Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2013 Jun 1.
Published in final edited form as: Aging Cell. 2012 Apr 4;11(3):500–508. doi: 10.1111/j.1474-9726.2012.00813.x

MFG-E8 Activates Proliferation of Vascular Smooth Muscle Cells via Integrin Signaling

Mingyi Wang 1,*,#, Zongming Fu 2,#, James Wu 1, Jing Zhang 1, Liqun Jiang 1, Benjamin Khazan 1, Richard Telljohann 1, Mingming Zhao 1, Alexander W Krug 1, Maria Pikilidou 1, Robert E Monticone 1, Robert Wersto 3, Jennifer Van Eyk 2,#, Edward G Lakatta 1,#
PMCID: PMC3350574  NIHMSID: NIHMS362819  PMID: 22385834

Summary

An accumulation of milk fat globule EGF-8 protein (MFG-E8) occurs within the context of arterial wall inflammatory remodeling during aging, hypertension, diabetes mellitus, or atherosclerosis. MFG-E8 induces VSMC invasion, but whether it effects VSMC proliferation, a salient feature of arterial inflammation, is unknown. Here, we show that in the rat arterial wall in vivo, PCNA and Ki67, markers of cell cycle activation, increase with age between 8 and 30-mo. In fresh or early passage VSMC isolated from old aortae, an increase in CDK4 and PCNA, and cell cycle with acceleration of S and G2 phases and reduction of the G1/G0 phase, and an increase in PDGF and its receptors, confer elevated proliferative capacity, compared to young VSMC. Increased co-expression and physical interaction of MFG-E8 and integrin αvβ5 occur with aging in both the rat aortic wall in vivo and in VSMC in vitro. In young VSMC in vitro, MFG-E8 added exogenously, or over-expressed endogenously, triggers phosphorylation of ERK1/2, augmented levels of PCNA and CDK4, increased BrdU incorporation and promotes proliferation, via αvβ5 integrins. MFG-E8 silencing, or its receptor inhibition, or the blockade of ERK1/2 phosphorylation in these cells reduces PCNA and CDK4 levels and decelerates the cell cycle S phase, conferring a reduction in proliferative capacity. Collectively, these results indicate that MFG-E8 in a dose-dependent manner, coordinates the expression of cell cycle molecules and facilitates VSMC proliferation via integrin/ ERK1/2 signaling. Thus, an increase in MFG-E8 signaling is a mechanism of the age-associated increase in aortic VSMC proliferation.

Keywords: MFG-E8, Aging, VSMC proliferation, cell cycle, vascular remodeling

Introduction

Quiescent, highly organized vascular smooth muscle cells (VSMC) residing within the adult arterial wall play a key role in maintaining vascular tone and hemodynamic homeostasis (Lakatta and Levy, 2003; Lakatta et al., 2009; Wang et al., 2002; Wang et al., 2005; Wang et al., 2010a). Arterial wall remodeling occurs with advancing adult age, and features a diffuse intimal thickening, enhanced deposition of collagen and a breakdown of elastin fibers and of basement membranes that favors VSMC interaction with neighboring cells and with the extracellular matrix (ECM) (Jiang et al., 2008; Spinetti et al., 2004; Wang et al., 2005; Wang et al., 2006). In the context of this adverse remodeling, arterial cells release a repository of proinflammatory factors and increase their bioavailability, subsequently enabling VSMC invasion and proliferation within the intima, contributing to its cellularity and thickening [Lakatta and Levy, 2003; Lakatta et al., 2009; Wang and Lakatta, 2002; Wang et al., 2010a, Wang et al, 2011).

Recent studies with high-throughput proteomic screening and cellular network analyses have identified an age-associated increase of the extracellular matrix adhesion molecule, milk fat globule epidermal growth factor-VIII (MFG-E8), within the arterial wall, particularly in the intima VSMC of rats, nonhuman primates and humans (Fu et al., 2009). MFG-E8 is also abundantly expressed in the inflamed VSMC of atherosclerotic, diabetic, and hypertrophied aortae (Bagnato et al., 2007, Li et al., 2010, Lin 2010). We have shown that MFG-E8 is an element of angiotensin II/ monocyte chemo-attractant protein-1 (Ang II/MCP-1) proinflammatory signaling cascade that becomes chronically activated with aging, and enables enhanced VSMC invasion (Fu et al., 2009). It is known that invasive VSMC, in a proinflammatory niche, also exhibit enhanced proliferation. We hypothesized that MFG-E8, in addition to enabling enhanced VSMC invasion, also induces VSMC proliferation, and that the age-associated increase in aortic MFG-E8 is linked to an increase in VSMC proliferation.

Our results demonstrate, for the first time, that MFG-E8 signaling is linked to a modulation of the VSMC cell cycle and platelet derived growth factor (PDGF) signaling cascade molecules, leading to increased VSMC proliferation. Silencing MFG-E8 or blocking its receptor/phosphorylation of ERK1/2, reduces expression of cell cycle activators and retards the cell cycle. An age-associated increase in MFG-E8 and its integrin receptor via increased autocrine or paracrine signaling elevates expression of cell cycle activators, and the powerful mitogen PDGF, and its receptors, enabling increased proliferation of old VSMC. Thus, targeting MFG-E8 could be a novel strategy to retard the enhanced VSMC proliferation that accompanies arterial wall inflammation and remodeling during ageing and disease states, such as diabetes mellitus, hypertension, and atherosclerosis.

Results

Activation of cell cycle in VSMC both in vivo and in vitro

Western blot analysis shows that proliferating cellular nuclear antigen (PCNA) protein abundance, a necessary element for DNA synthesis during the S phase of the cell cycle (Hall, et al. 1990), is significantly increased in old (30 mo) vs. young (8 mo) rat aortae (Figure S1A). Immunolabelling indicates that the number of PCNA positive VSMC (brown nuclei) markedly increases with age in the aortic wall in vivo (Figure S1B). Ki67, present only in the G1, S, G2, and M cell cycle phases, but not in G0, is a phase specific proliferation marker (Gerdes et al., 1983). The number of Ki67 positive VSMC within the arterial media (dark blue nuclei) is dramatically increased (~5 fold) in the aged vs. the young arterial wall (Figure S1C).

Cell cycle analysis of freshly isolated aortic VSMC from old to young aortae show a significant population shift of VSMC in cell cycle phase: the cell number in G0/G1 decreases while that S and G2/M increase with age (Figure 1A). In cultured early passage VSMC that still retain their in vivo characteristics of VSMC (Wang et al., 2011), incorporation of the S phase marker, 5-bromo-2'-deoxyuridine (BrdU), is increased by 2-fold in cells from old vs. younger aortae (Figure 1B).

Figure 1. Age-associated shifts in cell cycle phases and BrdU incorporation in VSMC.

Figure 1

Open in a new tab

A) FACS analysis of the cell cycle phase of freshly isolated VSMC. B) A BrdU incorporation assay of cultured early passage VSMC. *p<0.05, vs. young.

Interaction of MFG-E8 and αvβ5 integrin increases in VSMC with aging

During proliferative conditions such as angiogenesis, tumor metastasis, or wound healing (Bu et al., 2007; Silvestre et al., 2005), αvβ5 integrin avidly binds MFG-E8 Arg-Gly-Asp triplet (RGD). In vivo, RT-PCR, immunostaining, and Western blot demonstrate that the transcription and translation of αvβ5 integrin or co-expression of αvβ5 integrin and proteins are markedly increased within the old vs. young aortic wall (Figure S2A, B, C & D). Importantly, the enhanced transcription and translation of αvβ5 integrin is retained in vitro in primary, early passage cultured old VSMC (Figure 2A, B, & C). Co-immunoprecipitation further demonstrates that MFG-E8 physically interacts with integrin αvβ5 in VSMC, and this interaction is increased with aging (Figure 2D). In addition, recombinant human MFG-E8 (rhMFG-E8) treatment, per se, enhances the expression of αvβ5 integrin in VSMC in a time-dependent manner Figure S3.

Figure 2. Integrin receptor αvβ5 expression and interaction with MFG-E8 in early passage VSMC in culture.

Figure 2

Open in a new tab

A) qRT-PCR: αv (right panel) and β5 (left panel) mRNA relative abundance. *p<0.05, vs.young. B) Western blots of αvβ5. C) Confocal images of αvβ5 (red color, X 630). D) Co-mmunoprecipiation of αvβ5 integrin and MFG-E8.

MFG-E8 promotes proliferation of VSMC via facilitation of the cell cycle

We next determined whether the enhanced proliferative capacity of old VSMC is linked to the age-associated increase in MFG-E8 signaling. Exogenous treatment with an rhMFG-E8 for 5 days, increases cell proliferation in a dose-dependent manner in both early passage young and old VSMC cultured in 2.5% serum (Figure 3A). Figure 3B shows that MFG-E8 treatment for 5 days markedly increases BrdU incorporation in both young and old VSMC.

Figure 3. rhMFG-E8 promotes proliferation of VSMC via facilitatiion of the cell cycle.

Figure 3

Open in a new tab

A) MTT proliferation assay of early passage young and old VSMC cultured in 2.5% BSA medium and treated with MFG-E8 for 5 days.* p<0.05, age effect; #p<0.05, MFG-E8 treatment effect. B) A BrdU incorporation in young and old VSMC treated with MFG-E8 (50 ng/ml) for 5 days. *p<0.05, vs. young control; #p<0.05, treatment vs. corresponding age control. C) ELISA assay of rhMFG-E8 treatment (10 min) on p-ERK1/2 in young VSMC (upper panel) and old (lower panel). *p<0.05 vs. control. D) Representative western blots of p-ERK1/2 induced by rhMFG-E8 (50 ng/ml) after 10 or 30 min or by PMA (phorbol 12-myristate 13-acetate) treatment for 10 min of young (upper panel) and old VSMC (lower panel). E) Representative western blots of CDK4 and PCNA induced by rhMFG-E8 (50 ng/ml). F) Representative ERK1/2 and PCNA western blots of young VSMC treated with rhMFG-E8 (50ng/ml) in the presence and absence of U126 (10μM) treatment for 24h.

It is known that classic extracellular signal-regulated kinases 1/2 (ERK1/2) are key signaling molecules that orchestrate the mitotic process (Shapiro et al., 1998). Figure 3C shows that rhMFG-E8 treatment for 10 minutes markedly increases ERK1/2 activation in young VSMC in a dose-dependent manner as assessed by its phosphorylation status via an ELISA assay, and also increases ERK1/2 activation in old VSMC. Western blot analysis further confirms this finding and also indicates that rhMFG-E8 induces phosphorylation of ERK1/2 in a time-dependent manner (Figure 3D). This effect is similar to that of the well-known potent mitogen phorbol 12-myristate 13-acetate (PMA) in Figure 3D.

To demonstrate links between MFG-E8 and the proliferative signaling molecule ERK1/2 with aging, we exposed young VSMC to rhMFG-E8, which increases activated cyclin-dependent kinase 4 (CDK4) (lower band) (Rao et al. 2007) and PCNA protein abundance in a dose-dependent manner , up to levels of untreated old cells (Figure 3E & Figure S4). Importantly, U126, an inhibitor of ERK1/2 phosphorylation, substantially reduces rhMFG-E8 treatment-associated increases in expression of PCNA in young VSMC (Figure 3F)

Furthermore, we constructed an adenovirus harboring a full-length long- and short form of MFG-E8, both of which are expressed in rat tissue [Burgess et al., 2006]. Over-expression in young cells of either the long- or short-form of MFG-E8 also markedly increases phosphorylation of ERK1/2 (Figure S5A). Interestingly, MFG-E8 adenovirus infection of young VSMC increases levels of CDK-4 and PCNA expression, up to levels of old cells (Figure S5B). Importantly, inhibition of ERK1/2 phosphorylation by U126, also substantially reduces overexpression of MFG-E8-related increases in expression of both CDK4 and PCNA (Figure S5C).

MFG-E8 promotes cell cycling and proliferation of VSMC via integrin signaling

We next determined whether increased MFG-E8 enhances the proliferative capacity of VSMC via αvβ5 integrin signaling. rhMFG-E8 treatment-associated increases in ERK1/2 phosphorylation, PCNA and activated CDK4 expression in young VSMC are all substantially inhibited by the neutralizing antibody against αvβ5 inegrin, by the inhibitory αvβ5RGD peptide (Figure 4A, B, & C). Furthermore, the increase in young VSMC cell number, in response to exogenous treatment with rhMFG-E8 as assessed by an MTT assay, is also substantially blocked by the neutralizing antibody against αvβ5 integrin but not by the pre-immune-IgG (Figure 4D and Figure S6A). Additionally. pre-immune-IgG did not effect ERK1/2 phosphorylation, CKD4 and PCNA expression in VSMC (Figure S6B). Importantly, rhMFG-E8 treatment-associated increases in ERK1/2 phosphorylation are substantially inhibited by the neutralizing antibody against αvβ5 integrin in old VSMC (Figure S7A). Furthermore, the increase in old VSMC cell number in response to exogenous treatment with rhMFG-E8 is also substantially blocked by the neutralizing antibodies against αvβ5 integrin (Figure S7B).

Figure 4. rhMFG-E8 promotes the cell cycle and proliferation of VSMC via integrin signaling.

Figure 4

Open in a new tab

A) Representative Western blots analysis of ERK1/2 in young VSMC treated with MFG-E8 (50 ng/ml) in the presence and absence of a neutralizing antibody against αvβ5 integrin (5μg/ml, clone#: P5h9) for 24h. B) Western blots analysis of CDK4 in young VSMC treated with MFG-E8 (50 ng/ml) in the presence of an inhibitory RGD peptide (10μg/ml) or control RGE peptide (10μg/ml) for 24h. * p<0.05 vs. control RGE alone. C) Western blot analysis of PCNA in young VSMC treated with MFG-E8 (50 ng/ml) in the presence of an inhibitory RGD peptide (10μg/ml) or control RGE peptide (10μg/ml) for 24h. * p<0.05 vs. control RGE alone. D) The number of VSMC in the presence or absence of MFG-E8 or neutralizing integrin antibodies against αvβ5 integrin (10μg/ml) for 3 days. * p<0.05 vs. control and # p<0.05 vs. MFG-E8 treatment.

MFG-E8 silencing decelerates the VSMC cell cycle and proliferation

The results in Figures 3-4 and Figures S4-5 indicate that exposure of VSMC to exogenous MFG-E8, or overexpression of MFG-E8, increases cell cycle activators, DNA synthesis and cell proliferation, via the αvβ5 integrin/ ERK1/2 cascade. To further examine the role of constitutive expression of endogenous MFG-E8 in its proliferative effects, we silenced MFG-E8 in early passage VSMC. MFG-E8 silencing dramatically reduces MFG-E8 mRNA in both young and old VSMC (Figure 5A). MFG-E8 silencing also abolished the age difference in PCNA and CDK4 expression in VSMC (Figure 5B&C). Importantly, MFG-E8 silencing for 24 hours markedly reduces BrdU incorporation (Figure 5D) and cellular growth density in vitro over 50% (P<0.05) (Figure 5E).

Figure 5. Silencing of MFG-E8 triggers a deceleration of the cell cycle and VSMC proliferation.

Figure 5

Open in a new tab

A) qRT-PCR: MFG-E8 mRNA relative abundance. B) Western blotting analysis of CDK4 in control and after MFG-E8 silencing. *p<0.05 vs. young control; and #p<0.05 vs. silencing of corresponding age control. C) Western blots analysis of PCNA. *p<0.05 vs. young control; and #p<0.05 vs. silencing of corresponding age control. D) BrdU incorporation in old VSMC in control and after silencing of MFG-E8 for 48 hours. *p<0.05 vs. silencing of corresponding age control. E) Decrease of the cellular density in both young and old VSMC after silencing of MFG-E8 for 3 days.

Interestingly, rhMFG-E8 rescues the adverse effects of siRNAs of MFG-E8 on VSMC wound healing process (Figure S8A). In addition, rhMFG-E8 also rescues the effects of siRNAs of MFG-E8 on PCNA expression in VSMC (Figure S8B).

MFG-E8 signals the expression of platelet–derived growth factor (PDGF) and its receptors (PDGFR)

It is well-established that PDGF and its receptor signaling cascade potently orchestrate the proliferative capacity of VSMC (Fingerle et al., 1989, Marrero et al, 1997, Banai et al. 1998). Western blotting shows that PDGFR-α and -β are markedly increased in old VSMC (Figure 6A & B). Moreover, MFG-E8 increases expression of PDGF-aa, and its receptors-α and -β in young and old VSMC in a dose-dependent manner (Figure 6A) and a time-dependent manner (Figure 6B). Importantly, MFG-E8 silencing decreases expression of PDGFR-α and -β in both young (Figure 6C) and old VSMC (Figure 6D).

Figure 6. MFG-E8 modifies PDGF signaling cascade molecules.

Figure 6

Open in a new tab

A) Representative western blots of PDGFR-α & -β, PDGF-A, and β-actin (lower panel) of both young and old VSMC treated with rhMFG-E8 (0, 10, 50, 100 ng/ml) for 24 hours, average data of PDGFR-β. *p<0.05 vs. young control; and #p<0.05, vs. old control. B) Representative western blots of PDGFR-α in both young and old VSMC treated with MFG-E8 (50 ng/ml) for 12 and 48 hours. C) Western analysis of PDGFR-α & β in young VSMC with or without MFG-E8 silencing for 48 hours. *p<0.05, vs. control. D) Western analysis of PDGFR-α & β in old VSMC with or without MFG-E8 silencing for 48 hours. *p<0.05, vs. control.

Discussion

MFG-E8, a hybrid secreted protein, containing the RGD motif in the second EGF domain, plays a diverse biorole in various pathophysiologic conditions, including mammary gland remodeling, fertilization, tumor genesis, immunodeficiency, and wound healing (Bu et al., 2007; Jinushi et al., 2008; Okuyama et al., 2008; Silvestre et al., 2005; Talor et al., 1997). Recent studies show that MFG-E8 accumulates within the arterial wall during aging and age-related diseases such as hypertension, atherosclerosis, and diabetes mellitus [Bagnato et al., 2007; Fu et al., 2009; Li et al., 2010, Lin et al., 2010]. These findings suggest that MFG-E8 may play a causal role in cellular events of arterial remodeling, including invasion and proliferation with aging.

We have demonstrated that arterial MFG-E8 is a pivotal relay element within the Ang II/MCP-1/VSMC signaling cascade and enhances VSMC invasion capacity in an MCP-1 dependent manner with aging (Fu et al., 2009). In the current study, for the first time, we further demonstrate that MFG-E8 signaling is vital to the increased VSMC proliferation with aging. The role of the increase in MFG-E8 with aging and in proliferation of VSMC from old rats is linked to an acceleration of the cell cycle via the up-regulation of CDK4, PCNA and Ki67. The complex of CDK4 and PCNA accelerates the cell cycle by facilitating the mitotic phase of the cell (Hall et al., 1990; Braden et al., 2008). Both rhMFG-E8 treatment or overexpression via adenovirus infection increase proliferation and BrdU incorporation in both young and old VSMC. In contrast, silencing of MFG-E8 markedly decreases BrdU incorporation in VSMC.

The present study demonstrates that MFG-E8 facilitation of the cell cycle of VSMC is mediated by integrins/ERK1/2 signaling. It is known that αvβ5 integrin is a putative receptor of MFG-E8 in various cell types (Taylor et al., 1997; Yang C et al., 2011). The present results indicate that both integrins αvβ5 and p-ERK1/2 are up-regulated in aged VSMC and aged arterial wall, and that co-expression and physical interaction of MFG-E8 and αvβ5 integrin is increased in aged VSMC. The effects of MFG-E8 on proliferation of VSMC in the present study are consistent with its effects in other cell types. MFG-E8 increases proliferation and BrdU incorporation in epithelial and tumor cells, and the blockade of MFG-E8 signaling significantly retards the process of wound healing and tumor cell growth (Bu et al., 2007; Carrascosa et al., 2011; Ensslin et al. 2007; Jinushi et al., 2008; Jinushi et al, 2009; Neutzner et al, 2007; Taylor et al., 1997; Yang et al., 2011; Zeelenberg et al, and promotes the progression of the cell cycle of epithelial and tumor cells via integrin/ERK1/2 signaling (Bu et al., 2009; Ensslin et al. 2007). As in our study, the increased proliferation in tumor cells is linked to enhanced levels of PCNA and CDK4, and is abolished by either integrin inhibition or a blockade of ERK-1/2 phosphorylation.

MFG-E8 is an essential element of PDGF signaling in the invasion and proliferation of VSMC, angiogenesis, and development of embryonic vasculature (Fu et al., 2009, Motegi et al., 2011a, Motegi et al., 2011b, Bondjers et al., 2003, Scheidl et al., 2002). The present study provides evidence for the involvement of MFG-E8 in the PDGF proliferation signaling of VSMC with aging, and PDGF receptors are markedly increased in aged VSMC. MFG-E8 enhances expression of PDGF receptors and its ligands in VSMC in a dose-dependent manner, and MFG-E8 silencing reduces expression of PDGF receptors. PDGF is highly expressed in proliferative VSMC in vitro and in proliferative arterial neointima (Fingerle et al., 1989, Marrero et al, 1997, Banai et al. 1998), and blockade of PDGF signaling markedly reduces VSMC proliferation and arterial neointima thickening after injury [Banai et al. 1998].

MFG-E8 signaling also increases in various inflammatory arterial remodeling during aging and in the pathogenesis of hypertension, atherosclerosis and diabetes (Bagnato et al., 2007, Li et al., 2010, Fu, et al, 2009). The MFG-E8 downstream cascade molecules, PDGF, ERK1/2, CDK4 and PCNA, are also enriched during inflammatory arterial remodeling [Ding et al., 2007, Ju et al., 2001, Lee et al., 2009, Wang M et al., 2005 Li et al., 2010)]. In the diabetic aortic wall, MFG-E8 is substantially reduced by grape seed proanthocyanidin extracts, an anti-inflammatory product [Li, et al, 2010], suggesting that MFG-E8 releases inflammatory signaling to orchestrate arterial remolding.

In summary, the present study not only expands previous findings of increased proliferation of aged arterial VSMC (Hariri et al., 1988; Li et al., 1997; McCaffrey et al., 1988), but also provides a novel insight into the molecular mechanism. Increased MFGE8 within aged VSMC facilitates entrance into the cell cycle via the intergrin/ERK1/2 /CDK4/PCNA proliferative signaling cascade, a downstream event of which is increased PDGF signaling. Thus, interventions targeted at MFG-E8 signaling are a potential novel approach to the retardation of the age-associated arterial remodeling and age-associated vascular diseases e.g., atherosclerosis and hypertension, in which VSMC proliferation has a prominent role.

Experimental Procedures

Animals and arterial specimens

8-month (young, n=50) and 30-month (old, n=50) Fisher 344 X Brown Norway (F344XBN) male rats were obtained from the National Institute on Aging contract colonies (Harlan Sprague-Dawley, Indianapolis). The animal protocol was approved by the Institutional Animal Care and Use Committee and complied with the guide for the care and use of laboratory animals (National Institutes of Health publication No. 3040-2, revised 1999). All animals were sacrificed by an overdose of sodium pentobarbital, and thoracic aortae were immediately removed, isolated, and processed as described previously (Spinetti et al., 2004; Wang and Lakatta, 2002).

VSMC Isolation and Culture

VSMC were enzymatically isolated as previously described (Spinetti et al., 2004). Briefly, F344XBN rat thoracic aortae were rinsed in Hanks balanced salt solution (HBSS) containing 50μg/mL penicillin, 50μg/mL streptomycin and 0.25μg/mL amphotericin B (Gibco). After digestion for 30 min in 2mg/mL collagenase I solution (Worthington Biomedical, Freehold, New Jersey) at 37°C, the adventitia and intima were removed from the vessel media layer, which was placed overnight in complete medium (DMEM plus 10% FCS). On day 2, the vascular media was further digested with 2mg/mL collagenase II/0.5mg/mL elastase (Sigma) for 1 hour at 37°C, and the isolated cells were washed and plated in complete medium. In all cases, >95% of cells stained positive for a-SMA.

Early passage (p3-p5) VSMC were cultured in the presence or absence of MFGE8 (0, 10, 50, 100 ng/ml ABNOVA Corporation, Taiwan, or R&D System Inc. MN), neutralizing antibody against αvβ5 (clone#: P5h9, 5μg/ml, R&D System Inc. MN), cyclic RGD (10μg/ml, Invitrogen, Carlsbad, CA), RGE (10μg/ml, Invitrogen, Carlsbad, CA), and U126 (10 μM). for 24 hr, and were lysated for Weston blot analysis.

Generation of recombinant adenoviruses and VSMC infection

The plasmids that carry the FLAG-tagged full-length cDNA fragment of mouse MFGE8L or MFG-E8S cDNA in pEF-BOS-EX vector (pEF-MFG-E8L-Flag and pEF-MFGE8S-Flag) were generous gifts from Dr. Shigekazu Nagata (Department of Medical Chemistry, Kyoto University, Kyota, Japan) [Burgess et al., 2006]. The MFG-E8L or MFG-E8S fragments were cut by Bgl II and Sal I from above plasmids, respectively and then ligated into pAdTrack-CMV which has a reporter gene expressing green fluorescent protein (GFP). The adenoviral backbone plasmid pAdEasy-1 and shuttle plasmid pAdTrack-CMV were a gift from Dr Bert Vogelstein (John Hopkins Oncology Center Baltimore Maryland, USA). The replication-defective recombinant adenovirus encoded MFG-E8L or MFG-E8S together with GFP were constructed by homologous recombination, as described in a previous study [Jiang et al., 2008]. An adenoviral vector expressing GFP served as a control virus. Standard viral amplification and cesium chloride purification methods were used to amplify and purify these adenoviruses. The titer for each adenovirus in HEK293A cells was determined via a dilution assay.

Adenoviral infection of VSMC was performed with a multiplicity of infections (MOI) of 50 with or without U126 (10 μM). After forty-eight hours of adenoviral infection, total cellular proteins were isolated for Western blot.

qRT-PCR

qRT-PCR was performed according to modified protocol as reported in prior studies [Jiang et al., 2008; Fu et al., 2009]. Messenger RNA was extracted from the thoracic aortae or the early passage VSMC of four individual young and old rats using the TRIzol system (Life Technologies, Rockville, Md). RNA (500ng) was reverse transcribed for 30 minutes at 48°C using random hexonucleotides according to the manufacturer's instructions (Applied Biosystems, Foster City, CA). All the primers used for Real Time PCR analysis have been designated using Primer Express software 1.5 (Applied Biosystems, Foster City, CA), and synthesized by Invitrogen Life Technologies (Carlsbad, CA). The informantion on primer sequences are as followings. MFG-E8, forward ACACACAGCGAGGGGACAT; and backward ATCTGTGAATCGGCAATGG. αV, forward GCTGCCGTTGAGATAAGAGG; and backward TGCCTTGCTGAATGAACTTG. β 5 , forward GTGTGAGAAGTGCCCAACCT; and backward AGCTTCCTGGTCGTCTTTGA. B2M, forward TGCTACGTGTCTCAGTTCCA, backward GCTCCTTCAGAGTGACGTGT.

Real-time PCR was performed according to the SYBRGreen PCR protocol (Applied Biosystems Foster City CA). Each sample was tested in quadruplicate. The reaction conditions were: 10 min at 95°C (one cycle); 30 sec at 95°C; 30 sec at 60°C; and 30 sec at 72°C (40 cycles). Gene-specific PCR products were continuously measured by an ABI PRISM 7900 HT Sequence Detection System (PE Applied Biosystem Norwalk, CT). The PCR product sizes were verified by agarose gel electrophoresis. Samples were normalized to the expression of the “housekeeping” gene, B2M.

Quantification of ERK1/2 phosphorylation by ELISA

VSMC were seeded in 96-well plates at a concentration of 20,000 cells per 0.32 cm2. After reaching approximately 80% confluence, the cells were serum starved for 24 h. Subsequently, cells were equilibrated in 1x HEPES-Ringer solution (130.0 mmol/liter NaCl, 5.4 mmol/liter KCl, 1.0 mmol/liter CaCl2, 1.0 MgCl2, 1.0 mmol/liter NaH2PO4, 10 mmol/liter HEPES, and 5 mmol/liter glucose (pH 7.4) at 37 C for 30 min and then stimulated in the same buffer plus the respective vehicle (ethanol or DMSO), with or without rMFG-E8 (50μg/ml Abnova Corporation, Taiwan) for 10 min. Immediately afterward, cells were fixed with 8% formaldehyde in PBS for 20 min at room temperature and washed three times for 5 min with 0.1% Triton X-100 in PBS. Endogenous peroxidase was quenched for 20 min with freshly prepared 1% H2O2 and 0.1% azide. Cells were washed again three times in the same buffer, blocked by 10% fetal calf serum in PBS/Triton X-100 for 1 h and finally incubated overnight with the primary antibody (phosphorylated ERK; Cell Signaling; 1:1000) in PBS/Triton X-100 containing 5% BSA at 4 C under gentle shaking. The next day, cells were washed three times with PBS/Triton X-100 and incubated with the secondary antibody (anti-rabbit horseradish peroxidase-linked IgG; Cell Signaling; 1:3000) in PBS/Triton X-100 containing 5% BSA for 1 h at room temperature and then washed three times in PBS/Triton X-100 for 5 min and 10 min with PBS. After that, cells were incubated in 50 μl of chemoluminescence detection solution in the dark. Chemiluminescence signals were read within 10 min using a Victor multiwell reader. Cells were then washed twice in PBS/Triton X-100 and twice in PBS. The wells were air dried for 5 min at room temperature, and stained with 100 μl of trypane blue solution (0.4% in PBS) for 30 min at room temperature. Cells were subsequently washed three times in PBS, and 100 μl of 1% sodium dodecyl sulfate solution were added, and the plate was incubated on a shaker for 1 h at room temperature. Finally, absorbance was measured at 550 nm. Chemoluminescence signals were normalized to the protein content in each well as determined by trypan blue staining. This allows normalizing ERK1/2 phosphorylation to total protein content in each well.

Western blot analysis

For Western Blotting, 15 or 20 μg of whole cell or arterial lysates were resolved by SDS-PAGE and transferred onto PVDF membrane (Immobilon). The transferred membranes were incubated in PBS containing primary antibodies (Table 1) at 4°C for 24 hours. HRP-conjugated IgG (Amersham Pharmacia Biotech, Buckinghamshire, GB) were used as secondary antibodies and detected with SuperSignal West Pico Chemiluminescent Substrate (Pierce Biotechnology, Rockford, IL). The densitometric analysis of the bands was obtained on the protein extracts from the aortae of four rats of each age group or from VSMC of at least three independent experiments. β-actin immunoblotting has been used as a protein loading control since its expression does not change with age.

Table.

Primary Antibodies

Antibody Specie Titer Blotting Titer Staining Sources
PCNA M 1:200 1:50 DAKO A/S, Denmark
Ki67 M 1:200 DAKO A/S, Denmark
MFG-E8 M 1:1000 1:50 R&D System Inc. MN
αvβ3 M 1:50 Chemicon Intern. Inc., CA
αvβ5 M 1:50 COVANCE, CA
CDK4 M 1:1000 Chemicon Intern. Inc., CA
ERK1/2 R 1:1000 Cell Signaling, MA
p-ERK1/2 R 1:1000 Cell Signaling, MA
PDGF-A M 1:500 Santa Cruz, CA
PDGFR-α R 1:500 1:100 Santa Cruz, CA
PDGFR-β R 1:500 1:100 Santa Cruz, CA
β-actin M 1:10000 Sigma-aldrich, Inc. MO
Open in a new tab

R=rabbit; and M=mouse.

Immunohistochemistry and Immunofluorescence

Immunostaining was performed according to the protocols provided by the manufacturer (Dako Corp.CA). The negative control was stained with serum (no primary antibody). The source and characteristics of primary antibodies used were listed in the table 1.

MFG-E8 interference

The MFG-E8 silencing was carried out with the Stealth siRNA duplex oligoribonucleotides (1 nmol, RNA sequence 5' to 3': AGG ACA ACA ACA ACA GCC UGA AGA UUA A) of rat MFG-E8 (Invitrogen) using the Amaxa basic nucleofector techniques according to the manufacture's protocol (Amaxa). The P-024 program was used for the transfection. The cells transfected with Stealth RNAi Negative Control Duplexes (Invitrogen) were used as negative control. After 48 hours of transfection, the VSMCs were lyzed with 1x Cell Lysis Buffer (Cell Signaling) for Western blot analysis.

Proliferation analysis

VSMC proliferation was assessed by a methylthiazoletetrazolium (MTT) assay: approximately 3000 young and 1000 old VSMCs were plated sparsely in 96-well flat-bottomed microplates in 100 mL of DMEM + 2.5% FBS. After 24 h at subconfluency, the medium was replaced with MFG-E8 (0, 10, 50 ng/ml, Abnova Cprporation, Tainwain) with or without neutralizing antibody against avb5 (5μg/ml, R&D System Inc. MN), and cells were incubated at 37°C in a humidified, 5% CO2 atmosphere for 0, 3, 5 days with routine medium changes. At the end of the incubation, 25 μL of 3-[4,5-dimethylthiozol-2-yl]-2,5-diphenyltetrazolium bromide (MTT) solution (5 mg/mL) were added to each well, followed by a 4-h incubation at 37°C. Then the medium carefully was removed and 150μL of dimethylsulfoxide (DMSO) were added to dissolve the produced formazan crystals. The optical density immediately was measured at 570 nm using a microplate reader (Bio-Tek Instrument).

BrdU incorporation assay

VSMC were grown in 96-well plates for 48 h and then cultured in serum-free medium overnight before stimulation with or without MFG-E8 (50 ng/ml, Abnova Cprporation, Tainwain), for 24 h or 5 days. In addition, old VSMC were grown after 48 hours of transfection with si-MFG-E8. BrdU was added during the last 4 h of the DNA synthesis phase and the binding of a monoclonal anti-BrdU antibody (Roche Diagnostics) was used to quantify the incorporation of BrdU into DNA. Experiments were performed in triplicate.

Co-immunoprecipitation

VSMC were lysed with non-denaturing lysis buffer (20 mM Tris HCl, 150 mM naCl, 10% Glycerol, 1% glycerol, 1% Nonidet P-40, and 2mM EDTA). After removing cell debris, Preclear lysate was incubated with a 2.0 μg pre-immuno-mouse IgG (cat#, sc 2025, Santa Cruz, CA) for 1 hour on ice. 40 μl of Protein A/G plus-agarose (SC-2003, Santa Cruz, CA) beads were added to the lysate, incubated for 1h at 4°C with gentle agitation, and then centrifuged at 14,000 × g for 1 min at 4°C. The 500 μg supernatants were transferred to a fresh tube, 2 μg αVβ5 integrin (clone# , P5H9, cat#, MAB2528, R&D System) and MFG-E8 antibodies (clone# , 278901, cat#MAB2767, R&D System), and pre-immuno-mouse IgG (cat#, sc 2025, Santa Cruz, CA) respectively, were added and then incubated at 4°C for 3 h. 40μl of protein A/G plus-agarose beads was added To each tube (SC-2003, Santa Cruz, CA) and tubes were incubated at 4°C overnight. Beads were collected by centrifugation, and washed three times with lysis buffer. All supernatant were removed and then 30 μl of 2x Laemmli sample buffer was added and heated at 95°C for 5 min. The samples were separated with 4% to 12% NuPAGE gels and Western blotted with antibodies against αVβ5 integrin and MFG-E8 antibodies.

Statistical Analysis

All results are expressed as the mean ± SEM. Statistical analysis was performed via a T-test when two groups were analyzed, or via an ANOVA, followed by a Bonferroni post hoc test for multiple comparisons. A p value of <0.05 was taken as statistically significant.

Supplementary Material

Supp Fig S1-S8

Acknowledgments

Sources of Funding

This research was supported by the Intramural Research Program of the National Institute on Aging.

Footnotes

Author contribution: Conceived and designed the experiments: M.W., E.G.L., and J.V.E.. Performed the experiments: M.W., Z.F., J.W., J.Z., L.J., B.K., R.T., M. Z., A.W.K., M.P., R.E.M., and R.W.. Analyzed the data: M.W., J.V.E., and E.G.L. Contributed reagents/materials/analysis tools: Z.F., J.W., J.Z., L.J., B.K., R.T., A.K., M.P., and R.E.M. Wrote the paper: M.W., R.E.M., and E.G.L..

Disclosures

The authors (M.W., F.Z., J.V.E., & E.G.L) are inventors on a patent for method for the diagnosis of age-associated vascular disorders. This patent is owned by the United States Department of Human Health Services, and the authors do not receive any royalties from this patent

References

  1. Bagnato C, Thumar J, Mayya V, Hwang SI, Zebroski H, Claffey KP, Haudenschild C, Eng JK, Lundgren DH, Han DK. Proteomics analysis of human coronary atherosclerotic plaque: a feasibility study of direct tissue proteomics by liquid chromatography and tandem mass spectrometry. Mol Cell Proteomics. 2007;6:1088–1102. doi: 10.1074/mcp.M600259-MCP200. [DOI] [PubMed] [Google Scholar]
  2. Banai S, Wolf Y, Golomb G, Pearle A, Waltenberger J, Fishbein I, Schneider A, Gazit A, Perez L, Huber R, Lazarovichi G, Rabinovich L, Levitzki A, Gertz SD. PDGF-receptor tyrosine kinase blocker AG1295 selectively attenuates smooth muscle cell growth in vitro and reduces neointimal formation after balloon angioplasty in swine. Circulation. 1998;97:1960–1969. doi: 10.1161/01.cir.97.19.1960. [DOI] [PubMed] [Google Scholar]
  3. Bondjers C, Kalén M, Hellström M, Scheidl SJ, Abramsson A, Renner O, Lindahl P, Cho H, Kehrl J, Betsholtz C. Transcription profiling of platelet-derived growth factor-B-deficient mouse embryos identifies RGS5 as a novel marker for pericytes and vascular smooth muscle cells. Am J Pathol. 2003;162:721–729. doi: 10.1016/S0002-9440(10)63868-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Braden WA, McClendon AK, Knudsen ES. Cyclin-dependent kinase 4/6 activity is a critical determinant of pre-replication complex assembly. Oncogene. 2008;27:7083–7093. doi: 10.1038/onc.2008.319. [DOI] [PubMed] [Google Scholar]
  5. Burgess BL, Abrams TA, Nagata S, Hall MO. MFG-E8 in the retina and retinal pigment epithelium of rat and mouse. Mol Vis. 2006;12:1437–1447. 3. [PubMed] [Google Scholar]
  6. Bu HF, Zuo XL, Wang X, Ensslin MA, Koti V, Hsueh W, Raymond AS, Shur BD, Tan XD. Milk fat globule-EGF factor 8/lactadherin plays a crucial role in maintenance and repair of murine intestinal epithelium. J Clin Invest. 2007;117:3673–3683. doi: 10.1172/JCI31841. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Carrascosa C, Obula RG, Missiaglia E, Lehr HA, Delorenzi M, Frattini M, Rüegg C, Mariotti A. MFG-E8/lactadherin regulates cyclins D1/D3 expression and enhances the tumorigenic potential of mammary epithelial cells. Oncogene. 2011 doi: 10.1038/onc.2011.356. doi: 10.1038/onc.2011.356. [DOI] [PubMed] [Google Scholar]
  8. Ding L, Chapman A, Boyd R, Wang HD. ERK activation contributes to regulation of spontaneous contractile tone via superoxide anion in isolated rat aorta of angiotensin II-induced hypertension. Am J Physiol Heart Circ Physiol. 2007;292:H2997–H3005. doi: 10.1152/ajpheart.00388.2006. [DOI] [PubMed] [Google Scholar]
  9. Ensslin MA, Shur BD. The EGF repeat and discoidin domain protein, SED1/MFG-E8, is required for mammary gland branching morphogenesis. Proc Natl Acad Sci U S A. 2007;104:2715–2720. doi: 10.1073/pnas.0610296104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Fingerle J, Johnson R, Clowes AW, Majesky MW, Reidy MA. Role of platelets in smooth muscle cell proliferation and migration after vascular injury in rat carotid artery. Proc Natl Acad Sci U S A. 1989;86:8412–8416. doi: 10.1073/pnas.86.21.8412. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Fu Z, Wang M, Gucek M, Zhang J, Wu J, Jiang L, Monticone RE, Khazan B, Telljohann R, Mattison J, Sheng S, Cole RN, Spinetti G, Pintus G, Liu L, Kolodgie FD, Virmani R, Spurgeon H, Ingram DK, Everett AD, Lakatta EG, Van Eyk JE. Milk fat globule protein-epidermal growth factor-8: a pivotal relay element within the angiotensin II and monocyte chemoattractant protein-1 signaling cascade mediating vascular smooth muscle cells invasion. Circ. Research. 2009;104:1337–1346. doi: 10.1161/CIRCRESAHA.108.187088. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Gerdes J, Schwab U, Lemke H, Stein H. Production of a mouse monoclonal antibody reactive with a human nuclear antigen associated with cell proliferation. Int J. Cancer. 1983;31:13–20. doi: 10.1002/ijc.2910310104. [DOI] [PubMed] [Google Scholar]
  13. Hall PA, Levison DA, Woods AL, Yu CC-W, Kellock DB, Watkins JA, Barnes DM, Gillett CE, Camplejohn R, Dover R, Waseem NH, Lane DP. Proliferating cell nuclear antigen (PCNA) immunolocalization in paraffin sections: An index of cell proliferation with evidence of deregulated expression in some neoplasms. J. Pathol. 1990;162:285–294. doi: 10.1002/path.1711620403. [DOI] [PubMed] [Google Scholar]
  14. Hariri R, Hajjar DP, Coletti D, Alonso DR, Weksler ME, Rabellino E. Aging and arteriosclerosis: Cell cycle kinetics of young and old arterial smooth muscle cells. Am J Pathol. 1988;131:132–136. [PMC free article] [PubMed] [Google Scholar]
  15. Jiang L, Wang M, Zhang J, Monticone RE, Telljohann R, Spinetti G, Pintus G, Lakatta EG. Increased aortic calpain-1 activity mediates age-associated angiotensin II signaling of vascular smooth muscle cells. PLoS ONE. 2008;3:e2231. doi: 10.1371/journal.pone.0002231. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Jinushi M, Nakazaki Y, Carrasco DR, Draganov D, Souders N, Johnson M, Mihm MC, Dranoff G. Milk fat globule EGF-8 promotes melanoma progression through coordinated Akt and twist signaling in the tumor microenvironment. Cancer Res. 2008;68:8889–88898. doi: 10.1158/0008-5472.CAN-08-2147. [DOI] [PubMed] [Google Scholar]
  17. Jinushi M, Sato M, Kanamoto A, Itoh A, Nagai S, Koyasu S, Dranoff G, Tahara H. Milk fat globule epidermal growth factor-8 blockade triggers tumor destruction through coordinated cell-autonomous and immune-mediated mechanisms. J Exp Med. 2009;206:1317–1326. doi: 10.1084/jem.20082614. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Ju H, Gros R, You X, Tsang S, Husain M, Rabinovitch M. Conditional and targeted overexpression of vascular chymase causes hypertension in transgenic mice. Proc Natl Acad Sci U S A. 2001;98:7469–7474. doi: 10.1073/pnas.131147598. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Lakatta EG, Levy D. Arterial and cardiac aging: major shareholders in cardiovascular disease enterprises: Part I: aging arteries: a “set up” for vascular disease. Circulation. 2003;107:139–146. doi: 10.1161/01.cir.0000048892.83521.58. [DOI] [PubMed] [Google Scholar]
  20. Lakatta EG, Wang M, Najjar SS. Arterial aging and subclinical arterial disease are fundamentally intertwined at macroscopic and molecular levels. Med Clin North Am. 2009;93:583–604. doi: 10.1016/j.mcna.2009.02.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Lee SJ, Kim WJ, Moon SK. TNF-alpha regulates vascular smooth muscle celln responses in genetic hypertension. Int Immunopharmacol. 2009;9:837–843. doi: 10.1016/j.intimp.2009.03.010. [DOI] [PubMed] [Google Scholar]
  22. Li XL, Li BY, Gao HQ, Cheng M, Xu L, Li XH, Zhang WD, Hu JW. Proteomics approach to study the mechanism of action of grape seed proanthocyanidin extracts on arterial remodeling in diabetic rats. Int. J. Mol. Med. 2010;25:237–248. [PubMed] [Google Scholar]
  23. Li Z, Cheng H, Lederer WJ, Froehlich J, Lakatta EG. Enhanced proliferation and migration and altered cytoskeletal proteins in early passage smooth muscle cells from young and old rat aortic explants. Exp Mol Pathol. 1997;64:1–11. doi: 10.1006/exmp.1997.2204. [DOI] [PubMed] [Google Scholar]
  24. Lin YP, Hsu ME, Chiou YY, Hsu HY, Tsai HC, Peng YJ, Lu CY, Pan CY, Yu WC, Chen CH, Chi CW, Lin CH. Comparative proteomic analysis of rat aorta in a subtotal nephrectomy model. Proteomics. 2010;10:2429–2443. doi: 10.1002/pmic.200800658. [DOI] [PubMed] [Google Scholar]
  25. Marrero MB, Schieffer B, Li B, Sun J, Harp JB, Ling BN. Role of Janus kinase/signal transducer and activator of transcription and mitogen-activated protein kinase cascades in angiotensin II- and platelet-derived growth factor-induced vascular smooth muscle cell proliferation. J Biol Chem. 1997;272:24684–24690. doi: 10.1074/jbc.272.39.24684. [DOI] [PubMed] [Google Scholar]
  26. McCaffrey TA, Nicholson AC, Szabo PE, Weksler ME, Weksler BB. Aging and arteriosclerosis. The increased proliferation of arterial smooth muscle cells isolated from old rats is associated with increased platelet-derived growth factor-like activity. J Exp Med. 1988;167:163–174. doi: 10.1084/jem.167.1.163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Motegi SI, Garfield S, Feng X, Sárdy M, Udey MC. Potentiation of Platelet-Derived Growth Factor Receptor-{beta} Signaling Mediated by Integrin-Associated MFG-E8. Arterioscler Thromb Vasc Biol. 2011a;31:2653–2664. doi: 10.1161/ATVBAHA.111.233619. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Motegi S, Leitner WW, Lu M, Tada Y, Sárdy M, Wu C, Chavakis T, Udey MC. Pericyte-derived MFG-E8 regulates pathologic angiogenesis. Arterioscler Thromb Vasc Biol. 2011b;31:2024–2034. doi: 10.1161/ATVBAHA.111.232587. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Neutzner M, Lopez T, Feng X, Bergmann-Leitner ES, Leitner WW, Udey MC. MFG-E8/lactadherin promotes tumor growth in an angiogenesis-dependent transgenic mouse model of multistage carcinogenesis. Cancer Res. 2007;67:6777–6785. doi: 10.1158/0008-5472.CAN-07-0165. [DOI] [PubMed] [Google Scholar]
  30. Okuyama T, Kurata S, Tomimori Y, Fukunishi N, Sato S, Osada M, Tsukinoki K, Jin HF, Yamashita A, Ito M, Kobayashi S, Hata RI, Ikawa Y, Katoh I. p63(TP63) elicits strong trans-activation of the MFG-E8/lactadherin/BA46 gene through interactions between the TA and DeltaN isoforms. Oncogene. 2008;27:308–317. doi: 10.1038/sj.onc.1210646. [DOI] [PubMed] [Google Scholar]
  31. Rao HV, Thirumangalakudi L, Desmond P, Grammas P. Cyclin D1, cdk4, and Bim are involved in thrombin-induced apoptosis in cultured cortical neurons. J Neurochem. 2007;101:498–505. doi: 10.1111/j.1471-4159.2006.04389.x. [DOI] [PubMed] [Google Scholar]
  32. Scheidl SJ, Nilsson S, Kalén M, Hellström M, Takemoto M, Håkansson J, Lindahl P. mRNA expression profiling of laser microbeam microdissected cells from slender embryonic structures. Am J Pathol. 2002;160:801–813. doi: 10.1016/S0002-9440(10)64903-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Shapiro PS, Vaisberg E, Hunt AJ, Tolwinski NS, Whalen AM, McIntosh JR, Ahn NG. Activation of the MKK/ERK pathway during somatic cell mitosis: direct interactions of active ERK with kinetochores and regulation of the mitotic 3F3/2 phosphoantigen. J Cell Biol. 1998;142:1533–1545. doi: 10.1083/jcb.142.6.1533. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Silvestre JS, Thery C, Hamard G, Boddaert J, Aguilar B, Delcayre A, Houbron C, Tamarat R, Blanc-Brude O, Heeneman S, Clergue M, Duriez M, Merval R, Levy B, Tedgui A, Amigorena S, Mallat Z. Lactadherin promotes VEGF-dependent neovascularization. Nat. Med. 2005;11:499–506. doi: 10.1038/nm1233. [DOI] [PubMed] [Google Scholar]
  35. Spinetti G, Wang M, Monticone RE, Zhang J, Zhao D, Lakatta EG. Rat aortic MCP-1 and its receptor CCR2 increase with age and alter vascular smooth muscle cell function. Arterioscler Thromb Vasc Biol. 2004;24:1397–1402. doi: 10.1161/01.ATV.0000134529.65173.08. [DOI] [PubMed] [Google Scholar]
  36. Taylor MR, Couto JR, Scallan CD, Ceriani RL, Peterson JA. Lactadherin (formerly BA46), a membrane-associated glycoprotein expressed in human milk and breast carcinomas, promotes Arg-Gly-Asp (RGD)-dependent cell adhesion. DNA Cell Biol. 1997;16:861–869. doi: 10.1089/dna.1997.16.861. [DOI] [PubMed] [Google Scholar]
  37. Wang M, Spinetti G, Monticone R, Zhang J, Pintus G, Jiang LQ, Lakatta EG. A local proinflammation sugnaling loop facilitates adverse aging-associated arterial remodeling. Plos ONE. 2011;6:e16653. doi: 10.1371/journal.pone.0016653. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Wang M, Zhang J, Spinetti G, Jiang L, Monticone R, Zhao D, Cheng L, Krawczyk M, Talan M, Pintus G, Lakatta EG. Angiotensin II activates matrix metalloproteinase type II and mimics age-associated carotid arterial remodeling in young rats. Am J Patho. 2005;167:1429–1442. doi: 10.1016/S0002-9440(10)61229-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Wang M, Lakatta EG. Altered regulation of matrix metalloproteinase-2 in aortic remodeling during aging. Hypertension. 2002;39:865–873. doi: 10.1161/01.hyp.0000014506.13322.66. [DOI] [PubMed] [Google Scholar]
  40. Wang M, Monticone RE, Lakatta EG. Arterial aging: a journey into subclinical arterial disease. Curr Opin Nephrol Hypertens. 2010a;19:201–207. doi: 10.1097/MNH.0b013e3283361c0b. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Wang M, Takagi G, Asai K, Resuello RG, Natividad FF, Vatner DE, Vatner SF, Lakatta EG. Aging increases aortic MMP-2 activity and angiotensin II in nonhuman primates. Hypertension. 2003;41:1308–1316. doi: 10.1161/01.HYP.0000073843.56046.45. [DOI] [PubMed] [Google Scholar]
  42. Wang M, Wang X, Ching CB, Chen WN. Proteomic profiling of cellular responses to Carvedilol enantiomers in vascular smooth muscle cells by iTRAQ-coupled 2-D LC-MS/MS. J Proteomics. 2010b;73:1601–1611. doi: 10.1016/j.jprot.2010.03.015. [DOI] [PubMed] [Google Scholar]
  43. Wang M, Zhang J, Jiang LQ, Spinetti G, Pintus G, Monticone R, Kolodgie FD, Virmani R, Lakatta EG. Proinflammatory profile within the grossly normal aged human aortic wall. Hypertension. 2007;50:219–227. doi: 10.1161/HYPERTENSIONAHA.107.089409. [DOI] [PubMed] [Google Scholar]
  44. Wang M, Zhao D, Spinetti G, Zhang J, Jiang LQ, Pintus G, Monticone R, Lakatta EG. Matrix metalloproteinase 2 activation of transforming growth factor-beta1 (TGF-beta1) and TGF-beta1-type II receptor signaling within the aged arterial wall. Arterioscler Thromb Vasc Biol. 2006;26:1503–1509. doi: 10.1161/01.ATV.0000225777.58488.f2. [DOI] [PubMed] [Google Scholar]
  45. Yang C, Hayashida T, Forster N, Li C, Shen D, Maheswaran S, Chen L, Anderson KS, Ellisen LW, Sgroi D, Schmidt EV. The integrin alpha(v)beta(3-5) ligand MFG-E8 is a p63/p73 target gene in triple-negative breast cancers but exhibits suppressive functions in ER(+) and erbB2(+) breast cancers. Cancer Res. 2011;71:937–945. doi: 10.1158/0008-5472.CAN-10-1471. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Zeelenberg IS, Ostrowski M, Krumeich S, Bobrie A, Jancic C, Boissonnas A, Delcayre A, Le Pecq JB, Combadière B, Amigorena S, Théry C. Targeting tumor antigens to secreted membrane vesicles in vivo induces efficient antitumor immune responses. Cancer Res. 2008;68:1228–1235. doi: 10.1158/0008-5472.CAN-07-3163. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supp Fig S1-S8
NIHMS362819-supplement-Supp_Fig_S1-S8.pdf (8.9MB, pdf)

RESOURCES