Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2012 May 21.
Published in final edited form as: J Invest Dermatol. 2010 Jul 1;130(11):2561–2568. doi: 10.1038/jid.2010.174

The abcc6a Gene is Required for Normal Zebrafish Development

Qiaoli Li 1,*, Sara Sadowski 1,*, Michael Frank 1, ChunLi Chai 2,+, Andras Váradi 3, Shiu-Ying Ho 4, Hong Lou 5, Michael Dean 6, Christine Thisse 2, Bernard Thisse 2, Jouni Uitto 1
PMCID: PMC3357064  NIHMSID: NIHMS376616  PMID: 20596085

Abstract

Pseudoxanthoma elasticum (PXE) is caused by mutations in the ABCC6 gene, which encodes a putative efflux pump, ABCC6. The zebrafish (Danio rerio) has two ABCC6-related sequences. To study the function of abcc6 during zebrafish development, the mRNA expression levels were measured using RT-PCR and in situ hybridization. The abcc6a showed a relatively high level of expression at 5 days post-fertilization (dpf) and the expression was specific to the Kupffer’s vesicles. The abcc6b expression was evident at 6 hpf and remained high up to 8 dpf, corresponding to embryonic kidney proximal tubules. Morpholinos were designed to both genes to block translation and to prevent pre-mRNA splicing. Injection of the abcc6a morpholinos into 1–4 cell zebrafish embryos decreased gene expression by 54 to 81%, and induced a phenotype, cardiac edema and curled tail associated with death at around 8 dpf. Microinjecting zebrafish embryos with full-length mouse Abcc6 mRNA together with the morpholino completely rescued this phenotype. No phenotypic changes were observed when the abcc6b gene morpholino was injected to embryos, with knock-down efficiency of 100%. These results suggest that abcc6a is an essential gene for normal zebrafish development and provide novel insight into the function of ABCC6, the gene mutated in PXE.

Keywords: Zebrafish model, Morpholino “knock-down”, Pseudoxanthoma elasticum

INTRODUCTION

Pseudoxanthoma elasticum (PXE) is a heritable disease characterized by ectopic mineralization of connective tissues, with clinical manifestations primarily in the skin, the eyes, and the blood vessels (for review, see Li et al, 2009; Uitto et al, 2010). PXE has a late onset, diagnosis being made approximately at the age of 13 years on average, yet the tissue involvement is progressive, leading to considerable morbidity and even mortality. The classic forms of PXE, inherited in an autosomal recessive pattern (Ringpfeil et al, 2006), are caused by mutations in the ABCC6 gene, a member of the ATP-binding cassette family C, member 6, which encodes a putative transmembrane transporter protein, ABCC6 (also known as MRP6) (Pfendner et al, 2007; Li et al, 2009). In humans, ABCC6 is primarily expressed in the liver, to a lesser extent in the kidneys, and at very low level, if at all, in tissues clinically affected in PXE. These observations, together with recent grafting and parabiotic experiments (Jiang et al, 2009, 2010), have suggested that PXE is a metabolic disorder, potentially reflecting altered balance within the mineralization/anti-mineralization network in the circulation and in the peripheral connective tissues. Nevertheless, the nature of molecules transported in vivo by ABCC6 is currently unknown, and the precise role of this efflux transporter protein, which resides in the baso-lateral surface of hepatocytes, is unclear.

We have previously developed an Abcc6−/− mouse by targeted ablation of the corresponding mouse gene (Klement et al, 2005). This mouse model recapitulates the genetic, histopathologic, and ultrastructural features of PXE, and has served as a useful model to investigate the pathomechanistic details of PXE. Specifically, these mice demonstrate calcium/phosphate deposition in the peripheral connective tissues in the skin, the eyes, and the cardiovascular system. The drawback of this mouse model is that it takes several months to test the efficacy of different pharmacologic or dietary manipulations on the mineralization process.

As an alternate model system to study ABCC6 function, we have initiated work on the zebrafish (Danio rerio) which has nearly the same complement of ABC genes as mammals (for reviews on zebrafish, see Barut et al, 2000; Chen and Ekker, 2004; Dean and Annilo, 2005; Annilo et al, 2006). Several characteristics favor the choice of zebrafish for genetic screening studies. First, zebrafish are easy to maintain in large numbers in laboratory setting. Secondly, their development is very rapid, the major organs, including the skin, being largely developed in 5–6 days. Finally, each female produces about 50 to 100 embryos per week. The zebrafish also presents with advantages for embryological analysis: its embryos develop externally and are largely transparent for the first 36 hours of development. In addition, the expression of specific genes can be readily manipulated using morpholino-based anti-sense oligonucleotides (Shan, 2009). Thus, in this study, we have performed experiments to investigate the expression of abcc6 genes in zebrafish to determine whether these genes are essential to embryonic development and whether reduction in gene expression by morpholinos confers a visible phenotype.

RESULTS

Analysis of the abcc6 genes in zebrafish

The presence of two ABCC6-related sequences, abcc6a (ENSDART00000065433) and abcc6b (ENSDART00000042812), was discovered by analysis of the on-line gene database (Ensembl Database), and these two genes were mapped to zebrafish chromosomes 6 and 3, respectively.

The abcc6a gene in zebrafish consists of 33 exons ranging from 3 to 311 bp in size (Fig. 1a) and the predicted amino acid sequence of the zebrafish abcc6a protein contains 1529 amino acids (Fig. 1b). The abcc6b gene consists of 32 exons ranging from 6 to 311 bp in size (Fig. 1a) and the predicted protein contains 1528 amino acids (Fig. 1b). The positions of the conserved protein sequences for nucleotide-binding folds (NBF1 and NBF2), the three transmembrane spanning domains (TMD0, TMD1, and TMD2) consisting of 5, 6 and 6 transmembrance segments, respectively, as well as those for Walker A, ABC signature, and Walker B motifs were identified in the protein sequence (Fig. 1b) (Tusnády and Simon, 1998, 2001). The two abcc6 proteins in zebrafish have ~70% sequence homology at the amino acid sequence level. Comparison of the zebrafish abcc6a protein with other ABCC6 orthologues revealed 47% identity to human, and 45% identity to both mouse and rat. Comparison of the zebrafish NBF1 showed 65% identity to human NBF1, and 61% identity to mouse and rat NBF1. Comparison of the zebrafish NBF2 showed 58% identity to human NBF2 and 57% identity to mouse and rat NBF2.

Figure 1. Schematic representation of the zebrafish abcc6 genes and amino acid sequence of the zebrafish abcc6 proteins.

Figure 1

Open in a new tab

(a) The abcc6a gene consists of 33 exons and abcc6b consists of 32 exons numbered on the top, and the coding segments for transmembrane domains (TMDs) and nucleotide-binding folds (NBFs, dark green) are underlined. Note the location corresponding to the two morpholinos (MO1 and MO2) used in this study. (b) Amino acid sequence of zebrafish abcc6 proteins predict the presence of membrane spanning helices (in red) and nucleotide-binding folds (underlined). Note the presence of Walker A and B motifs (bold) and the ABC signature (blue).

We performed a phylogenetic analysis to determine the relationship between zebrafish abcc6 and the other members of the ABCC subfamily, including ABCC1, ABCC2, ABCC3 and ABCC10 proteins, by constructing a neighbor-joining phylogenetic tree (Fig. 2). The zebrafish abcc6 proteins are most closely related to the Tetraodon nigroviridis and Fugu rubripes Abcc6 proteins. A cluster of ABCC6 subfamily included the zebrafish abcc6a protein, a finding supported by high bootstrap values. Therefore, although the zebrafish abcc6 genes have diverged considerably from the mammalian genes, it is an ABCC6 ortholog. Collectively, zebrafish abcc6 genes have a high degree of conservation as compared to corresponding vertebrate genes, and critical functional elements of the protein, including the NBFs, are conserved.

Figure 2. Phylogenetic tree of the zebrafish abcc6 proteins.

Figure 2

Open in a new tab

The phylogenetic relationship between zebrafish abcc6 and the other members of the ABCC6 subfamily estimated by the neighbor-joining method. The bar indicates 10% divergence and percent bootstrap values out of 1000 replications are indicated at the nodes.

Developmental expression of zebrafish abcc6a and abcc6b by RT-PCR and ISH

Zebrafish embryos were collected during the first eight days of development and abcc6a and abcc6b mRNA expression profiles were determined by RT-PCR. Low level of expression of the abcc6a gene was detected during the first four days post-fertilization (dpf) (Fig. 3a). However, a drastic increase on the fifth dpf was noted (Fig. 3a). abcc6b gene expression at mRNA level was detected at 6 hpf and remain high thereafter (Fig. 3a).

Figure 3. Temporal and spatial expression of abcc6a and abcc6b expression in normal zebrafish embryos.

Figure 3

Open in a new tab

(a) Zebrafish embryos were collected on 0 hr, 6 hr and 1– 8 days post fertilization (dpf), and total RNA was isolated and cDNA prepared. mRNA levels were quantified using RT-PCR with specific primer pairs. The level of expression was corrected by the level of β-actin in the same RNA preparations. (b) In situ hybridization revealed abcc6a expression in the Kupffer’s vesicles and tail bud. (c) In situ hybridization revealed abcc6b gene expression in the EVL and embryonic kidney proximal straight tubules.

To determine the spatial expression of abcc6 whole mount in situ hybridization (ISH) was performed using probes specific for abcc6a and abcc6b (Fig. 3). ISH using an antisense RNA probe for abcc6a gene showed expression in forerunner cells at gastrulation, then in the Kupffer’s vesicle (which derives from the forerunner cells) as well as in the tail bud. Specific expression in these regions is observed during somitogenesis stages (Fig. 3b). ISH using an antisense probe for abcc6b gene also demonstrated a specific expression pattern. The most prominent site of expression corresponds to the arterior part of the embryonic kidney proximal straight tubule (Wingert et al, 2007). Another site of expression is far less intense but specific in the cells of the enveloping layer (EVL) at gastrula stage (Fig. 3c).

Morpholino “knock-down” of abcc6a expression

To determine whether the zebrafish abcc6a gene is essential for embryonic development or might confer a visible phenotype, two morpholino oligonucleotides were designed to correspond to abcc6a sequences: MO1 corresponds to the sequence including the ATG translation initiation site and extending 19 bp upstream to the 5′ untranslated region (Fig. 1a); MO2 was placed at the splice donor site at exon 7-intron 7 border (Fig. 1a). Injection of the morpholinos into 1–4 cell zebrafish embryos was performed, followed by monitoring for viability, morphology, and mRNA expression levels. With both morpholino oligonucleotides, there was a significant decrease in abcc6a mRNA expression levels. Specifically, there was a 54% decrease with the MO1 and an 81% decrease with the MO2 at 5 dpf. The efficiency of the splice site morpholino, MO2, was also monitored by analysis of splicing using PCR amplification of abcc6a exons 7 and 8 junction of the injected zebrafish embryo cDNA (Fig. 4a). This approach utilizing a forward primer on exon 7 and a reverse primer on exon 8 revealed that most of the pre-mRNA species were not appropriately spliced and retained the 108 bp intron 7 in the sequence. Injection with the same amount of standard control morpholino was performed as control which did not alter the abcc6a mRNA splicing (not shown). Collectively, these observations indicate that the newly designed morpholinos effectively downregulated the expression of the abcc6a gene expression at the mRNA level.

Figure 4. “Knock-down” of abcc6a and abcc6b expression by splice site morpholinos.

Figure 4

Open in a new tab

The consequences of MO2, which is placed on the exon 7/intron 7 border on abcc6a mRNA splicing, on the exon 18/intron 18 border on abcc6b mRNA splicing were determined by RT-PCR. The results show retention of intron 7 (282 bp fragment) in the majority of mRNA transcripts as compared to normally transcribed control (174 bp) when abcc6a MO2 was injected to embryos (a) A 122 bp fragment (intron 18) was retained in the majority of mRNA transcripts (421 bp) as compared to normally transcribed control (299 bp) when abcc6b MO2 was injected to embryos (b).

Phenotypic consequences of morpholino “knock-down” and mRNA rescue

The consequences of the “knock-down” of abcc6a expression were followed by survival rate and morphologic observations of the injected embryos (Table 1). The changes in morpholino-injected embryos were compared with those embryos injected with phenol red dye or a standard control morpholino (scMO) which has no target and no biological function in zebrafish as controls. Injection of phenol red or standard control morpholino did not cause any changes and the embryos were indistinguishable from the uninjected controls (Fig. 5 and Table 1). Observation of 1 dpf embryos suggested a shortening of the body, delay of the development of the head, decreased tail length, and curving of the caudal part of the fish (Fig. 5a). At 3 dpf these changes were more prominent and development of cardiac edema was noted (Fig. 5b). On 5 dpf, the cardiac edema was very prominent, and this was more severe in fish that were receiving MO2 (Fig. 5c), consistent with more efficient suppression of the corresponding mRNA expression. The treated embryos became incapacitated and eventually died around 8 dpf (not shown).

Table 1.

Survival and development of phenotype in zebrafish injected with abcc6a or abcc6b morpholinos1)

Experimental Group (Morpholino) No of fish 3 dpf3)
 5 dpf3)
Survival (%) Phenotype (%) Survival (%) Phenotype (%)
abcc6a 191 52* 83* 45* 63*
abcc6b 126 77 0 77 0
scMO2) 177 79 0 77 0
uninjected control 207 87 0 84 0
Open in a new tab
1)

This is a representative experiment in which all groups were followed in parallel. Similar results were obtained in >10 additional experiments with the same design.

2)

scMO, standard control morpholino with no biological function and no target sequence in the zebrafish genome (Robu et al, 2007).

3)

Statistical significance between the abcc6a and scMO groups (Fisher’s exact test: *p<0.0001). (For details, see Materials and Methods).

Figure 5. The morpholino “knock-down” of abcc6 expression.

Figure 5

Open in a new tab

Phenotypic appearance of zebrafish embryos injected with morpholinos at 1–4 cell stage. (a) 1 dpf; (b) 3 dpf; (c) 5 dpf. The cardiac edema is indicated by arrows. Control: Standard control morpholino-injected embryos as control.

To examine the specificity of the effects of morpholino “knock-down”, mRNA rescue experiments were performed. In these experiments, full-length mouse Abcc6 mRNA was injected to the embryos together with MO2 which was shown to result in the most severe phenotype. Co-injection of the Abcc6 mRNA together with MO2 into 1–4 cell embryos completely reversed the phenotypic effects of the morpholino in each embryo, and at 5 dpf the rescued embryos had essentially the same morphology as control embryos (Fig. 6). These observations attest to the critical importance of abcc6a in the development of zebrafish and also emphasize the specificity of the morpholinos used to arrest the abcc6a expression.

Figure 6. mRNA rescue.

Figure 6

Open in a new tab

Co-injection of full-length mouse Abcc6 mRNA fully rescued the phenotype at 5 dpf.

Morpholino “knock-down” of abcc6b expression and lack phenotypic consequences

A splice donor site morpholino was designed to target the abcc6b gene. This morpholino was placed at exon 18-intron 18 border (Fig. 1a.). Injection of the morpholino into 1–4 cell zebrafish embryos was performed, followed by survival rate, pre-mRNA splicing analysis and morphology observation. The efficiency of the morpholino was monitored by analysis of splicing using PCR amplification of abcc6b exons 18 and 19 of the injected embryo cDNA at 3 dpf (Fig. 4b). The result demonstrated that pre-mRNA (100%) was not appropriately spliced and retained the 122 bp intron 18 in the sequence. However, the abcc6b knock-down zebrafish did not reveal any morphological changes when compared to uninjected control or standard control morpholino-injected embryos at 1, 3 and 5 dpf (Fig. 5a–c).

DISCUSSION

The human ABCC6 gene encodes a putative transmembrane efflux transporter protein, ABCC6, a member of the family of ATP-binding cassette (ABC) proteins (Borst and Elferink, 2002; Dean, 2005; Szakács et al, 2008). Mutations in this gene have been found to cause PXE (Pfendnder et al, 2007). In humans, the ABCC6 gene is primarily expressed in the liver and to a lesser extent in the kidneys, but at a very low level, if at all, in tissues clinically affected by PXE (Belinsky and Kruh, 1999; Scheffer et al, 2002). This situation has led to a dilemma concerning the pathomechanism of PXE, and two contrasting hypotheses to explain the pathogenesis of mineralization have been proposed. ‘The metabolic hypothesis’ postulates that absence of functional ABCC6 activity, primarily in the liver, results in deficiency of circulating factor(s) that are physiologically required to prevent aberrant mineralization under normal calcium and phosphate homeostatic conditions (Uitto et al, 2001; Li et al, 2009). ‘The PXE cell hypothesis’ postulates that lack of ABCC6 expression in the resident cells in affected tissues, such as skin fibroblasts or arterial smooth muscle cells, alters their biosynthetic expression profile and cell–cell and cell–matrix interactions associated with changes in the proliferative capacity (Passi et al, 1996; Quaglino et al, 2000). In support of the metabolic hypothesis, there are several both clinical and experimental observations in patients with PXE as well as in the Abcc6−/− mouse that serves as a transgenic model for human PXE (Li et al, 2009).

In the present study, a real-time RT-PCR method was established to measure abcc6a mRNA expression levels, and to demonstrate the presence of abcc6a mRNA in various zebrafish tissues. “Knock-down” of abcc6a using morpholino oligonucleotides showed a severe, visible phenotype, and accumulation of fluid around the heart of the developing zebrafish. The specificity of the effects of morpholinos was attested to by the fact that co-injection of full length mouse Abcc6 mRNA fully rescued the phenotype. Abcc6a expression was shown to be very low in zebrafish heart tissue but relatively high in other tissues that appeared normal by morphologic observations. This finding is similar to PXE in humans and mice where the clinically affected tissues do not have a significant expression of the corresponding protein. This finding could be taken as further support for the “metabolic hypothesis.” Specifically, there is the possibility that the lack of functional abcc6a activity in the liver, kidney or intestines of the zebrafish, which express the highest level of abcc6a, results in the deficiency of some, currently undefined factors which are required for proper development of the embryo.

While the abcc6a morpholino “knock-down” clearly elicited a phenotype during the early stages of zebrafish development, the relationship of these findings to PXE, caused by inactivation of the ABCC6 efflux transporter, are not clear. Specifically, the characteristic pathogenic consequence of the absence of ABCC6 activity in patients with PXE or in Abcc6−/− mice, which recapitulate the features of PXE (Klement et al, 2005; Gorgels et al, 2005), is ectopic mineralization of soft connective tissues. Attempts to find ectopic mineralization in developing zebrafish treated with the morpholinos were unyielding. It should be noted, however, that connective tissue mineralization in PXE and its mouse model, Abcc6−/−, is not noted at birth but develops later in life. The clinical diagnosis of PXE in humans is usually made in the teens or early twenties of affected individuals. The earliest signs of mineralization in Abcc6−/− mice are evident at 5–6 weeks, shortly after weaning (Jiang et al, 2007). While zebrafish is fully developed at ~5–6 dpf, the morpholino phenotype resulted in death of zebrafish at 8 dpf and the mineralization phenotype, if developmentally corresponding to human or mouse pathogenesis of PXE, might occur much later.

It should also be noted that PXE is an autosomal recessive disease, although heterozygous carriers of a mutation in one of the ABCC6 alleles have been suggested to demonstrate subclinical findings in the eyes in terms of angioid streaks and presence of subtle histopathologic changes in the skin without overt cutaneous phenotype (Martin et al, 2007, 2008). The morpholino “knock-down” resulted in 54–81% reduction in abcc6a expression, as determined at the mRNA level. Thus, this zebrafish model did not display a full “knock-out” of the abcc6a gene, and the expected phenotype might be more akin to that noted in heterozygous carriers of PXE. Nevertheless, our observations attest to the critical importance of the abcc6a gene expression in zebrafish development. The discordance between the human, mouse and zebrafish phenotypes also raises the possibility that the ABCC6 gene product might have different biological functions depending on the species, or that unlike other members of the ABC family, this transmembrane protein is not acting as a transporter in zebrafish. If this is the case, the abcc6 knock-down in zebrafish is not a good model for PXE, which is characterized by a chronic, progressive and late-onset mineralization process.

In summary, this study has provided novel insight into the role of the ABCC6 gene harboring mutations in PXE. In zebrafish, this gene appears to be critical in the early embryonic development, but the direct relevance of these observations to human PXE remains to be explored.

METHODS AND MATERIALS

Identification and sequence analysis of ABCC6-related genes in zebrafish

The Ensambl database was searched for human ABCC6-related genes; two genes, in chromosomes 6 and 3, were identified and designated as abcc6a and abcc6b, respectively. The predicted zebrafish full-length abcc6 amino acid sequences, as well as various subdomain sequences, were aligned with human (Homo sapiens), mouse (Mus musculus) and rat (Rattus rattus) sequences using the ClustalW program (http://www.ebi.ac.uk/clustalw/).

Phylogenetic analysis

The genomic sequences of abcc6 loci were extracted from the Ensembl Database. The predicted zebrafish full length abcc6a and abcc6b amino acid sequence was aligned with Tni (Tetraodon nigroviridis), Fru (Fugu rubripes), Gga (Gallus gallus), Hsa (Homo sapiens), Rat (Rattus rattus) and Mus (Mus musculus) using ClustalW (http://www.ebi.ac.uk/clustalw/). The Neighbor-Joining (NJ) method with the standard Kimura two-parameter model was used for the construction of the phylogenetic tree using the Molecular Evolution Genetics Analysis software (MEGA) version 3.1 (Kumar and Gadagkar, 2001). The statistical reliance of NJ tree branches were evaluated using 1,000 bootstrap samples. The divergence was determined by the distance matrix method, and the pairwise distance among the zebrafish, human, mouse, rat, and chicken ABCC6 orthologs was estimated.

Maintenance of zebrafish

Wild-type zebrafish were maintained under standard conditions at 28.5°C and the zebrafish embryos were maintained also at 28.5°C in a special embryo medium. All animals were housed in the zebrafish facility of Thomas Jefferson University and were cared for and used in accordance with University Institutional Animal Care and Use Committee guidelines.

Morpholinos

Morpholino oligonucleotides were obtained from Gene Tools, LLC (Corvalis, OR). The morpholino oligomer sequences were from 5′ to 3′, as follows (Brackets around morpholino sequences, exonic sequences in capital letters, and intronic sequences in lower case letters):

  • abcc6a MO1: ATG site morpholino

  • CTCAGGACCAGACGAGTGA[(ATG)GATACCTTTTGCAGTCTAAGTG]

  • abcc6a MO2: Splice donor site morpholino

  • abcc6b MO2: Splice donor site morpholino

  • GCAACAGAGATTGG[AGAGAAGgtgcataatatggattag]tttttatgtat

  • Standard control morpholino (antisense) (scMO):

  • CCTCTTACCTCAGTTACAATTTATA

  • AGATCCTCTTCTGGTGGTT[CAGCGGgtaggcaattaaaatgatt]ttgaatacta

Injection of the morpholinos (22.5 ng of abcc6a MO1; 15.1 ng of abcc6a MO2; 10 ng of abcc6b MO2) into 1–4 cell embryos was performed and the embryos were followed for viability, morphology and mRNA expression levels. Embryos from the same matings were injected with an equal volume of phenol red/nuclease-free water mixture as a control and some embryos served as uninjected controls.

Total RNA isolation and cDNA synthesis

Zebrafish embryos were collected on 1–5 days post-fertilization and tissues including skin, eye, heart, liver, kidney and intestines were dissected from 3-month old adult zebrafish. Embryos and isolated organs were disintegrated by passing through a 20 gauge needle, and total RNA was prepared using TRizol reagent (Invitrogen). To remove contaminating genomic DNA, RNase-free DNase I digestion was carried out (Fisher Scientific, St. Louis, MO). One microgram of total RNA was reverse transcribed using Superscript III First-Strand cDNA synthesis kit (Invitrogen) according to the manufacturer’s protocol. Controls were performed by omitting the reverse transcriptase enzyme. All cDNAs were stored at −20° C for future use.

PCR amplication of cDNA

Abcc6 specific primers were designed using Primer 3 software according to the zebrafish abcc6 sequences from the Ensembl Database (http://www.ensembl.org/index.html). The abcc6a primers (Fwd: 5′-TTGACCCTCTATGGGACTGG-3′, Rev: 5′–GGACCCACAGGTAGATGCAC–3′) were placed on exons 1 and 2 of the corresponding mRNA to amplify a 111 bp fragment cDNA of zebrafish abcc6a gene. The abcc6b primers (Fwd: 5′-TCACGTGGTACACAGAACATCCAG-3′; Rev: 5′-AAGGCTACGGATAATAGGGCTCAG-3′) were placed on exons 2 and 3 of the corresponding mRNA to amplify a 287 bp fragment cDNA of zebrafish abcc6b gene. All RNA analyses used zebrafish β-actin as the housekeeping gene (Fwd: 5′-ATCTGGCACCACACCTTCTACAATG; Rev: 5′-GGGGTGT TGAAGGTCTCAAACATGAT). PCR was performed using Qiagen Taq polymerase and Q buffer (Qiagen, Valencia, CA, USA), according to the manufacturer’s instructions. The PCR reaction contained 100 ng cDNA as template and 50 ng of each primer in a final volume of 25 μl. Cycling conditions for all primer pairs were 94°C for 5 min, followed by 35 cycles of 94°C for 1 min; 58°C for 1 min; 72°C for 1 min; and finally 72°C for 10 min.

Analysis of the splice site morpholinos

The efficiency of the splice site morpholinos was monitored by analysis of splicing using PCR amplification of abcc6a exons 7 and 8, and abcc6b exons 18 and 19, of the injected zebrafish embryo cDNA. The abcc6a primers (Fwd: 5′-GCATGTCCTGTTCAAGATG-3′ on exon 7; Rev: 5′-gctttgctgtccattcttcc-3′ on exon 8) were used to amplify a 174 bp cDNA fragment and 282 bp gDNA fragment. The abcc6b primers (Fwd: 5′-CTCTGTGGGTTATGTTCCTCAGCA-3′ on exon 18; Rev: 5′ – TGTGTTGACCCACATGTGCATC-3′ on exon 19) were used to amplify a 299 bp cDNA fragment and 421 bp gDNA fragment. The relative intensity of the bands was quantified using ImageQuant version 5.0 software (Molecular Dynamics, Sunnyvale, CA).

Whole mount in situ hybridization (ISH)

ISH was performed as described previously (Thisse and Thisse, 2008). Collected zebrafish embryos were fixed in 4% paraformaldehyde before hybridization. To synthesize digoxigenin-labeled antisense RNA probes, abcc6a in pCR2.1 vector and abcc6b in pSPT18 vector were linearized by BamHI and HindIII, respectively, and then transcribed with T7 RNA polymerase. After hybridization, detection was performed with an anti-DIG antibody coupled to alkaline phosphatase. Hybridization with sense probes was performed as controls.

mRNA rescue experiments

Capped, full-length mouse Abcc6 mRNA was synthesized from a mouse cDNA expression vector using the mMessage mMachine kit (Ambion, Austin, TX). The mRNA (9 ng) was microinjected into 1–4 cell stage embryos either alone or in combination with a morpholino and the embryos were followed for viability and morphology.

Statistical analyses

Statistical analyses were conducted using SAS 9.2 (SAS Institute, Gary, NC). Risk differences and 5% confidence intervals were calculated between abcc6a and scMO injected groups with regard to survival and phenotype at 3 dpf and 5 dpf separately. Fisher’s exact test was used to determine differences between proportions because of the presence of cells with zero percent survival or phenotype. Adjustment for multiple comparisons was performed using False Discover Rate, which did not change the p-values appreciably, as the largest raw p-value was 3.84E-08.

Acknowledgments

The authors thank HsingYin Liu and Reid Oldenburg for technical assistance; Terry Hyslop and Jocelyn Andrel (Division of Biostatistics, Department of Pharmacology and Experimental Therapeutics, Thomas Jefferson University, and GianPaolo Guercio and Carol Kelly for help in manuscript preparation. These studies were supported by DHHS, NIH/NIAMS Grants R01 AR28450 and R01 AR55225 (to JU) by OTKA NI-68950 of Hungary (to AV), and the University of Virginia (to CT and BT).

Abbreviations

PXE

pseudoxanthoma elasticum

MO

morpholino

scMO

standard control morpholino

hpf and dpf

hours and days post-fertilization, respectively

Footnotes

CONFLICT OF INTEREST

The authors have no conflict of interest.

References

  1. Annilo T, Chen ZQ, Shulenin S, Costantino J, Thomas L, Lou H, et al. Evolution of the vertebrate ABC gene family: Analysis of gene birth and death. Genomics. 2006;88:1–11. doi: 10.1016/j.ygeno.2006.03.001. [DOI] [PubMed] [Google Scholar]
  2. Barut BA, Zon LI. Realizing the potential of zebrafish as a model for human disease. Physiol Genomics. 2000;13:49–51. doi: 10.1152/physiolgenomics.2000.2.2.49. [DOI] [PubMed] [Google Scholar]
  3. Belinsky MG, Kruh GD. MOAT-E (ARA) is a full length MRP cMOAT subfamily transporter expressed in kidney and liver. Br J Cancer. 1999;80:1342–1349. doi: 10.1038/sj.bjc.6690527. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Borst P, Elferink RO. Mammalian ABC transporters in health and disease. Annu Rev Biochem. 2002;71:537–592. doi: 10.1146/annurev.biochem.71.102301.093055. [DOI] [PubMed] [Google Scholar]
  5. Chen C, Ekker SC. Zebrafish as a genomics research model. Curr Pharmaceut Biotech. 2004;5:409–413. doi: 10.2174/1389201043376652. [DOI] [PubMed] [Google Scholar]
  6. Dean M. The genetics of ATP-binding cassette transporters. Methods Enzymol. 2005;400:409–429. doi: 10.1016/S0076-6879(05)00024-8. [DOI] [PubMed] [Google Scholar]
  7. Dean M, Annilo T. Evolution of the ATP-binding cassette (ABC) transporter superfamily in vertebrates. Annu Rev Genom Human Genet. 2005;6:123–142. doi: 10.1146/annurev.genom.6.080604.162122. [DOI] [PubMed] [Google Scholar]
  8. Gorgels TG, Hu X, Scheffer GL, van der Wal AC, Toonstra J, de Jong PT, et al. Disruption of Abcc6 in the mouse: Novel insight in the pathogenesis of pseudoxanthoma elasticum. Hum Mol Genet. 2005;14:1763–1773. doi: 10.1093/hmg/ddi183. [DOI] [PubMed] [Google Scholar]
  9. Jiang Q, Li Q, Uitto J. Aberrant mineralization of connective tissues in a mouse model of pseudoxanthoma elasticum: Systemic and local regulatory factors. J Invest Dermatol. 2007;127:1392–1402. doi: 10.1038/sj.jid.5700729. [DOI] [PubMed] [Google Scholar]
  10. Jiang Q, Endo M, Dibra F, Wang K, Uitto J. Pseudoxanthoma elasticum is a metabolic disease. J Invest Dermatol. 2009;129:348–354. doi: 10.1038/jid.2008.212. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Jiang Q, Oldenburg R, Otsuru S, Grand-Pierre A, Horwitz EM, Uitto J. Parabiotic heterogenetic pairing of Abcc6−/−/Rag1−/− mice and their wild-type counterparts halts ectopic mineralization in a murine model of pseudoxanthoma elasticum. Am J Pathol. 2010;176:1855–1862. doi: 10.2353/ajpath.2010.090983. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Klement JF, Matsuzaki Y, Jiang Q, Terlizzi J, Choi HY, Fujimoto N, et al. Targeted ablation of the ABCC6 gene results in ectopic mineralization of connective tissues. Mol Cell Biol. 2005;25:8299–8310. doi: 10.1128/MCB.25.18.8299-8310.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Kumar S, Gadagkar SR. Disparity index: a simple statistic to measure and test the homogeneity of substitution patterns between molecular sequences. Genetics. 2001;158:1321–1327. doi: 10.1093/genetics/158.3.1321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Li Q, Jiang Q, Pfendner E, Váradi A, Uitto J. Pseudoxanthoma elasticum: Clinical phenotypes, molecular genetics and putative pathomechanisms. Exp Dermatol. 2009;18:1–11. doi: 10.1111/j.1600-0625.2008.00795.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Martin L, Chassaing N, Delaite D, Estéve E, Maître F, Le Bert M. Histological skin changes in heterozygote carriers of mutations in ABCC6, the gene causing pseudoxanthoma elasticum. J Eur Acad Dermatol Venereol. 2007;21:368–373. doi: 10.1111/j.1468-3083.2006.01940.x. [DOI] [PubMed] [Google Scholar]
  16. Martin L, Maître F, Bonicel P, Daudon P, Verny C, Bonneau D, et al. Heterozygosity for a single mutation in the ABCC6 gene may closely mimic PXE: consequences of this phenotype overlap for the definition of PXE. Arch Dermatol. 2008;144:301–306. doi: 10.1001/archderm.144.3.301. [DOI] [PubMed] [Google Scholar]
  17. Passi A, Albertini R, Baccarani Contri M, de Luca G, de Paepe A, Pallavicini G, et al. Proteoglycan alterations in skin fibroblast cultures from patients affected with pseudoxanthoma elasticum. Cell Biochem Funct. 1996;14:111–120. doi: 10.1002/cbf.653. [DOI] [PubMed] [Google Scholar]
  18. Pfendner EG, Vanakker O, Terry SF, Vourthis S, McAndrew P, McLain MR, et al. Mutation detection in the ABCC6 gene and genotype-phenotype analysis in a large international case series affected by pseudoxanthoma elasticum. J Med Genet. 2007;44:621–628. doi: 10.1136/jmg.2007.051094. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Quaglino D, Boraldi F, Barbieri D, Croce A, Tiozzo R, Pasquali Ronchetti I. Abnormal phenotype of in vitro dermal fibroblasts from patients with pseudoxanthoma elasticum (PXE) Biochim Biophys Acta. 2000;1501:51–62. doi: 10.1016/s0925-4439(00)00007-7. [DOI] [PubMed] [Google Scholar]
  20. Ringpfeil F, McGuigan K, Fuschel L, Kozic H, Larralde M, Lebwohl M, et al. Pseudoxanthoma elasticum is a recessive disease characterized by compound heterozygosity. J Invest Dermatol. 2006;126:782–786. doi: 10.1038/sj.jid.5700115. [DOI] [PubMed] [Google Scholar]
  21. Robu ME, Larson JD, Nasevicius A, Beiraghi S, Brenner C, Farber SA, Ekker SC. p53 activation by knock down technologies. PLos Genet. 2007;3:e78. doi: 10.1371/journal.pgen.0030078. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Scheffer GL, Hu X, Pijnenborg AC, Wijnholds J, Bergen AA, Scheper RJ. MRP6 (ABCC6) detection in normal human tissues and tumors. Lab Invest. 2002;82:515–518. doi: 10.1038/labinvest.3780444. [DOI] [PubMed] [Google Scholar]
  23. Shan G. RNA interference as gene knockdown technique. Int J Biochem Cell Biol. 2009 doi: 10.1016/j.biocel.2009.04.023. Epub. [DOI] [PubMed] [Google Scholar]
  24. Szakács G, Váradi A, Ozvegy-Lazka C, Sarkadi B. The role of ABC transporters in drug absorption, distribution, metabolism, excretion and toxicity (ADME-Tox) Drug Discov Today. 2008;13:379–393. doi: 10.1016/j.drudis.2007.12.010. [DOI] [PubMed] [Google Scholar]
  25. Thisse C, Thisse B. High resolution in situ hybridization on whole-mount zebrafish embryo. Nat Protoc. 2008;3:59–69. doi: 10.1038/nprot.2007.514. [DOI] [PubMed] [Google Scholar]
  26. Tusnády GE, Simon I. Principles governing amino acid composition of integral membrane proteins: application to topology predicition. J Mol Biol. 1998;283:489–506. doi: 10.1006/jmbi.1998.2107. [DOI] [PubMed] [Google Scholar]
  27. Tusnády GE, Simon I. The HMMTOP transmembrane topology prediction server. Bioinformatics. 2001;17:849–850. doi: 10.1093/bioinformatics/17.9.849. [DOI] [PubMed] [Google Scholar]
  28. Uitto J, Pulkkinen L, Ringpfeil F. Molecular genetics of pseudoxanthoma elasticum: a metabolic disorder at the environment-genome interface? Trends Mol Med. 2001;7:13–17. doi: 10.1016/s1471-4914(00)01869-4. [DOI] [PubMed] [Google Scholar]
  29. Uitto J, Li Q, Jiang Q. Pseudoxanthoma elasticum: molecular genetics and putative pathomechanisms. J Invest Dermatol. 2010;130:661–70. doi: 10.1038/jid.2009.411. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Wingert RA, Selleck R, Yu J, Song HD, Chen Z, Song A, et al. The cdx genes and retinoic acid control the positioning and segmentation of the zebrafish pronephos. Plos Genet. 2007;3:1022–1938. doi: 10.1371/journal.pgen.0030189. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES