. doi: 10.1002/jms.1168. [DOI] [PubMed] [Google Scholar]
  • 43.Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The CLUSTAL_X windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997;25:4876–4882. doi: 10.1093/nar/25.24.4876. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Tamura K, Dudley J, Nei M, Kumar S. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol. 2007;24:1596–1599. doi: 10.1093/molbev/msm092. [DOI] [PubMed] [Google Scholar]
  • 45.Tatusov R, Fedorova N, Jackson J, Jacobs A, Kiryutin B, et al. The COG database: an updated version includes eukaryotes. BMC Bioinformatics. 2003;4:41. doi: 10.1186/1471-2105-4-41. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Table S1

The primers used in this study.

(DOC)

Click here for additional data file. (49.5KB, doc)
Table S2

The accession numbers of the proteins included in Figure 3 .

(DOC)

Click here for additional data file. (156KB, doc)

Data Availability Statement

The sequence and annotation of the M. harundinacea chromosome and the plasmid were submitted to the GenBank database under accession numbers CP003117 and CP003118, respectively.

Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES