Survey of Virulence Determinants among Vancomycin Resistant Enterococcus faecalis and Enterococcus faecium Isolated from Clinical Specimens of Hospitalized Patients of North west of Iran

Abstract

Recent data indicates an increasing rate of vancomycin resistance in clinical enterococcal isolates worldwide. The nosocomial enterococci are likely to harbor virulence elements that increase their ability to colonize hospitalized patients. The aim of this study was to characterize virulence determinants in vancomycin-resistant enterococci (VRE) obtained from various clinical sources.

During the years 2008 to 2010, a total of 48 VRE isolates were obtained from three University teaching hospitals in Northwest, Iran. Initially, phenotypic speciation was done and minimum inhibitory concentrations (MICs) of vancomycin were determined by agar dilution method and E-test. Then, species identification and resistance genotypes along with detection of virulence genes (asa1, esp, gelE, ace and cpd) of the isolates were performed by multiplex PCR.

Thirty eight isolates were identified as vancomycin-resistant Enterococcus faecium (VREfm) and ten as E. faecalis (VREfs). Irrespective of the species, vanA gene (89.58%) was dominant and three phenotypically vancomycin susceptible E. faecium isolates carried the vanB gene. Among virulence genes investigated, the esp was found in 27(71%) VREfm strains, but did not in any VREfs. Other virulence determinants were highly detected in VREfs strains. Our data indicate a high prevalence of E. faecium harboring vancomycin resistance with vanA genotype and the two VRE species displayed different virulence genes.

INTRODUCTION

Enterococci are Gram-positive intestinal commensals of humans and other animals, in addition to be an isolate from environmental sources. During the past decades an enhancement in the prevalence of enterococal infections such as bacteremia and urinary tract infections along with emergence of multi antimicrobial resistance, particularly VRE has been reported worldwide [1, 2].

Among vancomycin-resistance phenotypes in enterococci, VanA and VanB possess highest clinical importance. Strains resistant to vancomycin and teicoplanin were assigned to VanA phenotype while, those susceptible to teicoplanin but resistant to vancomycin were considered as the VanB phenotype [2]. The vanA and vanB gene clusters contain nine different genes for a two-component regulatory system (vanR and vanS), three resistance genes (vanH, encoding dehydrogenase; vanA or vanB, encoding ligase; vanX, encoding DD-dipeptidase); an accessory gene (vanY); and the vanZ gene, which is present in the vanA gene cluster whereas, the vanW gene is found only in the vanB operon. VanA is carried on Tn1546 whilst, VanB on transposons Tn1547 and Tn1549, which may be found on plasmids or inserted on the chromosome [3].

Despite the fact that E. faecalis has been observed as the predominant species in clinical infections, an increase in the prevalence of E. faecium has been seen recently [4]. This shift is likely to be explained in part by the emergence of vancomycin resistant enterococci (VRE) and E. faecium being the dominant detectable species among them [5]. Unfortunately, little is known about the pathogenic mechanisms or virulence factors of this microorganism [6]. Enterococcal infections may occur via the ability to persist on harsh environments due to their intrinsic properties and even these conditions may contribute largely to emergence of this organism as a nosocomial pathogen [7, 8]. The process of invasion is usually facilitated by damage to host tissues and the presence of bacterial virulence factors such as adhesins along with antibiotic resistance that gradually assist in advancement and furtive survival in newly infected place. At the next, enterococci utilize several virulence factors for adherence and colonization in the infection site by formation of cell aggregates such as biofilms [5, 9]. At the end, interactions between host and enterococci leads to the clinical manifestation of infection in target vital tissues [5].

By consideration of the fact that the presence of putative virulence determinants among clinical isolates may promote emergence of infections and persistence of enterococci in nosocomial locations causes an increase in antibiotic resistance and act as facilities for emerging infections [10, 11], this study was designed to survey distribution of virulence genes including asa1(aggregation substance), esp (Enterococcal surface protein), gelE (gelatinase), ace (collagen adhesion) and cpd (sex pheromones determinant) in clinical isolates of vancomycin resistant E. faecalis and E. faecium at molecular level. To our knowledge, this is the first report from the Northwest of Iran.

MATERIALS AND METHODOLOGY

VRE Isolates and Susceptibility Tests

Thirty-eight VREfm and 10 VREfs isolates, obtained from different clinical specimens submitted in three University teaching hospitals of Tabriz (Imam Reza and Sina Hospitals) and Orumieh (Imam Khomeini Hospital), Iran, between 2008 and 2010. The origins of isolates were as follows: urine 35 (72.91%), blood 5 (10.41%), wound 3(6.25%), body fluids 4(8.33%) and intravenous catheter 1(2.08%). Initially, these isolates were identified to the species level by conventional methods described previously [12] and then, multiplex PCR was used to detect vancomycin resistant vanA and vanB genes and also to confirm phenotypic speciation by targeting D-alanine– D-alanine ligases specific for E. faecalis (ddl_{E. faecalis}) and E. faecium (ddl_{E. faecium}) as developed by Kariyama et al., [13]. E. faecalis E206 (vanA⁺) and E. faecium E2781 (vanB⁺) (kindly provided by Dr. Eimaneini) was used as control strains.

For all isolates, MICs of vancomycin were determined by agar dilution method and E-test (BioMerieux, SA) according to the CLSI’s (2006) guidelines [14] and manufacturer’s recommendations, respectively. E. faecalis ATCC 29212 was used as a quality control strain on every occasion of susceptibility testing.

Detection of Virulence Genes by PCR

DNA extraction was performed by boiling method as described previously [15] and then by commercial kit (DNG^TM-Plus, CinnaGen, Iran). Multiplex PCR was performed on all enterococcal isolates for the detection of virulence determinants with specific primers for each gene (Table 1) with some modification on Vankerckhoven’s protocol [16]. Briefly, first 25µl master mix containing 2.5µl of bacterial suspension, 15pM of each primers for asa1 and gelE and 30 pM for esp, 1X PCR buffer, 2.0 mM MgCl₂, 0.2 mM each deoxynucleotide triphosphate (dATP, dCTP, dGTP, and dTTP) and 2.5 U of Taq DNA polymerase (CinnaGen, Iran). The second PCR mixture contained 10 pM of each primer for cpd and 4pM for ace, 1.5 mM MgCl₂ and additional rest of reagents mentioned in first master mix. Reactions for both mixtures were done on a thermal cycler (ASTEC-Japan) with an initial denaturation at 95°C for 10 min, 30 cycles of amplification (denaturation at 94°C for 1 min, annealing at 56°C for 1 min, and extension at 72°C for 1 min), and a final extension at 72°C for 10 min.

Table 1.

Primers used in this Study

Genes	Sequence (5' to 3')	Size(bp)	References
asa1	F1: GCACGCTATTACGAACTATGA R1: TAAGAAAGAACATCACCACGA	375	[15]
gelE	F2: TATGACAATGCTTTTTGGGAT R2: AGATGCACCCGAAATAATATA	213	[15]
esp	F7: AGATTTCATCTTTGATTCTTGG R7: AATTGATTCTTTAGCATCTGG	510	[15]
cpd	F8: TGGTGGGTTATTTTTCAATTC R8: TACGGCTCTGGCTTACTA	782	[29]
ace	F9: GGAATGACCGAGAACGATGGC R9: GCTTGATGTTGGCCTGCTTCCG	616	[14]
vanA	F14-CATGAATAGAATAAAAGTTGCAATA R14-CCCCTTTAACGCTAATACGATCAA	1030	[12]
vanB	F15-GTGACAAACCGGAGGCGAGGA R15-CCGCCATCCTCCTGCAAAAAA	433	[12]
E. faecalis	F16-ATCAAGTACAGTTAGTCTTTATTAG R16-ACGATTCAAAGCTAACTGAATCAGT	941	[12]
E. faecium	F17-TTGAGGCAGACCAGATTGACG R17-TATGACAGCGACTCCGATTCC	658	[12]

Amplicons were analyzed on a 1.5% agarose gel and a 100-bp DNA ladder was used as the molecular size marker. The gels were stained with ethidium bromide and photographed under UV light. Each PCR assay was accompanied with a negative control, containing all of the reagents without template DNA.

Statistical Analysis

Data were analyzed statistically using chi-square test and difference was considered significant at p<0.05 by SPSS software (version 18).

RESULTS

Most of VREs were isolated from intensive care units (ICUs) [16(33.3%)], nephrology [10(20.8%)] and internal [8(16.7%)] wards. Among VRE strains, thirty- five E. faecium harboured vanA gene and all of them revealed MICs≥ 256 µg/ml, except one (MIC=8µg/ml). Five vanA positive isolates did not show any studied virulence determinants. On the other hand, 3 E. faecium isolates carried vanB gene with MICs< 4 µg/ml and also, they were negative for all virulence determinants tested. However, VREfm isolates were found with the esp gene (71.05%).

All E. faecalis showed MICs ≥ 256 µg/ml and 8 isolates carried vanA gene while, in the two strains, neither vanA nor vanB gene were detected.

In comparison to E. faecium, vancomycin resistant E. faecalis strains were furnished with diverse combinations of virulence genes include: 4 strains presenting asa1, gelE, ace and cpd; 4 strains with asa1, gelE and cpd; 1 strain showed gelE, ace and cpd and another one displayed gelE and cpd. Among virulence genes studied, concomitant occurrence of gelE and cpd in all E. faecalis isolates was significant (p<0.001). Distribution of virulence genes among vancomycin resistant E. faecalis and E. faecium are shown in Table 2.

Table 2.

Distribution of Virulence Genes among Vancomycin Resistant E. faecalis and E. faecium Isolates

Virulence Genes	Vancomycin Resistant	Total (N=48)
	E. faecalis (N=10)                               E. faecium (N=38)
gelE	10 (100)                                    3(7.89)	13(27.08)
asa1	8 (80)                                     3(7.89)	11(22.91)
cpd	10(100)                                    1(2.63)	11(22.91)
ace	5(50)                                      1(2.63)	6(12.5)
esp	0(0)27                                     (71.05)	27(56.25)

DISCUSSION

This study investigated prevalence of virulence factors in vancomycin resistant enterococci. The majority of VREs were E. faecium (38 out of 48 VREs). Similar enhancement in the prevalence of VRE, especially E. faecium has been noticed earlier in several studies from different countries [17-19]. This increase has been attributed mainly to the occurrence and spread of vanA and vanB positive VRE, which exhibited some virulence factors such as Esp (esp), cytolysin (cyl), hyaluronidase (hyl) [10]. In comparison among various sources of Enterococci, the same as clinical samples, farm animals, water and food products, isolates from clinical specimens have been attributed to have the highest virulence factors [20, 21]. In this study, E. faecalis and E. faecium strains show significantly different patterns in the incidence of virulence determinants. Similar to study of Eaton et al., (2001), in our study, all E. faecalis strains harbored multiple virulence determinants.

The aggregation substance is a pheromone-inducible surface protein encoded by asa1 gene involved in adherence to eukaryotic cell [22], which may increase the hydrophobicity of the enterococcal cell surface that may delay or prevent fusion with lysosomal vesicles [23], cell aggregation and conjugation [24]. Various reports are available for the prevalence of asa1 in enterococcal isolates obtained from different sources. In this study 8 out of 10 E. faecalis harbored asa1 gene and majority (62.5%) of them were being isolated from urine specimen. Waar et al., (2002) reported high prevalence of asa1 in E. faecalis isolates from liver transplant and septicemic patients and assumed that asa1 might be associated with infection [25]. Baldassarri et al., [26] indicated presence of this gene in seven out of 11 E. faecalis from endocarditis, with only one strain being vanA positive. The present study also revealed this gene in 3 (7.89 %) VREfm isolates from UTI, whereas other studies did not find asa1 in E. faecium [16, 27, 28]. A much higher incidence (13%) has been reported by Elsner et al., [29] in clinical E. faecium isolated from blood culture. A study on food and medical isolates of enterococci showed the asa1 gene was always associated with the presence of pheromone determinants (cpd, cob, ccf and cad ) and only detected in E. faecalis [30]. Abriouel et al., (2008) reported high prevalence of cpd (89.7%) determinant in comparison of aggregation substance (58.97%) in clinical E. faecalis [28]. Similarly, we found the cpd gene in all VREfs, of them 80% were also asa1 positive (p<0.001). Meanwhile, we could find cpd in one VREfm, suggests that it is probably not associated with virulence in this species. The presence of sex pheromone determinant in E. faecium was reported earlier [31].

Gelatinase encoded by gelE is an extracellular metalloendopeptidase that hydrolyzes gelatin, collagen, hemoglobin, and other bioactive compounds [32]. Sabia et al., (2008) reported gelE gene in 19 (70%) out of 27 VRE strains; all E. faecalis and 5 out of 7 E. faecium carried the gelE [33]. In accordance, we detected gelE gene in all VREfs and 7.9% of VREfm. In fact, among virulence genes investigated, concomitant occurrence of gelE and cpd in E. faecalis isolates was found significant (p<0.001). In contrast, some studies did not find gelE gene in any E. faecium isolates [34] while, other researchers reported different incidence for mentioned gene in clinical isolates [11, 27]. Silent form of this gene was reported in E. faecium isolates [30, 35].

The ace gene, which codes for a putative protein with characteristics similar to a collagen-binding protein of Staphylococcus aureus [36] has been identified more frequently in E. faecalis isolates [27, 37]. Abriouel et al., (2008) reported higher incidence of ace gene (>80%) in clinical isolates in comparison to much lower incidence or even absence in isolates obtained from vegetable foods, water and soil [28]. The present study revealed the ace gene in 50% of E. faecalis and only in one E. faecium. All ace positive isolates obtained from urine (UTI) and isolates from other sources were negative for this gene. Lebreton et al., (2009) suggested that Ace may be a valuable drug target against human UTI. Low incidence or absence of the ace in clinical E. faecium have been reported in some studies [11, 27] but it is unlikely to contribute significantly to virulence.

Esp protein encoded by esp gene assumed to play a role in the primary surface attachment, contributing to colonization and persistence on urinary tract and biofilm formation [38, 39]. The esp is one of the disputed virulence elements that found on a pathogenicity island of both E. faecalis and E. faecium [40, 41].

Although, an earlier study demonstrated esp gene only in E. faecalis isolates [42] and other available data indicated that the esp gene was common in E. faecalis [15] however, a study on the food and medical isolates depicted an increasing incidence of esp in clinical E. faecium isolates than E. faecalis [30] and an European investigation proposed, proposed only this gene for virulence among this species [16]. Camargo et al., (2006) demonstrated that esp (56%) was restricted to VREfm and not found in vancomycin sensitive E. faecium [43]. Vankerckhoven et al., [16] surveyed virulence genes in European hospitals and found higher incidence of esp in the clinical VREfm isolates. In accordance with these investigations, in our study esp was the most common gene in VREfm (71.05%) but not detected in VREfs. Moreover, earlier Van Wamel et al., (2007) demonstrated that Esp expression on the surface of E. faecium; dependent to growth condition, to vary consistently among strains and is quantitatively correlated with initial adherence and biofilm formation [44].

In the present study, three E. faecium isolates with vanB genotype were susceptible to vancomycin (MIC< 4 µg/ml) and did not carry any of examined virulence determinants. A research conducted on Australian patients with haematological disorders showed high incidence of esp gene in vancomycin resistant E. faecium (vanB positive), but all were negative for asa1 and gelE [45].

CONCLUSION

Our data indicate a high prevalence of E. faecium harboring vancomycin resistance with vanA genotype. In addition, finding of 3 E. faecium with vanB genotype, but sensitive to vancomycin, suggest application of both phenotypic and genotypic methods for screening VRE strains since using them in single may lead to misidentification.

VREfs possessed four distinctive patterns of virulence factors and the gelE gene was always associated with the presence of pheromone determinant (cpd) and these combinations may associate with increased virulence. Interestingly, esp was not found in any of VREfs strains.

On the other hand, the esp was the dominant determinant among E. faecium strains. Finding of esp gene in high incidence among E. faecium, but not in E. faecalis, may indicate the role of this gene in high prevalence of VREfm in hospitals environments. Although the gelE, cpd, asa1and ace genes were found in less frequencies, but there is a trend of increasing levels of virulence genes other than esp among E. faecium strains.

Meanwhile, in 8 of VREfm (3 vanB⁺ and five vanA⁺) none of these genes was present, it was concluded that other genes may be also important in the pathogensis of VRE isolates.

However, further investigation is required to evaluate the association of these virulent determinants with occurrence of an infection by VREs in more number of isolates.

ABBREVIATIONS

Ace

 = Collagen binding protein

Asa1

 = Aggregation substance

ATCC

 = American type culture collection

CLSI

 = Cinical and Laboratory Standards Institute

Esp

 = Enterococcal surface protein

GelE

 = Gelatinase

MICs

 = Minimum inhibitory concentrations

Min

 = Minutes

VanA

 = D- Ala- D- Lac ligase

vanB

 = D- Ala- D- Lac ligase

VRE

 = Vancomycin resistant Enterococci

VREfm

 = Vancomycin resistant Enterococcus faecium

VREfs

 = Vancomycin resistant Enterococcus faecalis

CONFLICT OF INTERESTS

Declared none.