Skip to main content
PLOS One logoLink to PLOS One
. 2012 May 16;7(5):e36549. doi: 10.1371/journal.pone.0036549

K65R in Subtype C HIV-1 Isolates from Patients Failing on a First-Line Regimen Including d4T or AZT: Comparison of Sanger and UDP Sequencing Data

Patricia Recordon-Pinson 1,2, Jennifer Papuchon 1,2, Sandrine Reigadas 1,2, Alaka Deshpande 3, Hervé Fleury 1,2,*
Editor: Luis Menéndez-Arias4
PMCID: PMC3353948  PMID: 22615779

Abstract

Background

We and others have shown that subtype C HIV-1 isolates from patients failing on a regimen containing stavudine (d4T) or zidovudine (AZT) exhibit thymidine-associated mutations (TAMs) and K65R which can impair the efficacy of Tenofovir (TDF) at second line. Depending on the various studies, the prevalence of K65R substitution as determined by the Sanger method ranges from 4 to 30%. Our aim was to determine whether ultra-deep pyrosequencing (UDPS) could provide more information than the Sanger method about selection of K65R in this population of patients.

Methods

27 subtype C HIV-1 isolates from treated patients failing on a regimen with d4T or AZT plus lamivudine (3TC) plus nevirapine (NVP) or efavirenz (EFV) and who had been sequenced by Sanger were investigated by UDPS at codon 65 of the reverse transcriptase (RT). 18 isolates from naïve patients and dilutions of a control K65R plasmid were analysed by Sanger plus UDPS.

Results

Analysis of Sanger sequences of subtype C HIV-1 isolates from naïve patients exhibited expected polymorphic substitutions compared to subtype B but no drug resistance mutations (DRMs). Quantitation of K65R variants by UDPS ranged from <0.4% to 3.08%. Sanger sequences of viral isolates from patients at failure of d4T or AZT plus 3TC plus NVP or EFV showed numerous DRMs to nucleoside reverse transcriptase inhibitors (NRTIs) including M184V, thymidine-associated mutations (TAMs) plus DRMs to non- nucleoside reverse transcriptase inhibitors (NNRTIs). Two K65R were observed by Sanger in this series of 27 samples with UDPS percentages of 27 and 87%. Other samples without K65R by Sanger exhibited quantities of K65R variants ranging from <0.4% to 0.80%, which were below the values observed in isolates from naïve patients.

Conclusions

While Sanger sequencing of subtype C isolates from treated patients at failure of d4T or AZT plus 3TC plus NVP or EFV exhibited numerous mutations including TAMs and 8% K65R, UDPS quantitation of K65R variants in the same series did not provide any more information than Sanger.

Introduction

We and others [1]–[2] have shown that subtype C HIV-1 isolates from Indian patients who fail on first-line HAART composed of stavudine (d4T) or zidovudine (AZT) plus lamivudine (3TC) plus nevirapine (NVP) or efavirenz (EFV) and according to WHO clinical and/or immunological criteria exhibit numerous drug resistance mutations (DRMs) to nucleoside reverse transcriptase inhibitors (NRTIs) and to non-nucleoside reverse transcriptase inhibitors (NNRTIs) in the reverse transcriptase (RT) part of the viral genome, including thymidine-associated mutations (TAMs) and K65R (the prevalence of which was around 8% in our series). When the RT sequences were introduced into the ANRS and Stanford algorithms, both algorithms showed that the DRMs of the first line induce a decreased susceptibility to tenofovir (TDF), an NRTI drug that is still used as second line in some southern countries. This has implications for public health because patients who fail with a first-line regimen including d4T or AZT plus 3TC plus NVP or EFV and who switch to 3TC plus TDF plus ritonavir-boosted lopinavir (LPV/RTV) will in fact not be fully susceptible to TDF and therefore to the second-line regimen. TAMs and K65R are known to induce partial or full resistance to TDF [3]. Regarding K65R, similar studies carried out in the same context of failure on a first-line regimen including d4T, AZT or dideoxyinosine (ddI) showed a prevalence of 4% in a South African population where subtype C was predominant [4], 10.9% in CRF02_AG plus G viruses in Nigeria [5], 14% in subtype C isolates from South Africa [6], 24% in Malawi with subtype C viruses [7] and up to 30% in Botswana [8].

From a molecular point of view, it has been demonstrated that the RT KKK nucleotide motif at codons 64, 65, 66 in reverse transcriptase of subtype C HIV-1 appears to lead to template pausing that facilitates the selection of K65R, even in isolates from untreated patients [9]–[12]. Moreover, it has also been shown that the KKK motif in this subtype can lead to PCR-induced K65R [13].

The aim of the present study was to clarify the prevalence of K65R in these subtype C isolates from patients failing on a first line including d4T or AZT. Since we had the prevalence of K65R by the Sanger sequencing method, we investigated K65R variants by ultradeep pyrosequencing (UDPS) in the same samples as those already used for bulk sequencing and sought whether UDPS provided additional knowledge to the Sanger results.

Methods

Subtype C HIV-1 isolates from Indian patients failing (according to WHO clinical and/or immunological criteria) on a first-line treatment including d4T or AZT plus 3TC plus NVP or EFV were sequenced on RT by the Sanger method, and the sequences were recorded in the Los Alamos database (GenBank JF895621–JF895673). Among these samples, 27 were randomly selected for investigation by UDPS using the Roche GS Junior equipment. RNA extracted previously from the samples was used to amplify a short region of RT with primers including specific sequences for the GS Junior system (Table 1). The reverse transcription used SuperScriptIII RTPCR enzyme (Invitrogen, Carlsbad, CA) with 10 ul RNA, one cDNA synthesis cycle at 50°C for 30 min and 40 cycles of PCR amplification. The nested PCR used FastStart HiFi (Roche) with 2 ul of RTPCR product, 40 cycles of PCR amplification. Amplicons were purified by AMPure kit (Agencourt Biosciences), quantified using Quant-iT Picogreen (Invitrogen) and pooled at equimolar concentrations. Clonal amplification on beads (EmPCR) was performed using the 454 Life Science reagents that enable bidirectional sequencing, composed of a 30 cycle PCR amplification. DNA containing beads were recovered and UDPS was performed on the GS Junior sequencer (454 Life Sciences). Most of the samples had HIV viral loads >100,000 copies/mL (mean: 379,753 copies/mL; IQR: 11209–5,817,977 copies/mL) and at least 1,000 clonal sequencing reads were used for the analysis, allowing a 0.4% accuracy in the quantitation [14]. Positions studied were codon 65 and codon 70, which was chosen as a TAM position in NRTI-treated patients leading to K70R, because it has been frequently observed in the studied isolates and because 70R is considered to be a DRM and not at all a substitution potentially related to polymorphism.

Table 1. Primers used for GS Junior ultradeep sequencing of RT.

sequence 5′-3′ HXB2 position
RT PCR GS Junior
primer 5′ AGTAGGACCTACACCTGTCA 2480 to 2499
primer 3′ CTGTTAGTGCTTTGGTTCCTCT 3399 to 3420
Nested GS Junior
primer 5′ GGCCATTGACAGAAGAAAAAATAAAAGC 2620 to 2647
primer 3′ GGGATGTGGTATTCCTAATTGAACTTCC 2813 to 2840

Since the viral isolates obtained at initiation of first-line therapy were not available, the data obtained by Sanger and UDPS in isolates from patients at failure were compared to those of subtype C isolates from 18 naïve patients. Some of their bulk sequences have been previously published by our group [15]. All codons were analysed by Sanger while potential polymorphism at codons 65 and 70 was investigated by both Sanger and UDPS. As a control, we used two subtype C MJ4 plasmids, one wild type and one bearing K65R (both provided by Mark Wainberg's group in Montreal). The UDPS results of the study are available in GenBank under accession number SRA 050640.

Results

Table 2 shows the Sanger results of viral isolates from naïve patients and UDPS results of codons 65 plus 70 in these isolates, together with UDPS results of control plasmids for codons 65 and 70. Analysis of Sanger results for naïve patients showed an extensive polymorphism compared to subtype B without involvement of substitutions 65R and 70R. K70R was <0.4% by UDPS in all isolates from naïve patients. K65R ranged from <0.4% to 3.08% (mean 0.66±0.76 standard deviation, SD).

Table 2. RT polymorphic substitutions (Sanger) compared to reference HIV-1 B in isolates from naïve patients and amounts of K65R and K70R mutations in the same isolates plus control plasmids.

naive patients RT sequence by Sanger method K65R K70R
1031 35Q, 39D, 48T, 48S, 60I, 73K, 73I, 122K, 135R, 162N, 173A, 174K, 177E, 178L, 200A, 207E, 211K, 214F, 245Q <0.4% <0.4%
1050 21I, 35T, 39E, 43K, 43R, 48T, 60I, 90I, 90V, 106M, 121Y, 135T, 135I, 158A, 158S, 162A, 162G, 170P, 170L, 173A, 177E, 179D, 200A, 207E, 211K, 214F, 221H, 221Y, 245Q 0,44% <0.4%
1059 13R, 16N, 21G, 35T, 39D, 43R, 48T, 60I, 82R, 102Q, 107T, 107I, 121Y, 142I, 142V, 162A, 173A, 177E, 177D, 179I, 179V, 196E, 196G, 200A, 202V, 207G, 211K, 214F, 245Q, 250E 0,56% <0.4%
1071 13K, 13R, 35T, 36A, 39E, 48T, 60I, 77I, 77F, 123E, 142V, 166R, 173A, 177E, 195L, 200A, 202V, 207A, 211K, 214F, 245Q 0,42% <0.4%
1102 35T, 39N, 48T, 60I, 121H, 121Y,135R, 162A, 173A, 174K, 177E,200A, 207E, 211K, 214F, 245Q 0,71% <0.4%
1113 20R, 35T, 36E, 36A, 39D, 60I,103K, 103N, 106M, 106V, 118I,121D, 121Y, 135T, 139S, 162A,165V, 173T, 177E, 179D, 179V, 200A, 207E, 211K, 245Q 1,22% <0.4%
1114 28K, 32E, 35T, 36A, 39D, 48T, 60I, 121H, 173A, 174Q, 174R, 177E, 178L, 190R, 194H, 200A, 207E, 214C, 225L <0.4% <0.4%
1116 20R, 35T, 39E, 48T, 60I, 102K, 102Q, 121Y, 135T, 138A, 162C, 173A, 200A, 207E, 207A, 211K, 214L, 214F, 245Q 1,18% <0.4%
1117 35T, 36E, 36A, 39D, 48T, 60I, 64R, 121Y, 121C, 166R, 173T, 173A, 175N, 175H, 177E, 200A, 207K, 214F, 245Q, 250E 0,35% <0.4%
1121 35T, 39E, 48T, 60I, 110H, 110D,121Y, 135R, 173T, 177E, 200A,207E, 214F, 217P, 217S, 245Q,248R, 249R, 251V, 252G, 254F, 255K 1,33% <0.4%
1123 10I, 35T, 36A, 39D, 48T, 60I, 121H, 139T, 139S, 173S, 174K, 177E, 178I, 178V, 200A, 207A, 211K, 214F, 245Q, 252C <0.4% <0.4%
1125 13N, 35T, 39D, 43R, 48T, 60I, 121H, 121Y, 135T, 162A, 173A, 174R, 177E, 200A, 207E, 211K, 214F, 245Q 0,85% <0.4%
1129 35T, 36A, 39D, 48T, 60I, 122K,139A, 173T, 177E, 178M, 200A, 207E, 211K, 214F, 245Q 0,75% <0.4%
1131 36A, 39E, 48T, 55T, 55P, 73K,73I, 123S, 138E, 138V, 173A,177E, 200A, 207E, 211K, 214F, 245Q 3,08% <0.4%
1132 35T, 36A, 39D, 48T, 60I, 122P,162C, 166R, 173T, 173A, 177E,200A, 202I, 202V, 207E, 211K, 214F, 245Q 1,02% <0.4%
1133 35T, 36A, 39D, 48T, 60I, 122P,123E, 161Q, 161L, 166R, 173A,177E, 200A, 207E, 211K, 214F, 220K, 220I, 245E, 248K <0.4% <0.4%
1135 35T, 36A, 39D, 48T, 49K, 49R,60I, 121C, 159I, 159V, 160C,160F, 162S, 162C, 165I, 173T,173A, 177E, 178M, 178L, 200A, 207E, 214F, 245Q <0.4% <0.4%
1139 35T, 39N, 48T, 60I, 102R, 104R, 121Y, 162A, 173A, 200A, 207K, 211K, 214F, 245Q <0.4% <0.4%
plasmid K65R 10% 94% <0.4%
plasmid K65R 5% 2,30% <0.4%
plasmid K65R 1% 0,90% <0.4%

Footnote to Table 2 . Two subtype C MJ4 plasmids, one with K65K (wild type) and one with K65R were used to amplify RT region before sequencing by UDPS. Amplicon pools were not prepared in equimolar concentrations but with different percentages of K65R mutation. The theoretical and observed values of K65R plasmid dilutions were 100%∶94%, 5%∶2.30% and 1%∶0.90%.

Regarding the 27 isolates from treated patients at failure, the drug resistance mutations (DRMs) according to the French ANRS algorithm and following bulk DNA sequencing (Sanger) are listed in Table 3. Most of them exhibited the M184V mutations to 3TC of the regimen plus TAMs to d4T and/or AZT and DRMs to NNRTIs. Only two samples (455 and 493) bore a K65R mutation, one (455) cumulating K65R and the Q151M nucleoside analog mutation (NAM). Table 4 compares the Sanger and UDPS data of these isolates at codons 65 and 70. Quantitation of K65R by UDPS ranged from <0.4% to 87%. In the two isolates with K65R by Sanger, percentages of K65R by UDPS were 27% and 87%. If we only consider positions 65 found not to have K65R with Sanger (25 samples), the quantities of K65R ranged from <0.4% to 0.80% (0.162±0.22 SD). K70R with UDPS ranged from <0.4% to 100%. Eight samples exhibited K70R with Sanger and the corresponding UDPS values ranged from 34.50 to 100%. Regarding positions 70 found not to have the K70R mutation with Sanger (19), all of them were <0.4% for 70R by UDPS except two samples (470 and 489 with values of 1.80 and 4.40% respectively).

Table 3. RT bulk sequences of 27 subtype C HIV-1 isolates failing on first line.

patient RT sequence by Sanger method patient RT sequence by Sanger method
454 115F, 151M, 184V, 219Q, 90I, 181C, 221Y 479 41L, 44D, 67N, 75M, 184V, 215Y, 98G, 101E, 179I, 181C, 190A, 221Y
455 41L, 65R, 151M, 184V, 181V, 190A 480 41L, 67N, 69D, 70R, 184V, 210W, 215Y, 98G, 106M, 179I, 181C, 190A
456 67N, 70R, 184V, 215F, 219E, 98S, 181C 481 41L, 67N, 69insert, 75M, 184I, 210W, 215Y, 90I, 103N
461 41L, 44D, 69D, 184V, 90I, 179I, 181C 482 41L, 67N, 69D, 184V, 215Y, 101E, 179I, 188L, 190A
463 41L, 67N, 69D, 70R, 184V, 215Y, 188L, 221Y 485 no resistance mutation
464 184V, 98G, 101E, 181C, 190A 486 41L, 67N, 74V, 184V, 215Y, 101E, 138Q, 190S
465 41L,44D, 67N, 74V, 184V, 210W, 215Y, 101E, 179T, 181C, 190A 487 67N, 69D, 70R, 184V, 219Q, 98G, 179I, 190A
466 41L, 67N, 69D, 69N, 75M, 184V, 210W, 215Y, 101E, 179I, 190A 488 41L, 184V, 215Y, 103N, 225H
469 41L, 67N, 69N, 70R, 184V, 215F, 219E, 103N, 190A 489 74V, 184V, 215Y, 101E, 179I, 190C
470 no resistance mutation 493 65R, 75A, 219E, 179T, 181C, 190A, 221Y
471 41L, 184V, 215Y, 98G, 101E, 190A 495 41L, 184V, 210W, 215F, 90I, 103N
472 41L, 67N, 70R, 184V, 215Y, 219E, 181C 496 41L, 67N, 70R, 75M, 184V, 215F, 219Q, 106M, 190A
473 41L, 44D, 67N, 70R, 75M, 184V, 215Y, 103N, 190A 501 41L, 67N, 75M, 184V, 210W, 215Y, 101E, 190S
475 41L, 67N, 69D, 75M, 184V, 215Y, 101E, 179I, 188L, 190A

DRMs are noted according to ANRS.

Table 4. Comparison of Sanger and UDPS sequencing results for RT codons 65 and 70; same isolates as in Table 3.

K65R K70R
patient Sanger UDPS Sanger UDPS
454 N <0.4% N <0.4%
455 O 87% N <0.4%
456 N <0.4% O 100%
461 N <0.4% N <0.4%
463 N <0.4% O 34.6%
464 N 0.14% N <0.4%
465 N <0.4% N <0.4%
466 N 0.5% N <0.4%
469 N <0.4% O 94%
470 N <0.4% N 1.8%
471 N <0.4% N <0.4%
472 N 0.46% O 81.6%
473 N <0.4% O 97.1%
475 N <0.4% N <0.4%
479 N 0.24% N <0.4%
480 N 0.25% O 84.4%
481 N 0.21% N <0.4%
482 N <0.4% N <0.4%
485 N <0.4% N <0.4%
486 N 0.3% N <0.4%
487 N 0.25% O 90.1%
488 N 0.5% N <0.4%
489 N <0.4% N 4.4%
493 O 27% N <0.4%
495 N 0.4% N <0.4%
496 N 0.8% O 98.15%
501 N <0.4% N <0.4%

Sanger Y: presence of mutation; N: absence of mutation. UDPS: Frequency of mutations observed in samples.

Discussion

Sanger and UDPS results in isolates from naïve patients

Although UDPS has limitations particularly with regard to polymerization and pyrosequencing errors [13], [16], recent studies with different methods (UDPS, allele specific PCR) have shown that K65R is identified more frequently in subtype C HIV-1 from naïve patients [14], [17]. In our naïve patients, there was a clear difference between K70R (mean 0%) and K65R (mean 0.66%) (Table 2). Our data on position 65 are in agreement with those of Kozal et al [14], ranging from <0.4% to 1.33% apart from one sample (1131) at 3.08%. We were not expecting selection of K65R in this population of patients who were quite distant from primary infection and therefore from potential transmission of K65R mutants. For us, this naïve population was the basis of an evaluation of natural variation at codon 65 in subtype C HIV-1.

Sanger and UDPS results of isolates from treated patients at failure

The Sanger results of isolates from treated patients were as expected with a predominance of M184V, numerous TAMs of pathway1 (M41L, D67N, K70R, L210W, T215Y/F) and DRMs to NNRTIs (mainly K101E, K103N, V106M, Y181C, G190A). As mentioned above, 2 isolates of the series exhibited a K65R substitution.

With regard to UDPS results at codon 70, the quantitative data were different from those recorded in naïve patients: 8 isolates exhibiting K70R with Sanger had UDPS K70R values above 34.60%, while 2 samples without K70R with Sanger (470 and 489) had K70R variants at quantities above the <0.4% background observed in naïve patients. We hypothesize that these isolates are undergoing a process of selecting K70R mutations. Regarding the K65R values apart the two samples with K65R by Sanger, the UDPS quantities of K65R variants were low and below those of isolates from naïve patients. Our results are not in accordance with those obtained by another group [18] using an allele- specific PCR which exhibited minority variants of K65R in four subtype C HIV-1 isolates out of 30 patients having received NRTIs at first line; it must be pointed out that this technique uses an intercalating dye and high-melt resolution assay which can be difficult to interpret due to genomic variability in the flanking region of codon 65.

K65R substitutions are generated in subtype C isolates from naïve patients due to the 64–65–66 motif. There are some constraints in experienced patients failing on a suboptimal regimen with d4T or AZT plus 3TC plus NVP or EFV. We first hypothesize that 184V, which was the most prevalent mutation observed in our series of treated patients at failure, has dampened the emergence of 65R as noted by others [3]. Second, there is an antagonism between TAMs and K65R, while the latter can be found in association with NAMs (Q151M) and is considered to be increasingly selected in the presence of DRMs to NNRTIs and particularly Y181C and G190A. As noted above, the prevalence of K65R in this clinical context of failure ranges from 4 to 30%. In our series, we estimate this prevalence to be 8% and the UDPS data did not reveal any process of K65R selection that cannot be assessed by Sanger sequencing.

Acknowledgments

We thank M. Wainberg's group in McGill University, Montreal, for providing the control K65R plasmid. We thank Roche for providing the UDPS GS Junior equipment. The authors are indebted to Ray Cooke for linguistic assistance.

Footnotes

Competing Interests: The authors have received funding from Merck Sharp and Dohme-Chibret for this study. There are no patents, products in development or marketed products to declare. This does not alter the authors' adherence to all the PLoS ONE policies on sharing data and materials.

Funding: This study was funded by Merck Sharp and Dohme-Chibret (grant 3Z22204938). JP and SR were supported by Agence Nationale de Recherches sur le Sida et les Hépatites Virales.The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Deshpande A, Jeannot AC, Schrive MH, Wittkop L, Pinson P, et al. Analysis of RT sequences of subtype C HIV-type 1 isolates from indian patients at failure of a first-line treatment according to clinical and/or immunological WHO guidelines. AIDS Res Hum Retroviruses. 2010;3:343–350. doi: 10.1089/aid.2009.0217. [DOI] [PubMed] [Google Scholar]
  • 2.Kumarasamy N, Madhavan K, Venkatesh K, Saravanan S, Kantor R, et al. High frequency of clinically significant mutations after first-line generic highly active antiretroviral therapy failure: implications for second-line options in resource-limited settings. Clin Infect Dis. 2009;49:306–309. doi: 10.1086/600044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Brenner BG, Coutsinos D. The K65R mutation in HIV-1 reverse transcriptase: genetic barriers, resistance profile and clinical implications. HIV Ther. 2009;3:583–594. doi: 10.2217/hiv.09.40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.van Zyl GU, van der Merwe L, Claassen M, Zeier M, Preiser W. Antiretroviral resistance patterns and factors associated with resistance in adult patients failing NNRTI-based regimens in the Western Cape, South Africa. J Med Virol. 2011;83:1764–1769. doi: 10.1002/jmv.22189. [DOI] [PubMed] [Google Scholar]
  • 5.Hawkins CA, Chaplin B, Idoko J, Ekong E, Adewole I, et al. Clinical and genotypic findings in HIV-infected patients with the K65R mutation failing first-line antiretroviral therapy in Nigeria. J Acquir Immune Defic Syndr. 2009;52:228–234. doi: 10.1097/QAI.0b013e3181b06125. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Pillay V, Pillay C, Kantor R, Venter F, Levin L, et al. HIV type 1 subtype C drug resistance among pediatric and adult South African patients failing antiretroviral therapy. AIDS Res Hum Retroviruses. 2008;11:1449–1454. doi: 10.1089/aid.2008.0180. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Hosseinipour MC, van Oosterhout JJ, Weigel R, Phiri S, et al. The public health approach to identify antiretroviral therapy failure: high-level nucleoside reverse transcriptase inhibitor resistance among Malawians failing first-line antiretroviral therapy. J AIDS. 2009;Jun 1;23(9):1127–34. doi: 10.1097/QAD.0b013e32832ac34e. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Avalos A, Brenner B, Gaolathe T, Mine M, Gaseitsiwe S, et al. High prevalence of the K65R mutation in human immunodeficiency virus type 1 subtype C isolates from infected patients in Botswana treated with didanosine-based regimens. Antimicrob Agents Chemother. 2006;50:4182–4185. doi: 10.1128/AAC.00714-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Coutsinos D, Invernizzi CF, Xu H, Moisi D, Oliveira M, et al. Template usage is responsible for the preferential acquisition of the K65R reverse transcriptase mutation in subtype C variants of human immunodeficiency virus type 1. J Virol. 2009;83:2029–2033. doi: 10.1128/JVI.01349-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Coutsinos D, Invernizzi CF, Xu H, Brenner BG, Wainberg MA. Factors affecting template usage in the development of K65R resistance in subtype C variants of HIV type-1. Antivir Chem Chemother. 2010;20:117–131. doi: 10.3851/IMP1443. [DOI] [PubMed] [Google Scholar]
  • 11.Coutsinos D, Invernizzi CF, Moisi D, Oliveira M, Martinez-Cajas JL, et al. A template-dependent dislocation mechanism potentiates K65R reverse transcriptase mutation development in subtype C variants of HIV-1. PLoS One. 2011;6:e20208. doi: 10.1371/journal.pone.0020208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Invernizzi CF, Coutsinos D, Oliveira M, Moisi D, Brenner BG, et al. Signature nucleotide polymorphisms at positions 64 and 65 in reverse transcriptase favor the selection of the K65R resistance mutation in HIV-1 subtype C. J Infect Dis. 2009;200:1202–1206. doi: 10.1086/605894. [DOI] [PubMed] [Google Scholar]
  • 13.Varghese V, Wang E, Babrzadeh F, Bachmann MH, Shahriar R, et al. Nucleic acid template and the risk of a PCR-Induced HIV-1 drug resistance mutation. PLoS One. 2010;5:e10992. doi: 10.1371/journal.pone.0010992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Kozal MJ, Chiarella J, St John EP, Moreno EA, Simen BB, et al. Prevalence of low-level HIV-1 variants with reverse transcriptase mutation K65R and the effect of antiretroviral drug exposure on variant levels. Antivir Ther. 2011;16:925–929. doi: 10.3851/IMP1851. [DOI] [PubMed] [Google Scholar]
  • 15.Deshpande A, Karki S, Recordon-Pinson P, Fleury HJ. Drug Resistance Mutations in HIV Type 1 Isolates from Naive Patients Eligible for First Line Antiretroviral Therapy in JJ Hospital, Mumbai, India. AIDS Res Hum Retroviruses. AIDS Res Hum Retroviruses. 2011;27:1345–1347. doi: 10.1089/AID.2011.0066. [DOI] [PubMed] [Google Scholar]
  • 16.Shafer RW. Low-abundance drug-resistant HIV-1 variants: finding significance in an era of abundant diagnostic and therapeutic options. J Infect Dis. 2009;199:610–612. doi: 10.1086/596737. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Li JF, Lipscomb JT, Wei X, Martinson NA, Morris L, et al. Detection of low-level K65R variants in nucleoside reverse transcriptase inhibitor-naive chronic and acute HIV-1 subtype C infections. J Infect Dis. 2011;203:798–802. doi: 10.1093/infdis/jiq126. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Toni TA, Brenner BG, Asahchop EL, Ntemgwa M, Moisi D, et al. Development of an allele-specific PCR for detection of the K65R resistance mutation in patients infected with subtype C human immunodeficiency virus type 1. Antimicrob Agents Chemother. 2010;54:907–911. doi: 10.1128/AAC.01080-09. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES