Skip to main content
Frontiers in Plant Science logoLink to Frontiers in Plant Science
. 2012 Feb 7;3:17. doi: 10.3389/fpls.2012.00017

Diversification and Expression of the PIN, AUX/LAX, and ABCB Families of Putative Auxin Transporters in Populus

Nicola Carraro 1, Tracy Eizabeth Tisdale-Orr 2, Ronald Matthew Clouse 3, Anne Sophie Knöller 4, Rachel Spicer 5,*
PMCID: PMC3355733  PMID: 22645571

Abstract

Intercellular transport of the plant hormone auxin is mediated by three families of membrane-bound protein carriers, with the PIN and ABCB families coding primarily for efflux proteins and the AUX/LAX family coding for influx proteins. In the last decade our understanding of gene and protein function for these transporters in Arabidopsis has expanded rapidly but very little is known about their role in woody plant development. Here we present a comprehensive account of all three families in the model woody species Populus, including chromosome distribution, protein structure, quantitative gene expression, and evolutionary relationships. The PIN and AUX/LAX gene families in Populus comprise 16 and 8 members respectively and show evidence for the retention of paralogs following a relatively recent whole genome duplication. There is also differential expression across tissues within many gene pairs. The ABCB family is previously undescribed in Populus and includes 20 members, showing a much deeper evolutionary history, including both tandem and whole genome duplication as well as probable gene loss. A striking number of these transporters are expressed in developing Populus stems and we suggest that evolutionary and structural relationships with known auxin transporters in Arabidopsis can point toward candidate genes for further study in Populus. This is especially important for the ABCBs, which is a large family and includes members in Arabidopsis that are able to transport other substrates in addition to auxin. Protein modeling, sequence alignment and expression data all point to ABCB1.1 as a likely auxin transport protein in Populus. Given that basipetal auxin flow through the cambial zone shapes the development of woody stems, it is important that we identify the full complement of genes involved in this process. This work should lay the foundation for studies targeting specific proteins for functional characterization and in situ localization.

Keywords: auxin, PIN, AUX/LAX, ABCB, Populus

Introduction

Plant development is highly plastic owing to growth via meristems, and this plasticity is fundamental to the ability of plants, as sessile organisms, to adapt to changing environments. Developmental flexibility is particularly important for trees, which can live for thousands of years in the same place, growing massive bodies that must face a multitude of environmental challenges. The plant hormone auxin is well established as a key regulator of plant morphogenesis and in recent years the molecular mechanisms of transport and action have been elucidated. With the publication of the Populus trichocarpa genome (Tuskan et al., 2006), new tools to improve our understanding of secondary growth − the type of vascular growth that defines woody plants − became available. Populus is not only the dominant model species for woody plant growth, but also a valuable crop for pulp, bioenergy production, and carbon sequestration. Thus, understanding the mechanisms that underlie auxin transport in Populus is of interest both in the context of the evolution of plant development and as a means to manipulate plant architecture, biomass production, and fiber quality.

The auxins as a group include several molecules, with the most abundant natural form in plants being indole-3-acetic acid (IAA). Auxin synthesis occurs in young, actively growing tissues including shoot tips, young leaves, and germinating seeds (Ljung et al., 2001a,b), and increasing evidence suggests that synthesis takes place in the roots as well (Ljung et al., 2005). Auxin moves from the sites of production throughout the plant via two routes: long distance transport of conjugated forms in the phloem and short distance transport of “free” (non-conjugated) auxin via polar auxin transport (PAT). By far the better studied route, PAT is a form of active intercellular transport mediated by proteins inserted in the plasma membrane that belong to three distinct families. The PIN and ABCB families encode efflux proteins (i.e., proteins that facilitate movement out of cells), whereas members of the AUX/LAX family facilitate auxin entry into cells, along with passive diffusion. PAT is relatively slow (5–20 mm/h; Lomax et al., 1995), saturable and can be impaired by the application of both competitive inhibitors and inhibitors of protein synthesis (Katekar and Geissler, 1980; Sussman and Goldsmith, 1981). This form of transport is considered polar because the protein carriers are often asymmetrically positioned in the plasma membrane such that transport is directional. Transport directionality can then be altered on relatively short timescales in response to repositioning of the protein carriers. Feedback mechanisms also exist such that PAT is often self-reinforcing, with multiple transport proteins themselves being upregulated by auxin (Sauer et al., 2006; Titapiwatanakun and Murphy, 2009).

The PIN proteins have been studied extensively in Arabidopsis thaliana (Chen et al., 1998; Luschnig et al., 1998; Müller et al., 1998; Utsuno et al., 1998; Friml et al., 2002a,b, 2003) and show dynamic polar localization at the plasma membrane (PIN1, PIN2, PIN3, PIN7) or in the endoplasmic reticulum (ER) (PIN5, PIN6, PIN8; Mravec et al., 2009; Friml and Jones, 2010). PIN1 was first described as mediating PAT and determining organ outgrowth at the inflorescence (Okada et al., 1991; Gälweiler et al., 1998; Vernoux et al., 2011). Subsequently its role in embryogenesis, vein patterning, vascular development, and root development were established (Friml et al., 2003; Vieten et al., 2005; Scarpella et al., 2006; Petrásek and Friml, 2009). The characterization of PIN genes has been expanded to include the monocotyledons Zea mays and Oryza sativa, both of which express several PINs thought to be specific to the monocots. In maize, ZmPIN1a, b, and c are responsible for directing auxin transport in the male and female inflorescences and in the floret meristems (Carraro et al., 2006; Wu and McSteen, 2007). They are also involved in endosperm and embryonic development (Forestan et al., 2010) and in the maintenance of phyllotaxy (Lee et al., 2009). The monocot-specific PINs from rice (OsPIN9, OsPIN10a, and OsPIN10b) are highly expressed in adventitious root primordia and pericycle cells at the stem-base, suggesting that they may have evolved to promote adventitious root development (Wang et al., 2009).

Members of the AUXIN/LIKE AUXIN (AUX/LAX) family in Arabidopsis (Bennett et al., 1996; Yemm et al., 2004) are largely responsible for auxin influx, although the protonated form of auxin (IAAH) is able to passively diffuse into cells. The founder member AUX1 encodes a plasma membrane protein that belongs to the amino acid permease family of proton-driven transporters and functions as an anionic symporter (Swarup et al., 2005; Yang et al., 2006). AUX1-mediated IAA uptake is implicated in gravitropic response, as the agravitropic phenotype of the aux1 mutant can be phenocopied in wild-type seedlings by applying the auxin influx carrier inhibitor 1-naphthoxyaceticacids (1-NOA) and rescued using the membrane-permeable auxin 1-naphthaleneacetic acid (NAA; Swarup et al., 2001; Yemm et al., 2004). The paralogs of AUX1, LAX1, LAX2, and LAX3 encode proteins that maintain a correct phyllotactic pattern at the shoot apical meristem (SAM), as they act together with PIN1-mediated auxin efflux (Bainbridge et al., 2008). LAX3 is also involved in the development of lateral root primordia (Swarup et al., 2008).

The involvement of ABCB [ATP-binding cassette (ABC) transporters of the B class, previously known as multidrug resistance (MDR)/Phosphoglycoprotein (PGP)] proteins in auxin transport was first hypothesized when expression of ABCB1/PGP1 in Arabidopsis was found to regulate hypocotyl elongation in a light-dependent fashion (Sidler et al., 1998). Subsequently, ABCB1 was shown to function with ABCB19/PGP19/MDR1 in mediating PAT (Noh et al., 2001). ABCB1 and ABCB19 are the closest Arabidopsis orthologs of mammalian ABCB1-type MDR transporters and although specificity for auxin is not assured (Lee et al., 2008), some appear to transport auxin with relatively high substrate specificity (Titapiwatanakun and Murphy, 2009; Yang and Murphy, 2009). ABCB14 and ABCB15 promote auxin transport along the inflorescence of Arabidopsis, where they are expressed in vascular tissue and interfascicular fibers. Inflorescence stems in both knockout mutants show a reduction in PAT (Kaneda et al., 2011). ABCB4 from Arabidopsis is involved in basipetal PAT in the root (Terasaka et al., 2005; Wu et al., 2007; Kubeš et al., 2011) and, although most ABCBs studied to date function as efflux carriers, heterologous expression of ABCB4 suggests that it functions as an auxin influx carrier under low concentrations of IAA and reverses to efflux when IAA concentrations increase (Yang and Murphy, 2009). The ABCB1/PGP1 ortholog has been cloned in maize (Brachytic2/ZmPGP1) and in Sorghum bicolor (dwarf3/SbPGP1) and shown to be responsible for IAA transport along the stem (Multani et al., 2003; Knöller et al., 2010).

Our understanding of PAT and its role in development has advanced considerably in Arabidopsis and to a lesser extent in monocots, but the functional significance of these transport proteins − particularly the ABCBs − remain largely unknown in woody plants. Woody plants are defined by the production of secondary vascular tissue, specifically secondary xylem and phloem. These vascular tissues are derived from a lateral meristem called the vascular cambium that encircles the stem, adding new cells that will ultimately differentiate into xylem toward the inside of the stem and phloem toward the outside. Given the demonstrated role of PAT in vascular development in herbaceous plants it seems logical to expect a role in secondary growth. Indeed, the vascular cambium contains high levels of IAA in both Pinus and Populus, with a peak concentration occurring either in the cambial initials themselves, or perhaps more likely, in the earliest differentiating xylem elements (Uggla et al., 1996, 1998; Tuominen et al., 1997; Hellgren et al., 2004). Concentrations rapidly decline through the regions of cell differentiation to near zero in mature secondary xylem and phloem. Auxin transport in the cambium is basipetal (Lachaud and Bonnemain, 1984; Uggla et al., 1998; Kramer et al., 2008) and several members of the PIN and AUX/LAX gene families are expressed in developing Populus stems (Schrader et al., 2003, 2004; Nilsson et al., 2008). Furthermore, expression of one or more PIN and AUX/LAX genes is downregulated with the onset of dormancy (Schrader et al., 2003, 2004) and upregulated following exogenous application of IAA and/or gibberellins (Schrader et al., 2003; Björklund et al., 2007). Despite several excellent studies in Populus, our knowledge of the molecular mechanisms that regulate PAT in woody plants is essentially restricted to the expression patterns of just three PIN and AUX/LAX genes. A more comprehensive understanding of PAT gene and protein function in Populus will help to clarify the molecular mechanisms controlling vascular pattering in woody plants and explain the link(s) between short and long distance auxin transport in species with extensive stem development.

Here we present the first comprehensive account of the PIN, AUX/LAX, and ABCB gene families in Populus, which contain 16, 8, and 20 members respectively. We investigate the history of gene family members relative to each other within Populus and relative to proposed orthologs in Arabidopsis. Through phylogenetic analysis we describe the timing of the diversification of the PIN, AUX/LAX, and ABCB gene families relative to when plants colonized land. Because the transport function of the ABCB proteins is less understood and their specificity for auxin has not been completely elucidated, we model the protein structures for Populus ABCBs and compare these to known Arabidopsis ABCB transporters. We then provide expression data for all putative auxin transporters in Populus, including presence or absence data for each gene in the cortex, phloem, cambial zone, and xylem of mature stems. We present quantitative RT-PCR expression levels for whole plantlets, internodes just beginning to form secondary vascular tissue, roots and developing xylem from mature stems. Lastly, in order to determine the most likely contributors to the positive feedback mechanism driving “canalization” of auxin flow during vascular development, we test the response of PIN, ABCB, and AUX/LAX genes to exogenous IAA application. These findings should lay the foundation for the functional characterization of members of each family and suggest which proteins are likely to be important regulators of secondary growth.

Materials and Methods

Plant material

Populus tremula × alba hybrid clone INRA 717-1B4 was chosen for all experimental procedures. In vitro plants were grown on half-strength Murashige and Skoog (MS) supplemented with 2% sucrose, 0.25 mg ml−1MES, 0.04 mg ml−1 glycine, and 0.2 mg ml−1 myo-inositol at 25 ± 2°C under 16 h day length conditions using GE 20W F20T12 growth lamps. Greenhouse plants were grown in 2:1:1 promix HP: perlite:vermiculite supplemented with 19–6–12 N–P–K slow release fertilizer. Greenhouse temperatures were maintained around 22 ± 5°C and day light supplemented to achieve a 16 h day length using metal halide lamps.

Identification of PIN, AUX/LAX, and ABCB gene and protein families

Populus trichocarpa gene and protein sequences were retrieved from the Joint Genome Institute’s (JGI) P. trichocarpa v.1.1 database1. Henceforth we refer to these genes and gene families as PtrPIN, PtrAUX, and PtrABCB. When reporting expression data, we will refer to the same genes from P. tremula × alba (abbreviated as Pta, i.e., PtaPIN1). The PIN and AUX/LAX sequences had been previously annotated and we maintained the original nomenclature including the AUX and LAX names for every member of the AUX/LAX family from P. trichocarpa (i.e., PtrAUX1–LAX5). Every sequence was used as query with the BLASTn algorithm to search the National Centre for Biotechnology Information (NCBI) nucleotide collection database to confirm sequence identity. Putative ABCB genes in the P. trichocarpa genome were identified in the same database using 22 Arabidopsis ABCB gene sequences retrieved from the Arabidopsis Genome Initiative Research database (TAIR)2. The JGI P. trichocarpa v.1.1 database was also searched using the terms “MDR” and “ATP” as queries. A third search was conducted using the retrieved sequences to interrogate the Populus DataBase (PopulusDB)3. Finally all retrieved sequences were confirmed as encoding putative auxin transporters by searching the phytozome v.7.0 database4. All the remaining PIN, AUX/LAX and ABCB sequences from other species were retrieved from phytozome v.7.0, TAIR10, The Rice Genome Annotation Project5, and MaizeGDB6. The complete list of retrieved genes is provided in Table A4 in Appendix. All sequences were inspected for redundancy and presence of pseudogenes and invalid gene models were discarded. ABCB protein sequences were used as queries to search the PROSITE database7 to confirm the presence of the TMD–NBD–TMD–NBD (transmembrane domain, nucleotide-binding domain) structure and the ABC C-motif. This allowed to rule out the presence of ABC half transporters and other ABC proteins not belonging to class B (Sanchez-Fernandez et al., 2001) and to classify the genes according to their full length structure, conserved motifs, sequence similarity, and EST support. Intron–exon structures of P. trichocarpa PIN, AUX/LAX, and ABCB genes were produced using the online tool GSDS, Gene Structure Display Server (Guo et al., 2007)8. The genome representation for Populus was created using the online tool SyMAP v.3.59

PtrABCB, PIN, and AUX/LAX structure analysis and PtrABCB modeling

Transmembrane domains were predicted using the online tools TMHMM Server v.2.010 and Aramemnon11. The protein structure of Sav1866 and MDR1 were obtained from the PDB (Protein Data Bank) database12. The predicted protein structures of AtABCB1 and 4 have been previously generated by Yang and Murphy (2009). Arabidopsis templates (ABCB1 or 4) were chosen based on closest sequence identity. To generate the alignment files of Populus ABCB protein sequences and Arabidopsis ABCB sequences, Multialin13 was used with default settings. The output file was manually edited to meet Modeller 9v5 requirements14. The predicted 3D protein structure was generated using the python script Modeller 9v5. Three structures were generated and the quality was determined according to the manual (Wiederstein and Sippl, 2007). The best model was used for substrate docking. Furthermore, the quality of the protein model was tested using the program ProSA15. Substrate docking was performed using MEDOCK16. PDB files of all proteins were translated into pdbq files using the PDB2PQR server17. For substrate docking prediction, the nucleotide-binding folds (NBFs) were removed. All loops connecting the TMDs were removed to reduce the size of the file. Finally, the pdbq file of IAA was produced with the Dundee PRODRG2 Server (Dolinsky et al., 2004, 2007)18. Each run had a docking repeat of five times and four runs were performed, resulting in a total of 20 molecules docked to the protein structure. Protein models were displayed using PyMol19.

Phylogenetic analysis

Phylogenic reconstruction was conducted using the coding sequences of 18 species, including 3 monocotyledonous and 10 dicotyledonous plants. Sequences from the green algae Chlamydomonas reinhardtii (Merchant et al., 2007) and Volvox carteri (Prochnik et al., 2010), the moss Physcomitrella patens (Rensing et al., 2008) and the lycopod Selaginella moellendorffii (Banks et al., 2011) were also included. For each coding sequence, three types of trees were retrieved from two different alignments. The first alignment was generated in concert with the tree search, a method called “dynamic homology” (Wheeler, 1996). 149, 68, and 245 unaligned coding sequences from the PIN, AUX/LAX, and ABCB families (Table A4 in Appendix) were read into the phylogenetic program POY v.4.1.2 (Varón et al., 2009) and trees and alignments were searched simultaneously for the least costly sequence alignment and tree topology combination under the parsimony criterion. A second alignment was generated in the program MAFFT (Katoh et al., 2009), where the same sequences were aligned under a gap opening cost of 4 and a gap extension cost of 0.05. This alignment was then input to the program Gblocks v.0.91b (Castresana, 2000; Talavera and Castresana, 2007), which removes regions with multiple gaps and of dubious homology. Gblocks was run with default settings, except that gaps were allowed in all parts of the resulting alignment (such as in cases where one or a few sequences have a clear insertion or deletion). The alignment output by Gblocks was then used for tree searching in POY, where it was read as pre-aligned. Both unaligned and aligned POY tree searches were immediately followed by bootstrap searches, where 100 pseudoreplicates were searched starting with one Wagner tree each. Tree searches were conducted on a parallel computing cluster, using 24 processors searching for a maximum of 6 h of automated searching (in which POY decides on the best combination of builds, swapping, ratchet, and fusing) with dynamic homology and 16 processors for the pre-aligned data. For dynamic homology, in both the tree searches and the bootstrap calculations, the data were divided by the program into seemingly homologous blocks before searching using the command “auto_sequence_partition,” which greatly increases search speed. For all POY searches, the costs of transitions, transversions, and insertion/deletion events were the same.

The alignment from Gblocks was also used for a maximum likelihood search in RaxML (Stamatakis et al., 2008) on the CIPRES Science Gateway (Miller et al., 2010)20. The alignment was first uploaded and converted to relaxed Phylip format and then tree searches were performed with likelihood bootstrap in which the best tree is reported along with the results of a 100-pseudoreplicate bootstrap calculation. The program was allowed to determine the best model (the GAMMA Model was chosen) and other parameters automatically before tree searching. All trees were visualized and edited using FigTree v.1.3.121

DNA and RNA isolation and cDNA synthesis

Total RNA from whole in vitro-grown plantlets, internodes, roots, and developing xylem was extracted using the Spectrum Plant Total RNA Kit (Sigma-Aldrich, St. Louis, MO, USA) according to manufacturer’s instructions. Aliquots of approximately 100 mg developing xylem tissue were homogenized with a Mini Bead Beater (BioSpec Products Inc., Bartlesville, OK, USA) and stainless steel beads. mRNA from 20 μm-thick frozen sections from the cortex, secondary phloem, cambium, and secondary xylem was extracted using the DynaBeads mRNA Direct Kit (Invitrogen, Carlsbad, CA, USA) according to manufacturer’s instructions. DNA was extracted using the DNeasy Plant Mini Kit (Qiagen, Valencia, CA, USA) according to manufacturer’s instructions using approximately 100 mg fresh leaf tissue. DNA and RNA concentrations were measured with a NanoDrop 2000™ (Thermo Scientific, Waltham, MA, USA). Total RNA was treated with TURBO DNA-free™ (Ambion, Austin, TX, USA) according to manufacturer’s instructions. cDNA was synthesized from 1.5 μg of total RNA using SuperscriptII reverse transcriptase (Invitrogen, Carlsbad, CA, USA) with the oligodt20 primer. RT-PCR reaction cycles were carried out according to manufacturer’s instructions including a final 20 min incubation step with RNAseH (Invitrogen, Carlsbad, CA, USA). cDNA concentration was measured with a Nanodrop 2000™ and the cDNA was diluted to 170 ng μl−1.

Amplification, cloning and sequencing of 3′ end PCR products

In order to amplify the 3′ end untranslated region (UTR) of transcripts that could not be detected in quantitative real time PCR (qRT-PCR) reactions with at least three different primer pairs, reverse transcription reactions were carried out using the Adp1-dt17 primer (Kramer et al., 1998) and SuperscriptII reverse transcriptase according to manufacturer’s instructions. cDNA was amplified using the Adp1 primer coupled to the corresponding forward primer specifically designed to amplify the 3′ end of the transcript (the complete list of primers is provided in Table A5 in Appendix). The PCR amplifications were carried out with Taq DNA polymerase (SIGMA, St. Louis, MO, USA) or Amplitaq® Gold DNA polymerase (Applied Biosystems™, Foster City, CA, USA) according to manufacturer’s instructions. PCR products were run on 1% agarose gels, gel purified using the Zymoclean™ Gel DNA Recovery Kit (Zymo Research, Irvine, CA, USA) and cloned into the pGEM®-T Easy Vector Systems (Promega, Madison, WI, USA). Colonies were grown on LB plates containing 100 mg/ml ampicillin. Following PCR amplification, positive colonies were grown in 4 ml of LB medium containing 100 mg/ml ampicillin, at 37°C, over night. Plasmid DNA was extracted using the Qiagen Plasmid Mini Kit (Qiagen, Valencia, CA, USA) according to manufacturer’s instructions. Plasmids were sequenced by Eurofins MWG Operon (Huntsville, AL, USA). Sequences were aligned using the Vector NTI Advance™ 10.3.0 AlignX module (Invitrogen, Carlsbad, CA, USA).

Quantitative RT-PCR

Quantitative real time PCR was carried out on the MX3000P and MX3005P systems (Stratagene, La Jolla, CA, USA) using Brilliant™ SYBR® Green QPCR Master Mix (Stratagene, La Jolla, CA, USA) according to manufacturer’s instructions. The SYBR® Green (with dissociation curve) experimental setup was used. Plates were manually loaded and reactions were carried out in a total volume of 20 μl, using 75 ng of cDNA per reaction. Reactions were run in triplicate. Primer pairs were designed using Primer3 software22, analyzed with OlygoAnalyzer 3.1 software23 for melting temperature, oligo-, hetero-dimer, and hairpin structure formation, synthesized by Integrated DNA Technologies (IDT, IA) and tested with conventional PCR to verify amplification of a single product. Following primer titration, a final concentration of 250 nM for each primer was chosen. In qRT-PCR experiments the following thermal cycling conditions were used: activation step of 10 min at 95°C; 40 cycles of 30 s at 95°C, 25 s at 57°C, 25 s at 72°C; fluorescence was collected at the end of each extension step. A melting curve analysis was performed.

Efficiency-corrected expression values were calculated based on standard curves for all genes (Livak and Schmittgen, 2001; Pfaffl, 2001). Standard curves were run in triplicate for every gene in every cDNA batch and amplification efficiencies were calculated from the standard curve slopes. Baseline-subtracted and ROX-normalized fluorescence readings were collected with the MX3005P software v.4.01. Expression values were normalized to the geometric mean of four housekeeping genes (PtaPD-E1, PtaUBQ1, PtaTUA2, PtaACT2) that were found, in our hands, to have the highest amplification efficiency and most stable expression across different tissues (Vandesompele et al., 2002; Brunner et al., 2004; Gutierrez et al., 2008). For expression following exogenous IAA application, the same set of normalizers was used in a comparative quantitation experiment comparing treated and untreated control tissues.

IAA treatments

Two-month-old P. tremula × alba was grown in the greenhouse. Approximately 1-cm-long segments of internodes between four and eight nodes beneath the shoot apex and actively growing root tips were collected and incubated at room temperature in 30 μM IAA in liquid growth media (half-strength MS salts, 2% sucrose, 0.25 mg ml−1 MES, 0.04 mg/ml glycine, and 0.2 mg ml−1 myo-inositol) for 6 h in the dark following a 15 min vacuum infiltration. The same conditions were used for negative controls (no IAA). Tissues were frozen in liquid N2 and ground for RNA extraction.

Results

Chromosomal distribution and gene duplication in the PIN, AUX/LAX, and ABCB families of Populus

Nearly every locus coding for a PIN, AUX/LAX, or ABCB protein has a corresponding paralogous locus in another chromosomal block (Figure 1). Populus has exactly twice the number of PIN (16) and AUX/LAX (8) genes as Arabidopsis (eight and four, respectively) and these genes form pairs with highly similar coding sequences, which may be the consequence of the relatively recent genome duplication (Figures 1, 2, and 3). Neither the PIN loci nor the AUX/LAX loci appear to be derived from tandem duplications. In contrast, three tandem duplicated ABCB loci pairs (PtrABCB2–PtrABCB8, PtrABCB10–PtrABCB11, and PtrABCB13–PtrABCB14) are present in the Populus genome. Unlike the PIN and AUX/LAX families, the ABCB genes are more randomly distributed between corresponding and non-corresponding duplicated regions, with nine members that do not present any paired gene on another chromosome (Figure 1).

Figure 1.

Figure 1

Chromosome distribution of PtrPIN, PtrAUX/LAX, and PtrABCB genes. The online tool symap v.3.5 was used to blast the Populus trichocarpa genome against itself and find duplicated regions. Populus has 19 chromosomes in the haploid state, shown here mapped onto a circle with homologous pairs along the upper and lower semi-circumferences. The color coded ribbons link one region with the correspondent homologous chromosomal segments. All PIN, AUX/LAX, and ABCB genes are assigned to a chromosome based on their map position. Red coded genes do not have any unique match on another locus in the genome. For a detailed list of these genes, see Table A2 in Appendix.

Figure 2.

Figure 2

Phylogeny of the PIN genes. Maximum likelihood phylogeny of PIN genes from land plants, based upon coding sequences from the loci listed in Table A4 in Appendix. Gray branches indicate nodes with bootstrap support lower than 50%. Basal land plant PINs are colored blue, Populus green, Arabidopsis red, and monocots yellow. Abbreviated names of each species are listed in Table A1 in Appendix.

Figure 3.

Figure 3

Phylogeny of the AUX/LAX genes. Maximum likelihood phylogeny of AUX/LAX genes from land plants, based upon coding sequences from the loci listed in Table A4 in Appendix. Gray branches indicate nodes with bootstrap support lower than 50%. Basal land plant AUX/LAX genes are colored blue, Populus green, Arabidopsis red, and monocots yellow. Abbreviated names of each species are listed in Table A1 in Appendix.

Gene and protein structure of the PIN, AUX/LAX, and ABCB families of Populus

We identified a total of 44 Populus genes encoding putative auxin transport proteins, including 16 PIN, 8 AUX/LAX, and 20 PtrABCB loci. The complete list of P. trichocarpa PIN, AUX/LAX, and ABCB gene names, gene models, and loci can be found in Table A2 in Appendix. The PIN genes of Populus present a conserved intron–exon organization which is illustrated in Figure A1 in Appendix. The same structural characteristics are present across PINs from different plant species including Arabidopsis (Mravec et al., 2009; Wang et al., 2009; Shen et al., 2010). The proteins belonging to the PtrPIN family range from 347 to 650 amino acids in length. In Populus, seven, three, and six PIN proteins present long, reduced and short central hydrophilic domains respectively. In general, there is no strict correlation between the length of the genomic sequence of loci coding for auxin transporters and their protein product length (Figure A1 and Table A3 in Appendix). One locus (PtrPIN14) is classified as encoding a pseudogene. The proteins for the PtrAUX/LAX family range from 465 to 492 amino acids and present the most conserved sequence among the three families of putative auxin transporters. Their primary sequence is generally conserved across the plant kingdom and Populus has twice the number of AUX/LAX coding loci compared to Arabidopsis. All of the PtrAUX/LAX proteins have 11 predicted transmembrane domains. All the ABCB loci from P. trichocarpa encode proteins with a repeated TMD–NBD structure and carry a predicted nucleotide-binding domain signature ([AG]- × (4)-G-K-[ST]; Rea, 2007; Verrier et al., 2008). Their length varies between 1141 and 1578 amino acids and the two regions integral to the plasma membrane are highly hydrophobic and comprise 7–12 transmembrane helices. In addition to these two conserved modules, a more variable and less hydrophobic linker region connects the first NBD to the second TMD in all PtrABCB proteins.

Identification of predicted IAA membrane transporters from the ABCB family of Populus

After analysis of the primary structure of the PtrABCB proteins, models of tertiary structure were produced using all 20 ABCB amino acid sequences. Structural models were displayed using PyMol (Figure A2 in Appendix) in order to determine which PtrABCBs are the most likely candidates for IAA transport. Although pairwise comparison of amino acid sequences can provide a first estimate of which proteins are the true orthologs of confirmed Arabidopsis auxin transporters (AtABCB1, AtABCB19, and AtABCB4), this information should be supported with the identification of IAA docking sites and transmembrane barrel structure predictions (Yang and Murphy, 2009). Among all PtrABCBs, 10 are predicted to have one or more IAA binding sites (Figure A2 in Appendix). In Arabidopsis, IAA is primarily docked at two binding sites in the TMDs of ABCB19 while ABCB4 has a unique additional binding site (Yang and Murphy, 2009). In Populus, ABCB1.1/ABCB1.2 and ABCB19 have the most similar sequence to AtABCB1 and AtABCB19 and have two, five, and three predicted binding pockets respectively.

Reconstruction of the phylogenetic relationships in the PIN, AUX/LAX, and ABCB gene families of Populus

All three phylogenetic analyses (parsimony using unaligned and aligned sequences and maximum likelihood with aligned sequences) generally resulted in well resolved, reasonable, highly supported trees, indicating considerable phylogenetic signal in the sequence data, which was robust to different methods of analysis. Here we show the trees for all three gene families found under maximum likelihood and the tree found under dynamic homology and parsimony for the ABCB family (Figures 2, 3, and 4; Figure A3 in Appendix). The three different analyses showed the same general patterns in each gene family, although the PIN analysis was more sensitive to the difference between likelihood and parsimony, the latter producing long, pectinate clades containing a mixture of taxonomic groups.

Figure 4.

Figure 4

Phylogeny of the ABCB genes. Maximum likelihood phylogeny of ABCB genes from land plants, based upon coding sequences from the loci listed in Table A4 in Appendix. Gray branches indicate nodes with bootstrap support lower than 50%. Algal ABCBs are colored light blue–green, basal land plants blue, Populus green, Arabidopsis red, and monocots yellow. Abbreviated names of each species are listed in Table A1 in Appendix. An alternative phylogeny for the ABCBs based on dynamic homology and parsimony, generated with the program POY v.4.1.2, is shown in Figure A3 in Appendix.

The PIN genes of basal land plants (Physcomitrella and Selaginella in our analysis) cluster at the base of the tree, with the exception of PpPIN1D (Figure 2A). The placement of PpPIN1D may indicate an erroneous or highly derived sequence, as its placement was unstable and with low bootstrap support and it was recovered in the likelihood tree on an extremely long branch. The angiosperm PINs initially split into two large clades, with subsequent splits that show the monocot/dicot divergence four or five times, although support for several of these nodes is weak (Figure 2). There is also the frequent occurrence of clear sister pairs of PINs in Populus.

The AUX/LAX analysis similarly places the basal land plant AUX/LAX genes in a grade at the base of the tree followed by two large clades of angiosperms (albeit with weak support; Figure 3). The monocot AUX/LAX genes were recovered as two closely related clades under maximum likelihood (Figure 3B) but were recovered as a single clade when the aligned data were analyzed under parsimony (trees not shown). All Populus AUX/LAX genes were recovered as sister pairs or, in the case of PtrAUX1–LAX5 and PtrAUX2–LAX1, as closely related in a clade with the P. tomentosa and P. tremula × tremuloides AUX/LAXs.

In contrast to the PIN and AUX/LAX trees, clades, or paraphyletic grades of basal land plant ABCBs were recovered in several different locations throughout each tree, often as sister to angiosperm clades that subsequently showed the monocot/dicot split (Figure 4). We included coding sequences from the green algae in our ABCB analysis: two putative ABCB transporters from C. reinhardtii (Cre17_g725200 and Cre17_g725150) and one ABCB-like sequence from V. carteri (Vcprot1), the latter used to root each ABCB tree. The inclusion of the algal sequences and the use of Volvox as a root appear valid, as they are not recovered on especially long branches, and Physcomitrella and Selaginella are appropriately placed on the first branches of each tree. In the maximum likelihood tree, we recovered 10 separate clades of monocot ABCBs, as well as an apparent expansion of the ABCBs in several angiosperm species, including Medicago truncatula and Prunus persica (Figures 4A,B). Among the Populus ABCBs, only few were recovered in clear sister pairs. The tree found under dynamic homology for the ABCBs recovered almost identical groupings of basal land plant, monocot, and dicot ABCBs as those trees found using aligned sequences, but the relationships among these clades or groups differed. For example, a clade containing OsABCB12 and Mes026648 (top of Figure 4B) was recovered as a paraphyletic grade immediately after the algal sequences in the dynamic homology tree (Figure A3A in Appendix).

Tissue-specific and IAA-induced expression of PtaPINs, PtaAUX/LAXs, and PtaABCBs

Expression of all PIN, AUX/LAX, and ABCB gene family members in P. tremula × alba was characterized for whole plantlets, roots, and stem tissues from several developmental stages through qRT-PCR (Figures 6–8). Whole in vitro-grown plantlets that were old enough to have initiated secondary growth were used as an initial screen and showed that over half of the PtaPINs and PtaAUX/LAX genes were expressed at above-trace levels, while only four or five PtaABCBs showed above-trace expression. Internodes that spanned the region of secondary growth initiation in greenhouse-grown plants should reflect combined expression in several distinct tissues, including cortex, vascular cambium, developing secondary vasculature, and primary xylem parenchyma. Here PtaPIN1, 6, and PtaABCB1.1 show high expression levels, with lower levels of PtaPIN7, 11, 15, 16, and PtaABCB7 (Figures 6 and 8). Developing secondary xylem removed from beneath the bark in 6-month-old greenhouse-grown trees showed high expression of PtaPIN1 and PtaABCB1.1, with lower levels of PtaABCB7. Roots showed low expression levels of most genes, which may simply reflect the fact that the roots collected were relatively mature and composed largely of parenchyma, rather than a concentration of actively growing root tips. PtaAUX/LAX genes were expressed at relatively uniform levels across all tissues and developmental stages (Figure 7), although expression levels were highest for developing xylem, where very high levels of PtaAUX2 were detected.

Figure 6.

Figure 6

Quantification of PIN transcripts expression by qRT-PCR. PIN genes show tissue-specific expression profiles that may reflect a role in directional auxin transport in developing vasculature, with PtaPIN1 highly expressed across all tissues. PtaPIN6, 7, 15, and 16 were expressed in internodes and have not been described before. Total RNA was extracted from four biological replicates and qRT-PCR standard curves and assays were run in triplicate. Expression values were calculated via the 2−ΔΔCt method (Livak and Schmittgen, 2001; Pfaffl, 2001) and baseline-corrected fluorescence values were normalized against the geometric mean of PtaPD-E1, PtaTUA2, PtaUBQ, PtaACT2. These reference genes were stably expressed across all tissues with the exception of developing xylem; this means that it is permissible to compare expression levels within any single tissue as well as across whole plantlets, internodes, and roots. Error bars represent the SEM.

Figure 8.

Figure 8

Quantification of ABCB transcripts expression by qRT-PCR. Most notable among the ABCB family is PtaABCB1.1, which was highly expressed in internodes and developing xylem and whose ortholog in Arabidopsis (AtABCB1) has been demonstrated to transport auxin. Expression patterns of all PtaABCB genes are previously undescribed. Error bars represent the SEM.

Figure 7.

Figure 7

Quantification of AUX/LAX transcripts expression by qRT-PCR. Most AUX/LAX transcripts showed broad expression across plant tissues, including the previously undescribed PtaAUX4–8. PtaAUX2 and PtaAUX8 were highly expressed in internodes and developing xylem. Error bars represent the SEM.

In order to perform an expression screen (RT-PCR) with higher spatial resolution in developing woody stems, basal internodes approximately 100 nodes and 2.5 m down from the stem apex of 6-month-old Populus were freeze-sectioned and tissue collected from the cortex, secondary phloem, cambial zone (restricted to cambial initials and mother/daughter cells), and secondary xylem. Developing secondary xylem and phloem were discarded in order to obtain the most pure collections of tissues possible. Given that, the number of members of all families that are expressed in each tissue is striking (Figures 5–8). Only PtaPIN9, 10, and 12 and PtaABCB5 and 10 were not expressed in any tissue (Figures 6 and 8), and although some of the transcripts detected through RT-PCR are likely expressed at very low levels, it is clear that expression of many previously undescribed members (e.g., PtaPIN6, 7, 15, and 16 and PtaABCB1.1 and 7) is widespread in Populus stems. Also striking is the fact that several members of all three transport families are expressed in mature secondary xylem, from which all mRNA is derived from living ray parenchyma cells.

Figure 5.

Figure 5

Analysis of tissue-specific expression of PIN, AUX/LAX, and ABCB transcripts. Presence or absence of transcripts of genes coding for putative auxin transport proteins in the cortex, secondary phloem, cambial zone (i.e., initials and mother/daughter cells), and mature secondary xylem of Populus tremula × alba as determined by RT-PCR. Consensus of four biological replicates is shown, where GRAY = PRESENT, WHITE = ABSENT, and CROSS-HATCHED = VARIABLE among biological replicates. Samples were taken from the base of 6-month-old trees during active growth, approximately 100 internodes down from the top of the tree at a diameter of about 2 cm.

Because a positive feedback mechanism is fundamental to the canalization of auxin flow during vascular development, we also tested the auxin response of members of the PtaPIN, PtaAUX/LAX, and PtaABCB gene families in roots and internodes from 2-month-old plants, following exogenous IAA application, via qRT–PCR. PtaPIN1, 2, and 7 and PtaAUX5 and 6 were strongly upregulated in developing internodes, with PtaPIN15 and 16 showing a more moderate increase (Figure 9). In contrast, PtaPIN3 and 8 were strongly upregulated in roots, with PtaAUX6 and PtaABCB7 showing a lower expression level.

Figure 9.

Figure 9

Upregulation of putative auxin transporters expression following IAA treatment. Several PtaPIN, PtaAUX/LAX, and PtaABCB genes showed increased transcript levels in response to exogenous IAA in both roots and internodes. Two-month-old Populus tremula × alba were grown in the greenhouse and root tips and internodes were collected and incubated at room temperature in liquid growth media with or without 30 μM IAA for 6 h in the dark. Assays were run in triplicates. Bars represent SEM. Gene expression in the IAA treated tissue is reported relative to the untreated tissue according to the comparative quantitation methodology.

Discussion

The array of putative auxin transporters in Populus reflects both pre-existing diversity and expansion due to genomic and segmental duplications

There are twice as many members of the PIN and AUX/LAX gene families in Populus as there are in Arabidopsis and both families show a number of clear pairs based on coding sequence (e.g., PtrPIN4/5, PtrAUX3/4; Figures 2 and 3). With no clear evidence for any tandem duplication in the PIN and AUX/LAX gene families, it is possible that all gene copies were retained following the “salicoid” genome duplication (Tuskan et al., 2006). Although the functional role of these proteins has not been demonstrated in Populus, given the conserved protein structure and known specificity for IAA for most PINs in Arabidopsis (and to a lesser extent, AUX/LAX proteins), it seems likely that they have retained a function in auxin transport. To what extent new PINs have developed specialized roles in PAT in Populus is not known and the added redundancy for such an important developmental mechanism may be beneficial enough to warrant retention. Indeed, redundancy in Arabidopsis allows single PIN mutants to complete embryogenesis, whereas quadruple mutants are required before severe defects are observed (Benková et al., 2003; Friml et al., 2003). At the same time it is interesting to note that there are clear differences in expression among presumed paralogs. For instance, PtaPIN1 is expressed at much higher levels than PtaPIN7 in internodes and developing xylem. Predictions about PIN function in Populus may also be informed by structural comparisons with Arabidopsis. The “long” PINs in Arabidopsis are localized to the plasma membrane and function in PAT, whereas those with shorter structure are found in the ER (Mravec et al., 2009; Friml and Jones, 2010). PtrPIN1–3 and PtrPIN6–9 are all classified as “long” PINs (Table A3 in Appendix), but it is not known whether similar localization patterns exist in Populus.

In contrast to the PIN and AUX/LAX gene families, the number of ABCBs in Populus is not expanded relative to Arabidopsis (both species include about 20 members; Table A2 in Appendix) and only a few appear as closely related gene pairs. This is perhaps not surprising given that this gene family has a much deeper history and that ABCB proteins transport a number of substrates in addition to IAA. There also appears to be expansion in a number of angiosperms included in our phylogeny, such as Z. mays, M. truncatula, P. persica, and Arabidopsis (Figure 4). Although there has been retention of ABCB copies from both tandem duplication and whole genome duplication events in Populus, there also appears to have been loss. Much functional work is needed on Populus ABCB genes and proteins before any role in PAT can be ascribed.

Candidate ABCBs for IAA transport function in Populus are suggested by phylogenetic placement and protein structure prediction

ATP-binding cassette proteins constitute a very large superfamily that has representatives across the bacteria, plant, and animal kingdoms (Jasinski et al., 2003; Verrier et al., 2008) and, as a group, are able to transport a wide array of different molecules (Geisler et al., 2005; Bandyopadhyay et al., 2007). Among the ABCs, the subclass B includes proteins that are able to bind and transport auxin across the plasma membrane in Arabidopsis, whereas other members transport other substrates in addition to IAA (e.g., AtABCB14 functions primarily as a malate transporter (Lee et al., 2008)). There has been no functional characterization of the ABCBs in Populus to date and given the large size of the family and the likely role of one or more members in IAA transport, we sought to identify candidate PtrABCBs with this function. Our phylogenetic analysis shows that the coding sequences of PtrABCB1.1, PtrABCB1.2, and PtrABCB19 cluster together with AtABCB1 and AtABCB19 respectively, both of which are known IAA transporters with high specificity for IAA (Zazímalová et al., 2010). Interestingly, although 10 of the 20 PtaABCBs are predicted to have one or more IAA binding sites based on tertiary structure, both PtrABCB1 and PtrABCB19 have only one clearly defined binding pocket for IAA. All but one of the remaining ABCBs with putative IAA binding sites (PtrABCB2, PtrABCB5, PtrABCB6, PtrABCB8, PtrABCB11, PtrABCB14) cluster together in the same clade, which includes AtABCB4, a gene coding codes for another membrane protein capable of IAA transport (Terasaka et al., 2005; Kubeš et al., 2011). Similarly, PtrABCB16 occurs in the same clade as AtABCB13 and AtABCB14, where AtABCB14 has been recently determined as responsible for auxin transport in the inflorescence stem of Arabidopsis (Kaneda et al., 2011).

We found PtrABCB1.1 to be highly expressed in most Populus tissues, particularly in internodes and developing xylem. PtrABCB7 was also expressed in these same tissues and was strongly upregulated in response to IAA, although most notably in roots. However, although coding sequence similarity places PtrABCB7 as a close relative of a presumed IAA transporter in Arabidopsis (AtABCB15; Kaneda et al., 2011), the protein was not predicted to contain an IAA binding site. We suggest therefore that PtrABCB1.1 and its nearly identical paralog PtrABCB1.2 are the most logical candidates for initial functional characterization, both in heterologous expression systems (e.g., Schizosaccharomyces pombe) and in planta, given their phylogenetic placement relative to AtABCB1 and predicted IAA binding sites. It is interesting to note that in contrast to AtABCB1 (Geisler et al., 2005), we did not find PtaABCB1.1 to be upregulated by exogenous IAA treatment. Lastly, we did not observe strong expression of PtaABCB19 in any Populus tissues nor was it upregulated by IAA. The expression of its presumed ortholog in Arabidopsis, AtABCB19, is induced by IAA treatments (Noh et al., 2001) and the protein often co-localizes with AtPIN1 (Bandyopadhyay et al., 2007), suggesting that the relationship of these two proteins may have changed. Clearly there is much to be learned about the role of these ABCBs in IAA transport in Populus.

Auxin transporters in Populus stem development

That auxin regulates vascular development in woody plants is clear, but our understanding of the genetic mechanisms and the role of specific proteins in basipetal transport is limited. The expression of PttPIN1–3 and PttLAX1–3 has already been characterized in detail across the developing stem tissues of P. tremula × tremuloides (Schrader et al., 2003), but our results suggest that a far greater number of putative transporters are expressed in young internodes where cambial growth is being initiated. In particular, PtaPIN1, PtaPIN6, and PtaABCB1.1 are highly expressed in internodes, a complex tissue that includes primary xylem parenchyma, primary phloem, cortex, and a nascent vascular cambium. In developing xylem, PtaPIN1, PtaAUX2, and PtaABCB1.1 are highly expressed, with the latter likely to function in auxin transport given its protein sequence similarity to AtABCB1. Similarly, several previously uncharacterized transporters are strongly upregulated by auxin, including PtaPIN8, PtaAUX6, and PtaABCB7 in roots and PtaPIN7, PtaPIN15, PtaPIN16, PtaAUX5, and PtaAUX6 in internodes. Given the retention of copies of auxin transporters following duplication events, there is likely to be both redundancy and neo-functionalization for PAT proteins in Populus.

The vascular cambium and the secondary xylem and phloem that it produces are often viewed as distinct from primary growth, but it is important to remember that vascular development forms a continuum between stem and leaf (Spicer and Groover, 2010). We know a great deal about the role of PAT in venation patterning in leaves of Arabidopsis (Scarpella et al., 2006). Here, AtPIN1 directs auxin flow up through the epidermis toward a convergence point, from where it is channeled down through the center of a developing leaf primordium, establishing the location of the first central vascular bundle. This vascular bundle differentiates from a strand of procambium that is continuous with the vascular cambium below, such that the basipetal transport of auxin out of developing primordia is likely continuous with the basipetal stream moving down through the cambium (Lachaud and Bonnemain, 1984; Uggla et al., 1998; Kramer et al., 2008). Based on a combination of our results and published work in both Arabidopsis and Populus, we suggest that PtaPIN1, PtaAUX2, and PtaABCB1.1 are the best initial candidates for the maintenance of PAT in the cambial zone, although additional transporters are very likely involved. Given the slow time course and laborious nature of transformation in woody plants, our hope is that this work will provide a starting point for work in planta by identifying candidate IAA transporters involved in woody stem development. Functional studies, transport assays and protein localization are all needed to resolve the action of specific transporters in shaping the distribution of auxin across the cambial zone.

Finally, it is interesting to note that several members of the PIN, AUX/LAX, and ABCB gene families are expressed in the mature xylem. Although the bulk of this tissue is dead (e.g., vessels and fibers), ray parenchyma cells remain alive for many years (Spicer and Holbrook, 2007) and serve as a route of transport between xylem and phloem (Van Bel, 1990). In particular, PtaPIN1, PtaAUX2, PtaAUX3, PtaAUX4 and PtaABCB1, PtaABCB7, PtaABCB20 were found to be expressed in these cells. In addition to their role in carbohydrate transport and storage, xylem parenchyma cells are able to exchange solutes with the transpiration stream and function in wound response. What is puzzling however is that these cells are symplasmically connected, at least in the radial direction, whereas PAT requires transport across a membrane. Furthermore, there is no evidence for free IAA in mature xylem (Uggla et al., 1996; Tuominen et al., 1997). Although conjugated forms of IAA are transported in the phloem (Baker, 2000) no studies to date have looked for conjugated IAA in ray or axial parenchyma in secondary xylem. Given their role in wound response, some capacity for IAA transport (or even IAA synthesis) would not be surprising, but transport assays and protein localization are needed to clarify any potential role these cells might play in IAA transport.

The ABCB gene family diversified prior to the PIN and AUX/LAX families and prior to the diversification of land plants

It is clear from our phylogenetic analysis that the ABCB gene family existed before the diversification of land plants, whereas the PIN and AUX/LAX families arose within the land plant clade. This is supported by the fact that ABCB genes from a moss (P. patens) and a lycopod (S. moellendorffii) consistently occur nested within multiple, well-supported clades that also include higher plants (Figure 4; Figure A3 in Appendix). It also confirms previous work reconstructing the evolutionary history of this family (Bandyopadhyay et al., 2007; Krecek et al., 2009). In contrast, diversification of the PIN and AUX/LAX gene families occurred after the origin of land plants, as suggested by the well-supported and exclusively basal position of both Physcomitrella and Selaginella PIN and AUX/LAX genes (Figures 2 and 3). There was already considerable diversity in the ABCB gene family at the time of the monocot/dicot divergence, dated at approximately 130–150 Myr ago (Wolfe et al., 1989; Chaw et al., 2004; Bell et al., 2010), as we recovered as many as 10 distinct ABCB gene clades that contain a clear monocot/dicot split with strong support. The picture is not as clear for the PIN and AUX/LAX genes due to weak support at some nodes, but there may have been five copies of the PIN and likely just two copies of the AUX/LAX genes at the time of the monocot/dicot divergence. It is not clear at this time whether all AUX/LAX genes in monocots descended from a single original copy, as suggested by the tree found using aligned sequences under parsimony, since monocot AUX/LAX genes were not recovered in a single clade in other trees (Figure 3).

In conclusion, we show that the deep history of the ABCB family of transporters coupled with the expansion of the PIN and AUX/LAX families following a genome duplication has led to a diverse array of over 40 putative auxin transport proteins in Populus. Given this large number and the inherent difficulties in working with a woody plant (e.g., long generation times, slow transformation process, difficult nucleic acid extraction), it is important to establish a comprehensive picture of gene expression profiles and predict their protein structures. By considering both evolutionary relationships and structural similarities to known auxin transporters, we can choose the most appropriate candidates for future study. One of the main goals in the short term should be to develop a set of tools for protein localization, including antibodies and protein fusions for stable plant transformation. Although technically difficult for trees, these findings should be coupled with functional studies with knockout mutants. Lastly, it will be important to determine the transport capacity and substrate specificity of target proteins of Populus by expressing them in heterologous systems such as S. pombe. We hope that this work provides a foundation on which to build an improved understanding of auxin transport in Populus, as knowing the role of specific transport proteins in secondary vascular development is likely key to enhanced utilization of woody plants.

Conflict of Interest Statement

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Acknowledgments

The authors would like to thank the laboratories of Noel M. Holbrook and Elena M. Kramer (Harvard University, OEB) for providing space and access to equipment, technical support, and for helpful discussion. The authors are also grateful to Angus S. Murphy and Wendy A. Peer (Purdue University) for helpful discussion of the manuscript; Serena Varotto and Cristian Forestan for sharing sequences and for helpful discussion. This work was supported by a Rowland Junior Fellowship awarded to Rachel Spicer from 2007 to 2010.

Appendix

Figure A1.

Figure A1

Intron–exon structure of PIN, AUX/LAX, and ABCB genes from Populus trichocarpa.

Figure A2.

Figure A2

Predicted model structures of putative auxin transport ABCBs from Populus trichocarpa. Tertiary protein structures have been generated using the python script Modeller 9v5. Predicted IAA docking sites are depicted in red.

Figure A3.

Figure A3

Phylogeny of ABCB genes from land plants, based upon coding sequences from the loci listed in Table A4, analyzed using dynamic homology under the parsimony criterion. Gray branches indicate nodes with bootstrap support lower than 50%. Algal ABCBs are colored light blue–green, basal land plants blue, Populus green, Arabidopsis red, and monocots yellow. Abbreviated names of each species are listed in Table A1.

Table A1.

List of all species with their abbreviated names used in the present work.

Species Abbreviation
Aquilegia caerulea Aco
Arabidopsis thaliana At
Chlamydomonas reinhardtii Cre
Eucalyptus grandis Egr
Manihot esculenta Mes
Medicago truncatula Mtr
Oryza sativa Os
Physcomitrella patens Pp
Populus tomentosa Pto
Populus tremula × tremuloides Ptt
Populus trichocarpa Ptr
Prunus persica Ppe
Ricinus communis Rc
Selaginella moellendorffii Sm
Sorghum bicolor Sb
Vitis vinifera Vv
Volvox carteri Vc
Zea mays Zm

Table A2.

List of putative auxin transport genes identified in the Populus trichocarpa genome.

Genes JGI v1.1 gene model JGI v1.1 locus
PtrPIN1 estExt_fgenesh4_pg.C_LG_XV0366 LG_XV:3955456–3958939
PtrPIN2 estExt_Genewise1_v1.C_LG_XVI1213 LG_XVI:2023747–2028247
PtrPIN3 gw1.X.6584.1 LG_X:11493441–11496545
PtrPIN4 estExt_fgenesh4_pm.C_LG_V0399 LG_V:12604974–12610191
PtrPIN5 fgenesh4_pm.C_LG_II000334 LG_II:4970467–4976705
PtrPIN6 fgenesh4_pm.C_LG_VIII000556 LG_VIII:8394273–8397294
PtrPIN7 estExt_Genewise1_v1.C_LG_XII1068 LG_XII:3820572–3824595
PtrPIN8 eugene3.00060333 LG_VI:2296469–2299715
PtrPIN9 fgenesh4_pm.C_LG_XVIII000434 LG_XVIII:12913539–12916356
PtrPIN10 fgenesh4_pm.C_LG_I000524 LG_I:12290101–12293363
PtrPIN11 estExt_fgenesh4_pg.C_870067 scaffold_87:1004073–1006598
PtrPIN12 fgenesh4_pg.C_LG_XIX000547 LG_XIX:6900262–6903432
PtrPIN13 fgenesh4_pg.C_LG_IV001142 LG_IV:12489496–12491318
PtrPIN14 gw1.XVII.929.1 LG_XVII:3836316–3838259
PtrPIN15 fgenesh4_pg.C_LG_XIV000875 LG_XIV:7307054–7309154
PtrPIN16 gw1.5147.2.1 scaffold_5147:1–1679
 
PtrAUX1/LAX5 grail3.0023028402 LG_VI:6769035–6772003
PtrAUX2/LAX1 eugene3.00161081 LG_XVI:10707443–10710997
PtrAUX3/LAX2 estExt_fgenesh4_pg.C_LG_X1704 LG_X:17003105–17007090
PtrAUX4/LAX6 estExt_Genewise1_v1.C_LG_VIII1679 LG_VIII:3795803–3800287
PtrAUX5/LAX7 estExt_fgenesh4_pg.C_LG_IV1437 LG_IV:15662320–15666183
PtrAUX6/LAX3 grail3.0001031001 LG_IX:2231536–2235747
PtrAUX7/LAX8 estExt_fgenesh4_pg.C_LG_V0933 LG_V:11098424–11101148
PtrAUX8/LAX4 grail3.0003074001 LG_II:6104679–6107343
 
PtrABCB1.1 gw1.28.733.1 scaffold_28:2297969–2304256
PtrABCB1.2 fgenesh4_pg.C_LG_XVI000833 LG_XVI:7805788–7812322
PtrABCB2 estExt_Genewise1_v1.C_LG_II3719 LG_II:16940658–16946357
PtrABCB3 eugene3.00130846 scaffold_1: 44776038–44781535
PtrABCB4 fgenesh4_pg.C_scaffold_204000026 scaffold_204:388201–394437
PtrABCB5 gw1.X.3657.1 LG_X:276730–282241
PtrABCB6 estExt_fgenesh4_pm.C_LG_X0835 LG_X:18271669–18278875
PtrABCB7 gw1.XVII.765.1 LG_XVII:3190614–3196509
PtrABCB8 estExt_fgenesh4_pm.C_LG_II0929 LG_II:16965413–16970969
PtrABCB9 fgenesh4_pg.C_LG_XVII000406 LG_XVII:4919010–4924173
PtrABCB10 eugene3.00140575 LG_XIV:4755266–4761017
PtrABCB11 eugene3.00140576 LG_XIV:4765985–4771483
PtrABCB12 gw1.XVIII.2596.1 LG_XVIII:8860516–8866795
PtrABCB13 eugene3.00140578 LG_XIV:4778008–4781195
PtrABCB14 estExt_fgenesh4_pm.C_LG_XIV0249 LG_XIV:4781910–4787506
PtrABCB15 fgenesh4_pm.C_LG_XV000001 LG_XV:12903–18128
PtrABCB16 fgenesh4_pm.C_LG_II000094 LG_II:1130589–1135712
PtrABCB17 eugene3.01580034 scaffold_158:318976–324742
PtrABCB18 fgenesh4_pg.C_LG_VIII000415 LG_VIII:2748354–2755879
PtrABCB19 estExt_fgenesh4_pg.C_LG_XVII0355 LG_XVII:4160851–4168120
PtrABCB20 fgenesh4_pm.C_LG_XI000351 scaffold_11:16,395,988.0.16,402,087
Genes Phytozome v.7.0 locus GenBank accesion number Chrom. Closest similar sequence
PtrPIN1 POPTR_0015s04570 XM_002322068 chr.15 PtrPIN7
PtrPIN2 POPTR_0016s03450 XM_002322578 chr.16 PtrPIN8
PtrPIN3 POPTR_0010s12320 XM_002314774 chr.10 PtrPIN6
PtrPIN4 POPTR_0005s20990 XM_002306642 chr.5 PtrPIN5
PtrPIN5 POPTR_0002s07310 XM_002302160 chr.2 PtrPIN4
PtrPIN6 POPTR_0008s12830 XM_002312400 chr.8 PtrPIN3
PtrPIN7 POPTR_0012s04470 XM_002317838 chr.12 PtrPIN1
PtrPIN8 POPTR_0006s03540 XM_002307930 chr.6 PtrPIN2
PtrPIN9 POPTR_0018s13610 XM_002324641 chr.18 No clear match
PtrPIN10 POPTR_0001s21230 XM_002298168 chr.1 No clear match
PtrPIN11 POPTR_0013s08510 XM_002328968 chr.13 PtrPIN12
PtrPIN12 POPTR_0019s07990 XM_002325430 chr.19 PtrPIN11
PtrPIN13 POPTR_0004s12310 XM_002305335 chr.4 PtrPIN14
PtrPIN14 POPTR_0017s11440 NC_008483 chr.17 PtrPIN13
PtrPIN15 POPTR_0014s14390a XM_002320399 chr.14 No clear match
PtrPIN16 POPTR_0014s14390a XM_002336619 chr.2 No clear match
PtrAUX1/LAX5 POPTR_0006s09940 XM_002309092 chr.6 PtrAUX2/LAX1
PtrAUX2/LAX1 POPTR_0016s12100 XM_002322933 chr.16 PtrAUX1/LAX5
PtrAUX3/LAX2 POPTR_0010s19840 XM_002316190 chr.10 PtrAUX4/LAX6
PtrAUX4/LAX6 POPTR_0008s06630 XM_002311172 chr.8 PtrAUX3/LAX2
PtrAUX5/LAX7 POPTR_0004s17860 XM_002306139 chr.4 PtrAUX6/LAX3
PtrAUX6/LAX3 POPTR_0009s13470 XM_002312937 chr.9 PtrAUX5/LAX7
PtrAUX7/LAX8 POPTR_0005s16020 XM_002306579 chr.5 PtrAUX8/LAX4
PtrAUX8/LAX4 POPTR_0002s08750 XM_002302217 chr.2 PtrAUX7/LAX8
PtrABCB1.1 POPTR_0006s12590 XM_002323449 chr.6 PtrABCB1.2
PtrABCB1.2 POPTR_0016s09680 XM_002519442 chr.16 PtrABCB1.1
PtrABCB2 POPTR_0002s18860 XM_002301511 chr.2 PtrABCB10
PtrABCB11
PtrABCB13
PtrABCB14
PtrABCB3 POPTR_0001s44320 XM_002319243 chr.1 PtrABCB20
PtrABCB4 POPTR_0001s34280 XM_002331841 chr.1 No clear match
PtrABCB5 POPTR_0010s00540 XM_002314297 chr.10 No clear match
PtrABCB6 POPTR_0010s21720 XM_002316273 chr.10 PtrABCB18
PtrABCB7 POPTR_0017s11030 XM_002323983 chr.17 No clear match
PtrABCB8 POPTR_0002s18850 XM_002301514 chr.2 PtrABCB10
PtrABCB11
PtrABCB9 POPTR_0017s12120 XM_002323830 chr.17 POPTR_0004s12180
PtrABCB10 POPTR_0014s10860 XM_002320902 chr.14 PtrABCB2, PtrABCB8
PtrABCB11 POPTR_0014s10870 XM_002320903 chr.14 PtrABCB2, PtrABCB8
PtrABCB12 POPTR_0018s09420 XM_002324987 chr.18 No clear match
PtrABCB13 POPTR_0014s10880.1 XM_002320905 chr.14 PtrABCB2, PtrABCB8
PtrABCB14 POPTR_0014s10880.2 XM_002320906 chr.14 PtrABCB2, PtrABCB8
PtrABCB15 POPTR_0015s00250 XM_002321303 chr.15 POPTR_0012s00290c
POPTR_0012s00360b
POPTR_0012s00370c
PtrABCB16 POPTR_0002s02110 XM_002301925 chr.2 No clear match
PtrABCB17 POPTR_0001s16560 XM_002331169 chr.1 No clear match
PtrABCB18 POPTR_0008s05020 XM_002311108 chr.8 PtrABCB6
PtrABCB19 POPTR_0017s11750 XM_002323811 chr.17 No clear match
PtrABCB20 POPTR_0011s13720 XM_002316941 chr.11 PtrABCB3

Gene models, accession numbers, chromosome position, and the closest most similar match for each gene are reported.

aThese genes are distinct in GenBank but they retrieve the same entry in the phytozome database (www.phytozome.org).

bVery short protein classified as ATP-binding transporter.

cUncharacterized conserved protein.

Table A3.

Summary of the protein characteristics of the PIN, AUX/LAX, and ABCB families of Populus trichocarpa, Populus tomentosa, Populus tremula × tremuloides, and Arabidopsis.

Gene length Length n Type
cds (bp) Protein (aa) TMHs
AtPIN1 1869 622 11 Long
AtPIN2 1944 647 10 Long
AtPIN3 1923 640 10 Long
AtPIN4 1851 616 10 Long
AtPIN5 1056 351 10 Short
AtPIN6 1713 570 10 Reduced
AtPIN7 1860 619 10 Long
AtPIN8 1104 367 10 Short
PtrPIN1 1845 614 10 Long
PtrPIN2 1767 588 11 Long
PtrPIN3 1905 634 10 Long
PtrPIN4 1338 446 9 Reduced
PtrPIN5 1110 369 8 Reduced
PtrPIN6 1950 650 10 Long
PtrPIN7 1830 610 10 Long
PtrPIN8 1764 588 10 Long
PtrPIN9 1902 634 10 Long
PtrPIN10 1644 548 10 Reduced
PtrPIN11 1041 347 9 Short
PtrPIN12 1041 347 10 Short
PtrPIN13 1068 356 8 Short
PtrPIN14 1071 357 8 Short
PtrPIN15 1113 371 8 Short
PtrPIN16 912 304 6 Short
PttPIN1 1845 614 10 Long
PttPIN2 1767 588 10 Long
PttPIN3 1923 640 10 Long
PtoPIN1 1860 619 9 Long
AtAUX1 1458 485 11
AtLAX1 1467 489 11
AtLAX2 1452 484 11
AtLAX3 1413 471 11
PtrAUX1/LAX5 1443 481 11
PtrAUX2/LAX1 1434 478 11
PtrAUX3/LAX2 1422 474 11
PtrAUX4/LAX6 1416 472 11
PtrAUX5/LAX7 1476 492 11
PtrAUX6/LAX3 1476 492 11
PtrAUX7/LAX8 1395 465 11
PtrAUX8/LAX4 1398 466 11
PttLAX1 1434 477 10
PttLAX2 1422 473 11
PttLAX3 1476 491 11
PtoAUX1 1434 477 10
AtABCB1 3861 1286 12
AtABCB2 3822 1273 12
AtABCB3 3690 1229 11
AtABCB4 3861 1286 9
AtABCB5 3693 1230 9
AtABCB6 4224 1407 13
AtABCB7 3747 1248 11
AtABCB8 3723 1241 12
AtABCB9 3711 1236 9
AtABCB10 3684 1227 10
AtABCB11 3837 1278 9
AtABCB12 3822 1273 9
AtABCB13 3738 1245 11
AtABCB14 3744 1247 11
AtABCB15 3723 1240 11
AtABCB16 3687 1228 7
AtABCB17 3723 1240 9
AtABCB18 3678 1225 9
AtABCB19 3759 1252 10
AtABCB20 4227 1408 13
AtABCB21 3891 1296 9
AtABCB22 3666 1221 7
PtrABCB1.1 4074 1357 12
PtrABCB1.2 3975 1324 12
PtrABCB2 3687 1228 10
PtrABCB3 3756 1251 9
PtrABCB4 3768 1255 10
PtrABCB5 3882 1294 9
PtrABCB6 4194 1398 12
PtrABCB7 3780 1260 11
PtrABCB8 3828 1276 11
PtrABCB9 3717 1239 9
PtrABCB10 3864 1287 9
PtrABCB11 3882 1294 9
PtrABCB12 3693 1230 8
PtrABCB13 3597 1199 7
PtrABCB14 3885 1294 9
PtrABCB15 3828 1276 10
PtrABCB16 3660 1220 11
PtrABCB17 4644 1548 12
PtrABCB18 4197 1399 12
PtrABCB19 3756 1252 10
PtrABCB20 3516 1171 10

All proteins are classified according to their sequence length, number of predicted transmembrane helices, and length of the central hydrophilic loop (short, reduced, long).

Table A4.

List of all the sequences used in the reconstruction of PIN, AUX/LAX, and ABCB families phylogenies.

Phytozome database locus or GenBank accession number Assigned name
ABCBs
ppa000359m.g Ppe000359
ppa000340m.g Ppe000340
ppa000269m.g Ppe000269
ppa000313m.g Ppe000313
ppa000316m.g Ppe000316
ppa023953m.g Ppe023953
ppa000315m.g Ppe000315
ppa015302m.g Ppe015302
ppa000363m.g Ppe000363
ppa015387m.g Ppe015387
ppa015389m.g Ppe015389
ppa017251m.g Ppe017251
ppa023915m.g Ppe023915
ppa018252m.g Ppe018252
ppa000312m.g Ppe000312
ppa026713m.g Ppe026713
ppa000338m.g Ppe000338
ppa0208157m.g Ppe020815
POPTR_0006s12590 PtrABCB11
POPTR_0016s09680 PtrABCB12
POPTR_0002s18860 PtrABCB2
POPTR_0001s44320 PtrABCB3
POPTR_0001s34280 PtrABCB4
POPTR_0010s00540 PtrABCB5
POPTR_0010s21720 PtrABCB6
POPTR_0017s11030 PtrABCB7
POPTR_0002s18850 PtrABCB8
POPTR_0017s12120 PtrABCB9
POPTR_0014s10860 PtrABCB10
POPTR_0014s10870 PtrABCB11
POPTR_0018s09420 PtrABCB12
POPTR_0014s10880.1 PtrABCB13
POPTR_0014s10880.2 PtrABCB14
POPTR_0015s00250 PtrABCB15
POPTR_0002s02110 PtrABCB16
POPTR_0001s16560 PtrABCB17
POPTR_0008s05020 PtrABCB18
POPTR_0017s11750 PtrABCB19
POPTR_0011s13720 PtrABCB20
GRMZM2G315375_T01 Zm2G315375-1
GRMZM2G085236_T01 Zm2G085236-1
GRMZM2G085236_T02 ZmG085236-2
GRMZM2G004748_T01 ZmG004748-1
GRMZM2G119894_T01 Zm2G119894-1
GRMZM2G119894_T03 Zm2G119894-3
GRMZM2G086730_T01 Zm2G086730
AC233882.1_FGT003 ZmAC233882-1_FG003
GRMZM2G025860_T01 Zm2G025860
GRMZM2G167658_T01 Zm2G167658
GRMZM2G111462_T01 Zm2G111462
GRMZM2G085111_T02 Zm2G085111-1
GRMZM2G333183_T01 Zm2G333183
AC233939.1_FGT002 ZmAC233939-1_FG002
GRMZM2G441722_T01 Zm2G441722
Eucrg.J2160.1 EgrJ02160
Eucgr.D00350.1 EgrD00350
Eucgr.K00568.1 EgrK00568-1
Eucgr.K02930.1 EgrK02930
Eucgr.E00260.1 EgrE00260
Eucgr.C01000.1 EgrC01000
Eucgr.A01005.1 EgrA01005
Eucgr.A01006.1 EgrA01006-1
Eucgr.A01006.2 EgrA01006-2
Eucgr.J01214.1 EgrJ01214
Eucgr.J02615.1 EgrJ02615
Eucgr.H00958.1 EgrH00958
Eucgr.J00052.1 EgrJ00052
cassava4.1_000398m.g Mes000398
cassava4.1_000345m.g Mes000345
cassava4.1_000359m.g Mes000359
cassava4.1_030988m.g Mes030988
cassava4.1_000410m.g Mes000410
cassava4.1_000306m.g Mes000306
cassava4.1_000385m.g Mes000385
cassava4.1_000386m.g Mes000386
cassava4.1_000399m.g Mes000399
cassava4.1_000409m.g Mes000409
cassava4.1_026648m.g Mes026648
cassava4.1_021429m.g Mes021429
Medtr5g029640.1 Mtr5g029640
Medtr1g031500.1 Mtr1g031500
Medtr2g022080.1 Mtr2g022080
Medtr6g089620.1 Mtr6g089620
Medtr2g021930.1 Mtr2g021930
Medtr1g105850.1 Mtr1g105850
Medtr8g078020.1 Mtr8g078020
Medtr6g009670.1 Mtr6g009670
Medtr8g133940.1 Mtr8g133940
Medtr3g110110.1 Mtr3g110110
Medtr8g133950.1 Mtr8g133950
Medtr8g133840.1 Mtr8g133840
Medtr4g107320.1 Mtr4g107320
Medtr4g107560.1 Mtr4g107560
Medtr6g009780.1 Mtr6g009780
Medtr6g009880.1 Mtr6g009880
Medtr6g009840.1 Mtr6g009840
Medtr3g136400.1 Mtr3g136400
Medtr7g046830.1 Mtr7g046830
Medtr6g009450.1 Mtr6g009450
Medtr3g102650.1 Mtr3g102650
Medtr8g025810.1 Mtr8g025810
Medtr4g110940.1 Mtr4g110940
GSVIVT00000633001 VvT00000633001
GSVIVT00003365001 VvT00003365001
GSVIVT00003375001 VvT00003375001
GSVIVT00003377001 VvT00003377001
GSVIVT00014386001 VvT00014386001
GSVIVT00016667001 VvT00016667001
GSVIVT00018550001 VvT00018550001
GSVIVT00019727001 VvT00019727001
GSVIVT00019729001 VvT00019729001
GSVIVT00020929001 VvT00020929001
GSVIVT00024397001 VvT00024397001
GSVIVT00028243001 VvT00028243001
GSVIVT00030719001 VvT00030719001
GSVIVT00034033001 VvT00034033001
GSVIVT00037129001 VvT00037129001
Sb01g039110.1 SbABCB1
Sb02g019540.1 SbABCB2
Sb03g011860.1 SbABCB3
Sb03g023740.1 SbABCB4
Sb03g031990.1 SbABCB5
Sb03g032000.1 SbABCB6
Sb03g032030.1 SbABCB7
Sb03g033290.1 SbABCB8
Sb03g047490.1 SbABCB9
Sb04g006087.1 SbABCB10
Sb04g006090.1 SbABCB11
Sb04g006100.1 SbABCB12
Sb04g022480.1 SbABCB13
Sb04g031170.1 SbABCB14
Sb06g001440.1 SbABCB15
Sb06g018860.1 SbABCB16
Sb06g020350.1 SbABCB17
Sb06g030350.1 SbABCB18
Sb07g003510.1 SbABCB19
Sb07g003520.1 SbABCB20
Sb07g023730.1 SbABCB21
Sb09g002940.1 SbABCB22
Sb09g027320.1 SbABCB23
Sb09g027330.1 SbABCB24
e_gw1.13.597.1 SmABCB1
fgenesh1_pm.C_scaffold_6000062 SmABCB2
fgenesh2_pg.C_scaffold_13000013 SmABCB3
e_gw1.6.146.1 SmABCB4
estExt_Genewise1Plus.C_350372 SmABCB5
fgenesh1_pm.C_scaffold_42000045 SmABCB6
e_gw1.0.369.1 SmABCB7
fgenesh2_pg.C_scaffold_9000128 SmABCB8
estExt_Genewise1.C_210058 SmABCB9
fgenesh1_pm.C_scaffold_2000054 SmABCB10
e_gw1.73.37.1 SmABCB11
estExt_Genewise1Plus.C_90010 SmABCB12
e_gw1.0.1863.1 SmABCB13
e_gw1.22.307.1 SmABCB14
fgenesh1_pm.C_scaffold_0000169 SmABCB15
estExt_Genewise1.C_00569 SmABCB16
e_gw1.73.196.1 SmABCB17
fgenesh1_pm.C_scaffold_15000068 SmABCB18
LOC_Os01g18670.1 OsABCB1
LOC_Os01g35030.1 OsABCB3
LOC_Os01g50080.1 OsABCB4
LOC_Os01g50100.1 OsABCB5
LOC_Os01g50160.1 OsABCB6
LOC_Os01g52550.1 OsABCB7
LOC_Os01g74470.1 OsABCB8
LOC_Os02g09720.1 OsABCB9
LOC_Os02g46680.1 OsABCB11
LOC_Os03g08380.1 OsABCB12
LOC_Os03g17180.1 OsABCB13
LOC_Os04g40570.1 OsABCB15
LOC_Os05g47490.1 OsABCB18
LOC_Os05g47500.1 OsABCB19
LOC_Os08g05690.1 OsABCB20
LOC_Os08g05710.1 OsABCB21
LOC_Os08g45030.1 OsABCB22
Rco30078.t000079 Rc30078_t000079
Rco30054.t000025 Rc30054_t000025
Rco30076.t000120 Rc30076_t000120
Rco30076.t000122 Rc30076_t000122
Rco28180.t000015 Rc28180_t000015
Rco30170.t000796 Rc30170_t000796
Rco29581.t000001 Rc29581_t000001
Rco29693.t000124 Rc29693_t000124
Rco29822.t000171 Rc29822_t000171
Rco29889.t000174 Rc29889_t000174
Rco29889.t000175 Rc29889_t000175
Pp1s252_67V6.1 Pp1s252_67
Pp1s38_321V6.1 Pp1s38_321
Pp1s28_282V6.1 Pp1s28_282
Pp1s173_145V6.1 Pp1s173_145
Pp1s1_780V2.1 Pp1s1_780
Pp1s397_2V6.1 Pp1s397_2
Pp1s188_78V6.1 Pp1s188_78
Pp1s391_45V6.1 Pp1s391_45
Pp1s338_12V6.1 Pp1s338_12
Pp1s29_108V2.1 Pp1s29_108
Vc_estExt_fgenesh4_pg.C_30286 VcProt1
Cre17.g725200 Cre17_g725200
Cre17.g725150 Cre17_g725150
AT2G36910 AtABCB1
AT4G25960 AtABCB2
AT4G01820 AtABCB3
AT2G47000 AtABCB4
AT4G01830 AtABCB5
AT2G39480 AtABCB6
AT5G46540 AtABCB7
AT3G30875 AtABCB8
AT4G18050 AtABCB9
AT1G10680 AtABCB10
At1g02520 AtABCB11
AT1G02530 AtABCB12
AT1G27940 AtABCB13
AT1G28010 AtABCB14
AT3G28345 AtABCB15
AT3G28360 AtABCB16
AT3G28380 AtABCB17
AT3G28390 AtABCB18
AT3G28860 AtABCB19
AT3G55320 AtABCB20
AT3G62150 AtABCB21
AT3G28415 AtABCB22
orange1.1g000851m.g Csi_g000851
orange1.1g000777m.g Csi_g000777
orange1.1g000789m.g Csi_g000789
orange1.1g000909m.g Csi_g000909
orange1.1g000830m.g Csi_g000830
orange1.1g000406m.g Csi_g000406
orange1.1g000687m.g Csi_g000687
orange1.1g000856m.g Csi_g000856
AcoGoldSmith_v1.000232m.g Aco000232
AcoGoldSmith_v1.022827m.g Aco022827
AcoGoldSmith_v1.027230m.g Aco027230
AcoGoldSmith_v1.000200m.g Aco000200
AcoGoldSmith_v1.018338m.g Aco018338
AcoGoldSmith_v1.000314m.g Aco000314
AcoGoldSmith_v1.022346m.g Aco022346
AcoGoldSmith_v1.026987m.g Aco026987
AcoGoldSmith_v1.022633m.g Aco022633
AcoGoldSmith_v1.000202m.g Aco000202
AcoGoldSmith_v1.000201m.g Aco000201
AcoGoldSmith_v1.000230m.g Aco000230
AcoGoldSmith_v1.000215m.g Aco000215
AcoGoldSmith_v1.000236m.g Aco000236
AcoGoldSmith_v1.000229m.g Aco000229
AUX/LAXs
ppa005323m.g Ppe005323
ppa005057m.g Ppe005057
ppa004949m.g Ppe004949
ppa004865m.g Ppe004865
POPTR_0006s09940 PtrAUX1/LAX5
POPTR_0016s12100 PtrAUX2/LAX1
POPTR_0010s19840 PtrAUX3/LAX2
POPTR_0008s06630 PtrAUX4/LAX6
POPTR_0004s17860 PtrAUX5/LAX7
POPTR_0009s13470 PtrAUX6/LAX3
POPTR_0005s16020 PtrAUX7/LAX8
POPTR_0002s08750 PtrAUX8/LAX4
GRMZM2G067022_T01 Zm2G067022
GRMZM2G127949_T01 Zm2G127949
GRMZM2G045057_T01 Zm2G045057
GRMZM2G149481_T01 Zm2G149481
GRMZM2G129413_T01 Zm2G129413
Eucgr.F03758.1 EgrF03758_1
Eucgr.K02992.2 EgrK02992_2
Eucgr.G03044.2 EgrG03044_2
Eucgr.G01769.2 EgrG01769_2
Eucgr.A00514.2 EgrA00514_2
cassava4.1_006838m.g Mes006838
cassava4.1_006423m.g Mes006423
cassava4.1_006788m.g Mes006788
cassava4.1_006570m.g Mes006570
cassava4.1_006783m.g Mes006783
cassava4.1_006474m.g Mes006474
cassava4.1_007093m.g Mes007093
Medtr3g024670.1 Mtr3g024670
Medtr3g097960.1 Mtr3g097960
Medtr5g089600.1 Mtr5g089600
GSVIVT01008917001 VvT01008917001
GSVIVT01024054001 VvT01024054001
GSVIVT01032855001 VvT01032855001
GSVIVT01033986001 VvT01033986001
Sb01g026240.1 SbLAX1
Sb01g041270.1 SbLAX2
Sb03g040320.1 SbLAX3
Sb05g004250.1 SbLAX4
Sb09g021990.1 SbLAX5
estExt_Genewise1Plus.C_20968 SmAUX1
estExt_fgenesh2_pg.C_50586 SmAUX2
LOC_Os01g63770.1 OsLAX1
LOC_Os03g14080.1 OsLAX2
LOC_Os05g37470.1 OsLAX3
LOC_Os10g05690.1 OsLAX4
LOC_Os11g06820.1 OsLAX5
Rco29669.t000030 Rc29669_t000030
Rco29741.t000002 Rc29741_t000002
Rco29908.t000197 Rc29908_t000197
Rco29969.t000004 Rc29969_t000004
Pp1s90_46V6.1 Pp1s90_46
Pp1s213_89V6.1 Pp1s213_89
Pp1s211_67V6.1 Pp1s211_67
AT2G38120.1 AtAUX1
AT5G01240.1 AtLAX1
AT2G21050.1 AtLAX2
AT1G77690.1 AtLAX3
orange1.1g011392m.g Csi_g011392
orange1.1g011022m.g Csi_g011022
orange1.1g012371m.g Csi_g012371
orange1.1g011966m.g Csi_g011966
AcoGoldSmith_v1.004219m.g Aco004219
AcoGoldSmith_v1.004342m.g Aco004342
AcoGoldSmith_v1.003895m.g Aco003895
AY864733 Pto-AY864733
AF115543 Ptt-AF115543
PINs
ppa022797m.g Ppe022797
ppa003159m.g Ppe003159
ppa024134m.g Ppe024134
ppa002528m.g Ppe002528
ppa025174m.g Ppe025174
ppa002944m.g Ppe002944
ppa021573m.g Ppe021573
ppa007621m.g Ppe007621
POPTR_0015s04570 PtrPIN1
POPTR_0016s03450 PtrPIN2
POPTR_0010s12320 PtrPIN3
POPTR_0005s20990 PtrPIN4
POPTR_0002s07310 PtrPIN5
POPTR_0008s12830 PtrPIN6
POPTR_0012s04470 PtrPIN7
POPTR_0006s03540 PtrPIN8
POPTR_0018s13610 PtrPIN9
POPTR_0001s21230 PtrPIN10
POPTR_0013s08510 PtrPIN11
POPTR_0019s07990 PtrPIN12
POPTR_0004s12310 PtrPIN13
POPTR_0017s11440 PtrPIN14
POPTR_0014s14390 PtrPIN15
XM_002336619.1 PtrPIN16
ZmPIN1a_GRMZM2G098643 ZmPIN1a
ZmPIN1b_GRMZM2G074267 ZmPIN1b
ZmPIN1c_GRMZM2G149184 ZmPIN1c
ZmPIN1d_GRMZM2G171702_T01 ZmPIN1d
ZmPIN2 ZmPIN2
ZmPIN5a-GRMZM2G025742 ZmPIN5a
ZmPIN5b-GRMZM2G148648 ZmPIN5b
ZmPIN5c-GRMZM2G040911 ZmPIN5c
ZmPIN8_GRMZM5G839411 ZmPIN8
ZmPIN9_GRMZM5G859099 ZmPIN9
ZmPIN10a-GRMZM2G126260 ZmPIN10a
ZmPIN10b-GRMZM2G160496 ZmPIN10b
Eucgr.F04265.1 EgrF04265_1
Eucgr.K02271.1 EgrK02271_1
Eucgr.G02187.1 EgrG02187_1
Eucgr.G02549.1 EgrG02549_1
Eucgr.B01406.1 EgrB01406_1
Eucgr.B02902.1 EgrB02902_1
Eucgr.B00948.1 EgrB00948_1
Eucgr.C00078.1 EgrC00078_1
Eucgr.A02229.1 EgrA02229_1
Eucgr.H01390.1 EgrH01390_1
Eucgr.H01391.1 EgrH01391_1
Eucgr.I01919.1 EgrI01919_1
Eucgr.G02548.1 EgrG02548_1
Eucgr.B01405.1 EgrB01405_1
Eucgr.B01403.1 EgrB01403_1
Eucgr.H01382.1 EgrH01382_1
cassava4.1_003807m.g Mes003807
cassava4.1_030090m.g Mes030090
cassava4.1_029078m.g Mes029078
cassava4.1_003367m.g Mes003367
cassava4.1_006998m.g Mes006998
cassava4.1_026579m.g Mes026579
cassava4.1_003794m.g Mes003794
cassava4.1_029063m.g Mes029063
cassava4.1_033391m.g Mes033391
cassava4.1_010688m.g Mes010688
cassava4.1_010607m.g Mes010607
Medtr2g043210 Mtr2g043210
Medtr4g154810 Mtr4g154810
Medtr6g083450 Mtr6g083450
Medtr7g008720 Mtr7g008720
Medtr7g089430 Mtr7g089430
Medtr7g106430 Mtr7g106430
Medtr8g130020 Mtr8g130020
Medtr8g130040 Mtr8g130040
MtrAAM55297 MtrAAM55297
MtrAY115838 MtrAY115838
MtrAAT48627 MtrAAT48627
GSVIVT00014302001 VvT00014302001
GSVIVT00017824001 VvT00017824001
GSVIVT00020886001 VvT00020886001
GSVIVT00023254001 VvT00023254001
GSVIVT00023255001 VvT00023255001
GSVIVT00025093001 VvT00025093001
GSVIVT00025108001 VvT00025108001
GSVIVT00030482001 VvT00030482001
GSVIVT00031315001 VvT00031315001
Sb02g029210.1 SbPIN1
Sb03g029320.1 SbPIN2
Sb03g032850.1 SbPIN3
Sb03g037350.1 SbPIN4
Sb03g043960.1 SbPIN5
Sb04g028170.1 SbPIN6
Sb05g002150.1 SbPIN7
Sb07g026370.1 SbPIN8
Sb10g004430.1 SbPIN9
Sb10g008290.1 SbPIN10
Sb10g026300.1 SbPIN11
e_gw1.26.13.1 Sm102666
e_gw1.59.169.1 Sm119024
fgenesh1_pm.C_scaffold_9000007 Sm231064
fgenesh1_pm.C_scaffold_59000022 Sm234325
estExt_fgenesh1_pm.C_500006 Sm268490
e_gw1.21.81.1 Sm99301
Os01g45550.1 OsPIN10a
Os01g51780 OsPIN8
Os01g58860 OsPIN9
Os01g69070 OsPIN5a
Os02g50960.1 OsPIN1b
Os05g50140 OsPIN10b
Os06g12610 OsPIN1a
Os06g44970 OsPIN2
Os08g41720 OsPIN5b
Os09g32770 OsPIN5c
Os11g04190 OsPIN1c
Os12g04000 OsPIN1d
Rco27985.t000045 Rc27985_t000045
Rco29662.t000026 Rc29662_t000026
Rco29816.t000014 Rc29816_t000014
Rco30180.t000054 Rc30180_t000054
Rco29822.t000149 Rc29822_t000149
Rco30128.t000486 Rc30128_t000486
Pp1s10_17V6.1 PpPIN1A
Pp1s18_186V6.1 PpPIN1B
Pp1s32_43V6.1 PpPIN1C
Pp1s79_126V6 PpPIN1D
AT1G73590 AtPIN1
AT5G57090 AtPIN2
AT1G70940 AtPIN3
AT2G01420 AtPIN4
AT5G16530 AtPIN5
AT1G77110 AtPIN6
AT1G23080 AtPIN7
AT5G15100 AtPIN8
orange1.1g006199m.g Csi_g006199
orange1.1g007826m.g Csi_g007826
orange1.1g036474m.g Csi_g036474
orange1.1g041301m.g Csi_g041301
orange1.1g048649m.g Csi_g048649
orange1.1g035534m.g Csi_g035534
orange1.1g007420m.g Csi_g007420
orange1.1g018360m.g Csi_g018360
orange1.1g019021m.g Csi_g019021
AcoGoldSmith_v1.001931m.g Aco001931
AcoGoldSmith_v1.018694m.g Aco018694
AcoGoldSmith_v1.018139m.g Aco018139
AcoGoldSmith_v1.016169m.g Aco016169
AcoGoldSmith_v1.007499m.g Aco007499
AcoGoldSmith_v1.021242m.g Aco021242
AY302060 PtoPIN1-like
AF190881 PttPIN1
AF515435 PttPIN2
AF515434 PttPIN3

Table A5.

List of all primers used in the present work.

Name Direction Sequence (5′–3′) Tm (°C)a Amplicon (bp)
PIN1 RT-F3 Forward AAGCTGAAGATGGTAGGGACCTT 58 94
PIN1 RT-R3 Reverse TGGGCGCCATAATCATGAC 59
PIN2 RT-F4 Forward GATCAATGTTCAGGGATCAACAGA 59 81
PIN2 RT-R4 Reverse GTTGTTGGTGGAAATGAAGTGAAA 59
PIN3 RT-F3 Forward CTTCACGTTGCTATTGTTCAGG 54.1 238
PIN3 RT-R3 Reverse TGACACACGACCAGCAAGTAA 56.5
PIN4 RT-F4 Forward CGTTGGAATGAGAGGAGTGC 55 204
PIN4 RT-R4 Reverse AATCTAAATTCCCCCTCTAATTCATGG 54.8
PIN5 RT-F2 Forward GACTAATGCAACCAACACACCTTT 58 67
PIN5 RT-R2 Reverse TGGATGCCGGGATATTTTACC 59
PIN6 RT-F2 Forward CCATTCCACAAGCTGGAAATT 53.7 166
PIN6 RT-R2 Reverse CCGGAATCTGGAGCGCCGA 62.6
PIN7 RT-F4 Forward TCAGTGCTCGGGCATCAA 58 81
PIN7 RT-R4 Reverse GGATCATTAGTAGATATGAAGTGGAAAGAG 58
PIN8 RT-F2 Forward CTTCATTTGCTGTTGGACTACG 54.1 192
PIN8 RT-R2 Reverse GTCCAAGCAAAATATAGTAAACCAGTGT 55.6
PIN9 RT-F2 Forward GCTGCTTTTCAACCTGAATCCG 57 173
PIN9 RT-R2 Reverse TCTGCTGCCATATCCATCTTCTTTTG 57.3
PIN10 RT-F4 Forward GGCAGACACACCTACCCTGATC 59.4 100
PIN10 RT-R4 Reverse CCGGAGGCATCTGTTGTTTC 56.3
PIN11 RT-F3 Forward CAGCATTGCCACAGTCAATTACATC 56.8 196
PIN11 RT-R3 Reverse GCCGAGCTATATTCCTCCTTCAAG 57
PIN12 RT-F6 Forward GCTACGGCTGGTCCATTACC 58 100
PIN12 RT-R6 Reverse ACTGCCGTCGGCCCATA 59.6
PIN13 RT-F2 Forward GGATACATTGAGCACAGGGGTAA 56.6 199
PIN13 RT-R2 Reverse TGGACGGGACAGACTTCTATGATTC 57.9
PIN14 RT-F3 Forward ATAGTGATATTGTCAACAGGAGGG 54.1 175
PIN14 RT-R3 Reverse CCAGTCTAACGGCGAAGGAAG 57.6
PIN15 RT-F2 Forward TTTGCTGGGCTAATTTCTCAAGA 55.5 188
PIN15 RT-R1 Reverse AGTGGGATCCCCATCACAAG 54.9
PIN16 RT-F4 Forward GGTAACAATCTTGTCAAAGGCAGGT 57.3 199
PIN16 RT-R4 Reverse GGATAGTTTCAACATGGTCCCTCTCA 58.2
AUX1 RT-F1 Forward TCCCTTTATGCCAAGCTGGA 56.5 217
AUX1 RT-R1 Reverse ATGTAGTCAGCTCACTCAGCG 56.6
AUX2 RT-F3 Forward CGTTCGGACTCTTCGCAAAG 56.3 100
AUX2 RT-R3 Reverse TCTTGGGACTGATTTGCTTCAG 55.1
AUX3 RT-F2 Forward GTTCACGGCCAGGTTGATG 56.6 100
AUX3 RT-R2 Reverse CATGCCCACCAAAAGTGTAGAG 56.1
AUX4 RT-F4 Forward AGGGTGGGCTAGTATGTCCAA 57.7 191
AUX4 RT-R4 Reverse AAACACAATGCAGAGGAGATGC 55.9
AUX5 RT-F1 Forward AGCCATCAAAGTACACGGGA 56.3 174
AUX5 RT-R1 Reverse TCTGAGGTGGGCATTGGTAA 56.1
AUX6 RT-F4 Forward CCTGTGGTTATTCCCATTTGGTT 55.6 180
AUX6 RT-R4 Reverse GTACTTTGGTGGTTGCTCCA 55.2
AUX7 RT-F2 Forward CGTCAGATTGATTCATTTGGTCTATTC 54.2 213
AUX7 RT-R2 Reverse ATCACACCTTTTCAAGAACCAACA 55.2
AUX8 RT-F1 Forward GAGAGAATGCTGTGGAGAGAC 54.8 182
AUX8 RT-R1 Reverse ACACTGGTAGCACTTGGTGA 56.2
ABCB1 RT-F4 Forward GATGGTAAAGTAGCAGAGCAAGGAT 56.7 212
ABCB1 RT-R4 Reverse ATGGGATATACTCCTCTTACTGGTGT 56.5
ABCB2 RT-F3 Forward CAAGCATGAGACTCTGATTCATATCA 54.7 100
ABCB2 RT-R3 Reverse AATATTGCAGGTGGTGACTCAAGA 56.4
ABCB4 RT-F2 Forward GGGCAATCCTAAAGAATCCGAAAAT 55.7 264
ABCB4 RT-R4 Reverse TATGAAGGGCGACCAAGGATG 56.9
ABCB5 RT-F3 Forward TCGCAATACCTCCCGGTACA 58.1 100
ABCB5 RT-R3 Reverse GCGTGCGGGTCGTAAAAC 57.3
ABCB7 RT-F2 Forward GTGGTTTTGCTGTTAGATGAGGC 56.5 269
ABCB7 RT-R2 Reverse ACTGTTTTGTGTTGTCCTCTGG 55.4
ABCB10 RT-F4 Forward CAG AAG CAA AGG GTA GCC ATT 55.4 211
ABCB10 RT-R4 Reverse CTCCATTTTTAACCACTGCGATTAGA 56.4
ABCB13 RT-F3 Forward CAAGAGCAATTCTGAAAGATCCACG 56.3 206
ABCB13 RT-R3 Reverse ACCTTTTTCCACTATCTTGCCATG 55.6
ABCB14 RT-F1 Forward GACAGTCAAGTCAAAGAATCTCATTG 54.2 221
ABCB14 RT-R1 Reverse TGGAACCTCTGGCTTGTTAAGA 56
ABCB13 RT-F2 Forward CAAGAAGCACTGGACCGAATCAT 57.4 229
ABCB13 RT-R2 Reverse TAAACACACGGAGGTGCTACAAT 56.4
ABCB18 RT-F3 Forward AGCTCATCCATCGAATCTGAATCAA 56.3 211
ABCB18 RT-R3 Reverse GCATCAGACGGACATACAAACCAT 57.4
ABCB19 RT-F3 Forward TCTTAAGGACCCAGCAATCCTACT 57.3 100
ABCB19 RT-R3 Reverse CCTCATTAGCCTCTCGAGTGCTT 58.5
ACT2 RT-F1b Forward GCAACTGGGATGATATGGAGA 54.3 213
ACT2 RT-R1 Reverse TACGACCACTGGCATACAGG 56.5
UBQ RT-F1b Forward CAGCTTGAAGATGGGAGGAC 55.4 154
UBQ RT-R1 Reverse CAATGGTGTCTGAGCTCTCG 55.5
TUA2 RT-F1 Forward CCTACTGTAGTACCTGGGGGTG 58.2 230
TUA2 RT-R1 Reverse CCAACTTCCTCGTAATCCTTCTCA 56.2
PD-E1 RT-F1 Forward ATGAGAACTGGTGGTATTGGTGC 57.3 164
PD-E1 RT-R1 Reverse GTCACAATCTGGGCAGGTTGAAC 58.5
CLONING AND SEQUENCING
M13F Forward TTGTAAAACGACGGCCAGT 54.7
M13R Reverse CAGGAAACAGCTATGACC 50.1
adp1-dT17c CCGGATCCTCTAGAGCGGCCGC(T)17 64.6
adp1 CCGGATCCTCTAGAGCGGCC 61.9
PIN3 RT-F3 Forward CTTCACGTTGCTATTGTTCAGG 54.1
PIN4 RT-F3 Forward CTTCAGCCTCGGATAATTGTATGC 55.1
PIN11A RT-F3 Forward GCGATGTCTTACGTGTTGCTA 55.1
PIN13 RT-F2 Forward GGATACATTGAGCACAGGGGTAA 56.6
AUX4 RT-F3 Forward CCGACTCCTGCAAAACATCATTA 55.4
ABCB1 RT-F3 forward CGCATGATACAGTTACAAAGGTTCA 55.5

aMelting temperatures were calculated with the online tool OlygoAnalyzer v.3.1 from Integrated DNA Technologies.

bThese primer pairs have been first published in Secchi et al. (2009).

cThis primer sequence has been first published in Kramer et al. (1998).

Footnotes

References

  1. Bainbridge K., Guyomarc’h S., Bayer E., Swarup R., Bennett M., Mandel T., Kuhlemeier C. (2008). Auxin influx carriers stabilize phyllotactic patterning. Genes Dev. 22, 810–823 10.1101/gad.462608 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Baker D. A. (2000). Long-distance vascular transport of endogenous hormones in plants and their role in source: sink regulation. Isr. J. Plant Sci. 48, 199–203 10.1560/QA6D-YP8C-DP8G-AG6K [DOI] [Google Scholar]
  3. Bandyopadhyay A., Blakeslee J. J., Lee O. R., Mravec J., Sauer M., Titapiwatanakun B., Makam S. N., Bouchard R., Geisler M., Martinoia E., Friml J., Peer W. A., Murphy A. S. (2007). Interactions of PIN and PGP auxin transport mechanisms. Biochem. Soc. Trans. 35, 137–141 10.1042/BST0350137 [DOI] [PubMed] [Google Scholar]
  4. Banks J. A., Nishiyama T., Hasebe M., Bowman J. L., Gribskov M., DePamphilis C., Albert V. A., Aono N., Aoyama T., Ambrose B. A., Ashton N. W., Axtell M. J., Barker E., Barker M. S., Bennetzen J. L., Bonawitz N. D., Chapple C., Cheng C., Correa L. G., Dacre M., DeBarry J., Dreyer I., Elias M., Engstrom E. M., Estelle M., Feng L., Finet C., Floyd S. K., Frommer W. B., Fujita T., Gramzow L., Gutensohn M., Harholt J., Hattori M., Heyl A., Hirai T., Hiwatashi Y., Ishikawa M., Iwata M., Karol K. G., Koehler B., Kolukisaoglu U., Kubo M., Kurata T., Lalonde S., Li K., Li Y., Litt A., Lyons E., Manning G., Maruyama T., Michael T. P., Mikami K., Miyazaki S., Morinaga S., Murata T., Mueller-Roeber B., Nelson D. R., Obara M., Oguri Y., Olmstead R. G., Onodera N., Petersen B. L., Pils B., Prigge M., Rensing S. A., Riaño-Pachón D. M., Roberts A. W., Sato Y., Scheller H. V., Schulz B., Schulz C., Shakirov E. V., Shibagaki N., Shinohara N., Shippen D. E., Sørensen I., Sotooka R., Sugimoto N., Sugita M., Sumikawa N., Tanurdzic M., Theissen G., Ulvskov P., Wakazuki S., Weng J. K., Willats W. W., Wipf D., Wolf P. G., Yang L., Zimmer A. D., Zhu Q., Mitros T., Hellsten U., Loqué D., Otillar R., Salamov A., Schmutz J., Shapiro H., Lindquist E., Lucas S., Rokhsar D., Grigoriev I. V. (2011). The Selaginella genome identifies genetic changes associated with the evolution of vascular plants. Science 332, 960–963 10.1126/science.1203810 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bell C. D., Soltis D. E., Soltis P. S. (2010). The age and diversification of the angiosperms re-revisited. Am. J. Bot. 97, 1296–1303 10.3732/ajb.0900161 [DOI] [PubMed] [Google Scholar]
  6. Benková E., Michniewicz M., Sauer M., Teichmann T., Seifertová D., Jürgens G., Friml J. (2003). Local, efflux-dependent auxin gradients as a common module for plant organ formation. Cell 115, 591–602 10.1016/S0092-8674(03)00924-3 [DOI] [PubMed] [Google Scholar]
  7. Bennett M. J., Marchant A., Green H. G., May S. T., Ward S. P., Millner P. A., Walker A. R., Schulz B., Feldmann K. A. (1996). Arabidopsis AUX1 gene: a permease-like regulator of root gravitropism. Science 273, 948–950 10.1126/science.273.5277.948 [DOI] [PubMed] [Google Scholar]
  8. Björklund S., Antti H., Uddestrand I., Moritz T., Sundberg B. (2007). Cross-talk between gibberellin and auxin in development of Populus wood: gibberellin stimulates polar auxin transport and has a common transcriptome with auxin. Plant J. 52, 499–511 10.1111/j.1365-313X.2007.03250.x [DOI] [PubMed] [Google Scholar]
  9. Brunner A. M., Yakovlev I. A., Strauss S. H. (2004). Validating internal controls for quantitative plant gene expression studies. BMC Plant Biol. 4, 14. 10.1186/1471-2229-4-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Carraro N., Forestan C., Canova S., Traas J., Varotto S. (2006). ZmPIN1a and ZmPIN1b encode two novel putative candidates for polar auxin transport and plant architecture determination of maize. Plant Physiol. 142, 254–264 10.1104/pp.106.080119 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Castresana J. (2000). Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol. Biol. Evol. 17, 540–552 [DOI] [PubMed] [Google Scholar]
  12. Chaw S.-M., Chang C.-C., Chen H.-L., Li W.-H. (2004). Dating the monocot-dicot divergence and the origin of core eudicots using whole chloroplast genomes. J. Mol. Evol. 58, 424–441 10.1007/s00239-003-2564-9 [DOI] [PubMed] [Google Scholar]
  13. Chen R., Hilson P., Sedbrook J., Rosen E., Caspar T., Masson P. H. (1998). The Arabidopsis thaliana AGRAVITROPIC 1 gene encodes a component of the polar-auxin-transport efflux carrier. Proc. Natl. Acad. Sci. U.S.A. 95, 15112–15117 10.1073/pnas.95.11.6193 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Dolinsky T. J., Czodrowski P., Li H., Nielsen J. E., Jensen J. H., Klebe G., Baker N. A. (2007). PDB2PQR: expanding and upgrading automated preparation of biomolecular structures for molecular simulations. Nucleic Acids Res. 35, W522–W525 10.1093/nar/gkm276 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Dolinsky T. J., Nielsen J. E., McCammon J. A., Baker N. A. (2004). PDB2PQR: an automated pipeline for the setup of Poisson-Boltzmann electrostatics calculations. Nucleic Acids Res. 32, W665–W667 10.1093/nar/gkh381 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Forestan C., Meda S., Varotto S. (2010). ZmPIN1-mediated auxin transport is related to cellular differentiation during maize embryogenesis and endosperm development. Plant Physiol. 152, 1373–1390 10.1104/pp.109.150193 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Friml J., Benková E., Blilou I., Wisniewska J., Hamann T., Ljung K., Woody S., Sandberg G., Scheres B., Jürgens G., Palme K. (2002a). AtPIN4 mediates sink-driven auxin gradients and root patterning in Arabidopsis. Cell 108, 661–673 10.1016/S0092-8674(02)00656-6 [DOI] [PubMed] [Google Scholar]
  18. Friml J., Wisniewska J., Benková E., Mendgen K., Palme K. (2002b). Lateral relocation of auxin efflux regulator PIN3 mediates tropism in Arabidopsis. Nature 415, 806–809 10.1038/415806a [DOI] [PubMed] [Google Scholar]
  19. Friml J., Jones A. R. (2010). Endoplasmic reticulum: the rising compartment in auxin biology. Plant Physiol. 154, 458–462 10.1104/pp.110.161380 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Friml J., Vieten A., Sauer M., Weijers D., Schwarz H., Hamann T., Offringa R., Jürgens G. (2003). Efflux-dependent auxin gradients establish the apical-basal axis of Arabidopsis. Nature 426, 147–153 10.1038/nature02085 [DOI] [PubMed] [Google Scholar]
  21. Gälweiler L., Guan C., Müller A., Wisman E., Mendgen K., Yephremov A., Palme K. (1998). Regulation of polar auxin transport by AtPIN1 in Arabidopsis vascular tissue. Science 282, 2226–2230 10.1126/science.282.5397.2226 [DOI] [PubMed] [Google Scholar]
  22. Geisler M., Blakeslee J. J., Bouchard R., Lee O. R., Vincenzetti V., Bandyopadhyay A., Titapiwatanakun B., Peer W. A., Bailly A., Richards E. L., Ejendal K. F., Smith A. P., Baroux C., Grossniklaus U., Müller A., Hrycyna C. A., Dudler R., Murphy A. S., Martinoia E. (2005). Cellular efflux of auxin catalyzed by the Arabidopsis MDR/PGP transporter AtPGP1. Plant J. 44, 179–194 10.1111/j.1365-313X.2005.02519.x [DOI] [PubMed] [Google Scholar]
  23. Guo A.-Y., Zhu Q.-H., Chen X., Luo J.-C. (2007). GSDS: a gene structure display server. Yi Chuan 29, 1023–1026 10.1360/yc-007-1023 [DOI] [PubMed] [Google Scholar]
  24. Gutierrez L., Mauriat M., Guénin S., Pelloux J., Lefebvre J.-F., Louvet R., Rusterucci C., Moritz T., Guerineau F., Bellini C., Van Wuytswinkel O. (2008). The lack of a systematic validation of reference genes: a serious pitfall undervalued in reverse transcription-polymerase chain reaction (RT-PCR) analysis in plants. Plant Biotechnol. J. 6, 609–618 10.1111/j.1467-7652.2008.00346.x [DOI] [PubMed] [Google Scholar]
  25. Hellgren J. M., Olofsson K., Plant U., Centre S., Sciences A. (2004). Patterns of auxin distribution during gravitational induction of reaction wood in poplar and pine. Plant Physiol. 135, 212–220 10.1104/pp.104.038927 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Jasinski M., Ducos E., Martinoia E., Boutry M. (2003). The ATP-binding cassette transporters: structure, function, and gene family comparison between. Plant Physiol. 131, 1169–1177 10.1104/pp.102.014720 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Kaneda M., Schuetz M., Lin B. S. P., Chanis C., Hamberger B., Western T. L., Ehlting J., Samuels A. L. (2011). ABC transporters coordinately expressed during lignification of Arabidopsis stems include a set of ABCBs associated with auxin transport. J. Exp. Bot. 62, 2063–2077 10.1093/jxb/erq416 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Katekar G. F., Geissler A. E. (1980). Auxin transport inhibitors. Plant Physiol. 66, 1190–1195 10.1104/pp.66.6.1190 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Katoh K., Asimenos G., Toh H. (2009). Multiple alignment of DNA sequences with MAFFT. Methods Mol. Biol. 537, 39–64 10.1007/978-1-59745-251-9_3 [DOI] [PubMed] [Google Scholar]
  30. Knöller A. S., Blakeslee J. J., Richards E. L., Peer W. A., Murphy A. S. (2010). Brachytic2/ZmABCB1 functions in IAA export from intercalary meristems. J. Exp. Bot. 61, 3689–3696 10.1093/jxb/erq180 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Kramer E. M., Dorit R. L., Irish V. F. (1998). Molecular evolution of genes controlling petal and stamen development: duplication and divergence within the APETALA3 and PISTILLATA MADS-box gene lineages. Genetics 149, 765–783 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Kramer E. M., Lewandowski M., Beri S., Bernard J., Borkowski M., Borkowski M. H., Burchfield L. A., Mathisen B., Normanly J. (2008). Auxin gradients are associated with polarity changes in trees. Science 320, 1610. 10.1126/science.320.5879.1011b [DOI] [PubMed] [Google Scholar]
  33. Kubeš M., Yang H., Richter G. L., Cheng Y., Mlodzinska E., Wang X., Blakeslee J. J., Carraro N., Petrášek J., Zažímalová E., Hoyerová K., Peer W. A., Murphy A. S. (2011). The Arabidopsis concentration-dependent influx/efflux transporter ABCB4 regulates cellular auxin levels in the root epidermis. Plant J. [Epub ahead of print]. [DOI] [PubMed] [Google Scholar]
  34. Krecek P., Skupa P., Libus J., Naramoto S., Tejos R., Friml J., Zažímalová E. (2009). Protein family review The PIN-FORMED (PIN) protein family of auxin transporters. Genome Biol. 10, 1–11 10.1186/gb-2009-10-12-249 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Lachaud S., Bonnemain J. L. (1984). Seasonal variations in the polar transport pathways and retention sites of [3H]indole-3-acetic acid in young branches of Fagus sylvatica L. Planta 161, 207–215 10.1007/BF00982914 [DOI] [PubMed] [Google Scholar]
  36. Lee B. H. A., Johnston R., Yang Y., Gallavotti A., Kojima M., Travençolo B. A. N., Costa L. D. F., Sakakibara H., Jackson D. (2009). Studies of aberrant phyllotaxy1 mutants of maize indicate complex interactions between auxin and cytokinin signaling in the shoot apical meristem. Plant Physiol. 150, 205–216 10.1104/pp.109.137745 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Lee M., Choi Y., Burla B., Kim Y.-Y., Jeon B., Maeshima M., Yoo J.-Y., Martinoia E., Lee Y. (2008). The ABC transporter AtABCB14 is a malate importer and modulates stomatal response to CO2. Nat. Cell Biol. 10, 1217–1223 10.1038/ncb1710 [DOI] [PubMed] [Google Scholar]
  38. Livak K. J., Schmittgen T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25, 402–408 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]
  39. Ljung K., Bhalerao R. P., Sandberg G. (2001a). Sites and homeostatic control of auxin biosynthesis in Arabidopsis during vegetative growth. Plant J. 28, 465–474 10.1046/j.1365-313X.2001.01173.x [DOI] [PubMed] [Google Scholar]
  40. Ljung K., Ostin A., Lioussanne L., Sandberg G. (2001b). Developmental regulation of indole-3-acetic acid turnover in Scots pine seedlings. Plant Physiol. 125, 464–475 10.1104/pp.125.1.464 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Ljung K., Hull A. K., Celenza J., Yamada M., Estelle M., Normanly J. (2005). Sites and regulation of auxin biosynthesis in Arabidopsis roots. Plant Cell 17, 1090–1104 10.1105/tpc.104.029272 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Lomax T., Muday G. K., Rubery P. H. (1995). Plant Hormones: Physiology, Biochemistry, and Molecular Biology. Dordrecht: K. A. Publishers [Google Scholar]
  43. Luschnig C., Gaxiola R. A., Grisafi P., Fink G. R. (1998). EIR1, a root-specific protein involved in auxin transport, is required for gravitropism in Arabidopsis thaliana. Genes Dev. 12, 2175–2187 10.1101/gad.12.14.2175 [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Merchant S. S., Prochnik S. E., Vallon O., Harris E. H., Karpowicz S. J., Witman G. B., Terry A., Salamov A., Fritz-Laylin L. K., Maréchal-Drouard L., Marshall W. F., Qu L. H., Nelson D. R., Sanderfoot A. A., Spalding M. H., Kapitonov V. V., Ren Q., Ferris P., Lindquist E., Shapiro H., Lucas S. M., Grimwood J., Schmutz J., Cardol P., Cerutti H., Chanfreau G., Chen C. L., Cognat V., Croft M. T., Dent R., Dutcher S., Fernández E., Fukuzawa H., González-Ballester D., González-Halphen D., Hallmann A., Hanikenne M., Hippler M., Inwood W., Jabbari K., Kalanon M., Kuras R., Lefebvre P. A., Lemaire S. D., Lobanov A. V., Lohr M., Manuell A., Meier I., Mets L., Mittag M., Mittelmeier T., Moroney J. V., Moseley J., Napoli C., Nedelcu A. M., Niyogi K., Novoselov S. V., Paulsen I. T., Pazour G., Purton S., Ral J. P., Riaño-Pachón D. M., Riekhof W., Rymarquis L., Schroda M., Stern D., Umen J., Willows R., Wilson N., Zimmer S. L., Allmer J., Balk J., Bisova K., Chen C. J., Elias M., Gendler K., Hauser C., Lamb M. R., Ledford H., Long J. C., Minagawa J., Page M. D., Pan J., Pootakham W., Roje S., Rose A., Stahlberg E., Terauchi A. M., Yang P., Ball S., Bowler C., Dieckmann C. L., Gladyshev V. N., Green P., Jorgensen R., Mayfield S., Mueller-Roeber B., Rajamani S., Sayre R. T., Brokstein P., Dubchak I., Goodstein D., Hornick L., Huang Y. W., Jhaveri J., Luo Y., Martínez D., Ngau W. C., Otillar B., Poliakov A., Porter A., Szajkowski L., Werner G., Zhou K., Grigoriev I. V., Rokhsar D. S., Grossman A. R. (2007). The Chlamydomonas genome reveals the evolution of key animal and plant functions. Science 318, 245–250 10.1126/science.1143609 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Miller M. A., Pfeiffer W., Schwartz T. (2010). “Creating the CIPRES science gateway for inference of large phylogenetic trees,” in Gateway Computing Environments Workshop (GCE), New Orleans [Google Scholar]
  46. Mravec J., Skupa P., Bailly A., Hoyerová K., Krecek P., Bielach A., Petrásek J., Zhang J., Gaykova V., Stierhof Y.-D., Dobrev P. I., Schwarzerová K., Rolcík J., Seifertová D., Luschnig C., Benková E., Zazímalová E., Geisler M., Friml J. (2009). Subcellular homeostasis of phytohormone auxin is mediated by the ER-localized PIN5 transporter. Nature 459, 1136–1140 10.1038/nature08066 [DOI] [PubMed] [Google Scholar]
  47. Müller A., Guan C., Gälweiler L., Tänzler P., Huijser P., Marchant A., Parry G., Bennett M., Wisman E., Palme K. (1998). AtPIN2 defines a locus of Arabidopsis for root gravitropism control. EMBO J. 17, 6903–6911 10.1093/emboj/17.1.61 [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Multani D. S., Briggs S. P., Chamberlin M. A., Blakeslee J. J., Murphy A. S., Johal G. S. (2003). Loss of an MDR transporter in compact stalks of maize br2 and sorghum dw3 mutants. Science 302, 81–84 10.1126/science.1086072 [DOI] [PubMed] [Google Scholar]
  49. Nilsson J., Karlberg A., Antti H., Lopez-Vernaza M., Mellerowicz E., Perrot-Rechenmann C., Sandberg G., Bhalerao R. P. (2008). Dissecting the molecular basis of the regulation of wood formation by auxin in hybrid aspen. Plant Cell 20, 843–855 10.1105/tpc.107.055798 [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Noh B., Murphy A. S., Spalding E. P. (2001). Multidrug resistance-like genes of Arabidopsis required for auxin transport and auxin-mediated development. Plant Cell 13, 2441–2454 10.1105/tpc.13.11.2441 [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Okada K., Ueda J., Komaki M. K., Bell C. J., Shimura Y. (1991). Requirement of the auxin polar transport system in early stages of Arabidopsis floral bud formation. Plant Cell 3, 677. 10.1105/tpc.3.7.677 [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Petrásek J., Friml J. (2009). Auxin transport routes in plant development. Development 136, 2675–2688 10.1242/dev.030353 [DOI] [PubMed] [Google Scholar]
  53. Pfaffl M. W. (2001). A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, e45. 10.1093/nar/29.9.e45 [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Prochnik S. E., Umen J., Nedelcu A. M., Hallmann A., Miller S. M., Nishii I., Ferris P., Kuo A., Mitros T., Fritz-Laylin L. K., Hellsten U., Chapman J., Simakov O., Rensing S. A., Terry A., Pangilinan J., Kapitonov V., Jurka J., Salamov A., Shapiro H., Schmutz J., Grimwood J., Lindquist E., Lucas S., Grigoriev I. V., Schmitt R., Kirk D., Rokhsar D. S. (2010). Genomic analysis of organismal complexity in the multicellular green alga Volvox carteri. Science 329, 223–226 10.1126/science.1188800 [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Rea P. A. (2007). Plant ATP-binding cassette transporters. Annu. Rev. Plant Biol. 58, 347–375 10.1146/annurev.arplant.57.032905.105406 [DOI] [PubMed] [Google Scholar]
  56. Rensing S. A., Lang D., Zimmer A. D., Terry A., Salamov A., Shapiro H., Nishiyama T., Perroud P.-F., Lindquist E. A., Kamisugi Y., Tanahashi T., Sakakibara K., Fujita T., Oishi K., Shin-I T., Kuroki Y., Toyoda A., Suzuki Y., Hashimoto S., Yamaguchi K., Sugano S., Kohara Y., Fujiyama A., Anterola A., Aoki S., Ashton N., Barbazuk W. B., Barker E., Bennetzen J. L., Blankenship R., Cho S. H., Dutcher S. K., Estelle M., Fawcett J. A., Gundlach H., Hanada K., Heyl A., Hicks K. A., Hughes J., Lohr M., Mayer K., Melkozernov A., Murata T., Nelson D. R., Pils B., Prigge M., Reiss B., Renner T., Rombauts S., Rushton P. J., Sanderfoot A., Schween G., Shiu S. H., Stueber K., Theodoulou F. L., Tu H., Van de Peer Y., Verrier P. J., Waters E., Wood A., Yang L., Cove D., Cuming A. C., Hasebe M., Lucas S., Mishler B. D., Reski R., Grigoriev I. V., Quatrano R. S., Boore J. L. (2008). The Physcomitrella genome reveals evolutionary insights into the conquest of land by plants. Science 319, 64–69 10.1126/science.1150646 [DOI] [PubMed] [Google Scholar]
  57. Sanchez-Fernandez R., Davies T. G., Coleman J. O., Rea P. A. (2001). The Arabidopsis thaliana ABC protein superfamily, a complete inventory. J. Biol. Chem. 276, 30231–30244 10.1074/jbc.M103104200 [DOI] [PubMed] [Google Scholar]
  58. Sauer M., Balla J., Luschnig C., Wisniewska J., Reinöhl V., Friml J., Benková E. (2006). Canalization of auxin flow by Aux/IAA-ARF-dependent feedback regulation of PIN polarity. Genes Dev. 20, 2902–2911 10.1101/gad.390806 [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Scarpella E., Marcos D., Friml J., Berleth T. (2006). Control of leaf vascular patterning by polar auxin transport. Genes Dev. 20, 1015–1027 10.1101/gad.1402406 [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Schrader J., Baba K., May S. T., Palme K., Bennett M., Bhalerao R. P., Sandberg G. (2003). Polar auxin transport in the wood-forming tissues of hybrid aspen is under simultaneous control of developmental and environmental signals. Proc. Natl. Acad. Sci. U.S.A. 100, 10096–10101 10.1073/pnas.1633693100 [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Schrader J., Moyle R., Bhalerao R., Hertzberg M., Lundeberg J., Nilsson P., Bhalerao R. P. (2004). Cambial meristem dormancy in trees involves extensive remodelling of the transcriptome. Plant J. 40, 173–187 10.1111/j.1365-313X.2004.02199.x [DOI] [PubMed] [Google Scholar]
  62. Secchi F., MacIver B., Zeidel M. L., Zwieniecki M. A. (2009). Functional analysis of putative genes encoding the PIP2 water channel subfamily in Populus trichocarpa. Tree Physiol. 29, 1467–1477 10.1093/treephys/tpp060 [DOI] [PubMed] [Google Scholar]
  63. Shen C., Bai Y., Wang S., Zhang S., Wu Y., Chen M., Jiang D., Qi Y. (2010). Expression profile of PIN, AUX/LAX and PGP auxin transporter gene families in Sorghum bicolor under phytohormone and abiotic stress. FEBS J. 277, 2954–2969 10.1111/j.1742-4658.2010.07706.x [DOI] [PubMed] [Google Scholar]
  64. Sidler M., Hassa P., Hasan S., Ringli C., Dudler R. (1998). Involvement of an ABC transporter in a developmental pathway regulating hypocotyl cell elongation in the light. Plant Cell 10, 1623–1636 10.2307/3870761 [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Spicer R., Groover A. (2010). Evolution of development of vascular cambia and secondary growth. New Phytol. 186, 577–592 10.1111/j.1469-8137.2010.03236.x [DOI] [PubMed] [Google Scholar]
  66. Spicer R., Holbrook N. M. (2007). Parenchyma cell respiration and survival in secondary xylem: does metabolic activity decline with cell age? Plant Cell Environ. 30, 934–943 10.1111/j.1365-3040.2007.01677.x [DOI] [PubMed] [Google Scholar]
  67. Stamatakis A., Hoover P., Rougemont J. (2008). A rapid bootstrap algorithm for the RAxML Web servers. Syst. Biol. 57, 758–771 10.1080/10635150802429642 [DOI] [PubMed] [Google Scholar]
  68. Sussman M. R., Goldsmith M. H. M. (1981). The action of specific inhibitors of auxin transport on uptake of auxin and binding of N-1-naphthylphthalamic acid to a membrane site in maize coleoptiles. Planta 13–18 10.1007/BF00384978 [DOI] [PubMed] [Google Scholar]
  69. Swarup K., Benková E., Swarup R., Casimiro I., Péret B., Yang Y., Parry G., Nielsen E., De Smet I., Vanneste S., Levesque M. P., Carrier D., James N., Calvo V., Ljung K., Kramer E., Roberts R., Graham N., Marillonnet S., Patel K., Jones J. D., Taylor C. G., Schachtman D. P., May S., Sandberg G., Benfey P., Friml J., Kerr I., Beeckman T., Laplaze L., Bennett M. J. (2008). The auxin influx carrier LAX3 promotes lateral root emergence. Nat. Cell Biol. 10, 946–954 10.1038/ncb1754 [DOI] [PubMed] [Google Scholar]
  70. Swarup R., Friml J., Marchant A., Ljung K., Sandberg G., Palme K., Bennett M. (2001). Localization of the auxin permease AUX1 suggests two functionally distinct hormone transport pathways operate in the Arabidopsis root apex. Genes Dev. 15, 2648–2653 10.1101/gad.210501 [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Swarup R., Kramer E. M., Perry P., Knox K., Leyser H. M. O., Haseloff J., Beemster G. T. S., Bhalerao R., Bennett M. J. (2005). Root gravitropism requires lateral root cap and epidermal cells for transport and response to a mobile auxin signal. Nat. Cell Biol. 7, 1057–1065 10.1038/ncb1316 [DOI] [PubMed] [Google Scholar]
  72. Talavera G., Castresana J. (2007). Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments. Syst. Biol. 56, 564–577 10.1080/10635150701472164 [DOI] [PubMed] [Google Scholar]
  73. Terasaka K., Blakeslee J. J., Titapiwatanakun B., Peer W. A., Bandyopadhyay A., Makam S. N., Lee R., Richards E. L., Murphy A. S., Sato F., Yazaki K. (2005). PGP4, an ATP binding cassette P-glycoprotein, catalyzes auxin transport in Arabidopsis thaliana roots. Plant Cell 17, 2922–2939 10.1105/tpc.105.035816 [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Titapiwatanakun B., Murphy A. S. (2009). Post-transcriptional regulation of auxin transport proteins: cellular trafficking, protein phosphorylation, protein maturation, ubiquitination, and membrane composition. J. Exp. Bot. 60, 1093–1107 10.1093/jxb/ern240 [DOI] [PubMed] [Google Scholar]
  75. Tuominen H., Puech L., Fink S., Sundberg B. (1997). A radial concentration gradient of indole-3-acetic acid is related to secondary xylem development in hybrid aspen. Plant Physiol. 115, 577–585 [DOI] [PMC free article] [PubMed] [Google Scholar]
  76. Tuskan G. A., Difazio S., Jansson S., Bohlmann J., Grigoriev I., Hellsten U., Putnam N., Ralph S., Rombauts S., Salamov A., Schein J., Sterck L., Aerts A., Bhalerao R. R., Bhalerao R. P., Blaudez D., Boerjan W., Brun A., Brunner A., Busov V., Campbell M., Carlson J., Chalot M., Chapman J., Chen G. L., Cooper D., Coutinho P. M., Couturier J., Covert S., Cronk Q., Cunningham R., Davis J., Degroeve S., Déjardin A., Depamphilis C., Detter J., Dirks B., Dubchak I., Duplessis S., Ehlting J., Ellis B., Gendler K., Goodstein D., Gribskov M., Grimwood J., Groover A., Gunter L., Hamberger B., Heinze B., Helariutta Y., Henrissat B., Holligan D., Holt R., Huang W., Islam-Faridi N., Jones S., Jones-Rhoades M., Jorgensen R., Joshi C., Kangasjärvi J., Karlsson J., Kelleher C., Kirkpatrick R., Kirst M., Kohler A., Kalluri U., Larimer F., Leebens-Mack J., Leplé J. C., Locascio P., Lou Y., Lucas S., Martin F., Montanini B., Napoli C., Nelson D. R., Nelson C., Nieminen K., Nilsson O., Pereda V., Peter G., Philippe R., Pilate G., Poliakov A., Razumovskaya J., Richardson P., Rinaldi C., Ritland K., Rouzé P., Ryaboy D., Schmutz J., Schrader J., Segerman B., Shin H., Siddiqui A., Sterky F., Terry A., Tsai C. J., Uberbacher E., Unneberg P., Vahala J., Wall K., Wessler S., Yang G., Yin T., Douglas C., Marra M., Sandberg G., Van de Peer Y., Rokhsar D. (2006). The genome of black cottonwood, Populus trichocarpa (Torr. & Gray). Science 313, 1596–1604 10.1126/science.1128691 [DOI] [PubMed] [Google Scholar]
  77. Uggla C., Mellerowicz E., Sundberg B. (1998). Indole-3-acetic acid controls cambial growth in scots pine by positional signaling. Plant Physiol. 117, 113–121 10.1104/pp.117.1.113 [DOI] [PMC free article] [PubMed] [Google Scholar]
  78. Uggla C., Moritz T., Sandberg G., Sundberg B. (1996). Auxin as a positional signal in pattern formation in plants. Proc. Natl. Acad. Sci. U.S.A. 93, 9282–9286 10.1073/pnas.93.17.9282 [DOI] [PMC free article] [PubMed] [Google Scholar]
  79. Utsuno K., Shikanai T., Yamada Y., Hashimoto T. (1998). Agr, an Agravitropic locus of Arabidopsis thaliana, encodes a novel membrane-protein family member. Plant Cell Physiol. 39, 1111–1118 [DOI] [PubMed] [Google Scholar]
  80. Van Bel A. J. E. (1990). Xylem-phloem exchange via the rays: the undervalued route of transport. J. Exp. Bot. 41, 631–644 10.1093/jxb/41.6.631 [DOI] [Google Scholar]
  81. Vandesompele J., De Preter K., Pattyn F., Poppe B., Van Roy N., De Paepe A., Speleman F. (2002). Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3, RESEARCH0034. 10.1186/gb-2002-3-7-research0034 [DOI] [PMC free article] [PubMed] [Google Scholar]
  82. Varón A., Vinh L. S., Wheeler W. C. (2009). POY version 4: phylogenetic analysis using dynamic homologies. Cladistics 26, 72–85 10.1111/j.1096-0031.2009.00282.x [DOI] [PubMed] [Google Scholar]
  83. Vernoux T., Brunoud G., Farcot E., Morin V., Van den Daele H., Legrand J., Oliva M., Das P., Larrieu A., Wells D., Guédon Y., Armitage L., Picard F., Guyomarc’h S., Cellier C., Parry G., Koumproglou R., Doonan J. H., Estelle M., Godin C., Kepinski S., Bennett M., De Veylder L., Traas J. (2011). The auxin signalling network translates dynamic input into robust patterning at the shoot apex. Mol. Syst. Biol. 7, 508. 10.1038/msb.2011.39 [DOI] [PMC free article] [PubMed] [Google Scholar]
  84. Verrier P. J., Bird D., Burla B., Dassa E., Forestier C., Geisler M., Klein M., Kolukisaoglu U., Lee Y., Martinoia E., Murphy A., Rea P. A., Samuels L., Schulz B., Spalding E. J., Yazaki K., Theodoulou F. L. (2008). Plant ABC proteins – a unified nomenclature and updated inventory. Trends Plant Sci. 13, 151–159 10.1016/j.tplants.2008.02.001 [DOI] [PubMed] [Google Scholar]
  85. Vieten A., Vanneste S., Wisniewska J., Benková E., Benjamins R., Beeckman T., Luschnig C., Friml J. (2005). Functional redundancy of PIN proteins is accompanied by auxin-dependent cross-regulation of PIN expression. Development 132, 4521–4531 10.1242/dev.02027 [DOI] [PubMed] [Google Scholar]
  86. Wang J.-R., Hu H., Wang G.-H., Li J., Chen J.-Y., Wu P. (2009). Expression of PIN genes in rice (Oryza sativa L.): tissue specificity and regulation by hormones. Mol. Plant 2, 823–831 10.1093/mp/ssn088 [DOI] [PubMed] [Google Scholar]
  87. Wheeler W. (1996). Optimization alignment: the end of multiple sequence alignment in phylogenetics? Cladistics 12, 1–9 10.1111/j.1096-0031.1996.tb00189.x [DOI] [Google Scholar]
  88. Wiederstein M., Sippl M. J. (2007). ProSA-web: interactive web service for the recognition of errors in three-dimensional structures of proteins. Nucleic Acids Res. 35, W407–W410 10.1093/nar/gkm290 [DOI] [PMC free article] [PubMed] [Google Scholar]
  89. Wolfe K. H., Gouy M., Yang Y. W., Sharp P. M., Li W. H. (1989). Date of the monocot-dicot divergence estimated from chloroplast DNA sequence data. Proc. Natl. Acad. Sci. U.S.A. 86, 6201–6205 10.1073/pnas.86.16.6201 [DOI] [PMC free article] [PubMed] [Google Scholar]
  90. Wu G., Lewis D. R., Spalding E. P. (2007). Mutations in Arabidopsis multidrug resistance-like ABC transporters separate the roles of acropetal and basipetal auxin transport in lateral root development. Plant Cell 19, 1826–1837 10.1105/tpc.106.048777 [DOI] [PMC free article] [PubMed] [Google Scholar]
  91. Wu X., McSteen P. (2007). The role of auxin transport during inflorescence development in maize (Zea mays, Poaceae). Am. J. Bot. 94, 1745–1755 10.3732/ajb.94.11.1745 [DOI] [PubMed] [Google Scholar]
  92. Yang H., Murphy A. S. (2009). Functional expression and characterization of Arabidopsis ABCB, AUX 1 and PIN auxin transporters in Schizosaccharomyces pombe. Plant J. 59, 179–191 10.1111/j.1365-313X.2009.03856.x [DOI] [PubMed] [Google Scholar]
  93. Yang Y., Hammes U. Z., Taylor C. G., Schachtman D. P., Nielsen E. (2006). High-affinity auxin transport by the AUX1 influx carrier protein. Curr. Biol. 16, 1123–1127 10.1016/j.cub.2006.04.029 [DOI] [PubMed] [Google Scholar]
  94. Yemm A., May S., Williams L., Millner P., Tsurumi S., Moore I., Napier R., Kerr I. D., Bennett M. J. (2004). Structure-function analysis of the presumptive Arabidopsis auxin permease AUX1. Plant Cell 16, 3069–3083 10.1105/tpc.104.024737 [DOI] [PMC free article] [PubMed] [Google Scholar]
  95. Zazímalová E., Murphy A. S., Yang H., Hoyerová K., Hosek P. (2010). Auxin transporters – why so many? Cold Spring Harb. Perspect. Biol. 2, 1–14 10.1101/cshperspect.a001552 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Frontiers in plant science are provided here courtesy of Frontiers Media SA

RESOURCES