Skip to main content
Springer logoLink to Springer
. 2011 Dec 9;44(3):761–767. doi: 10.1007/s11255-011-0102-z

Lack of evidence for increased level of circulating urothelial cells in the peripheral blood after transurethral resection of bladder tumors

Artur A Antoniewicz 1, Agnieszka Paziewska 2, Michal Mikula 3, Krzysztof Goryca 3, Michalina Dabrowska 3, Slawomir Poletajew 1, Andrzej Borowka 1, Jerzy Ostrowski 2,3,✉
PMCID: PMC3358538  PMID: 22160796

Abstract

Purpose

Aggressive intervention against the bladder wall during transurethral resection of bladder tumors (TURBT) causes damage and leakage from blood vessels to the bladder lumen. The aim of this study was to determine whether TURBT could increase the level of circulating urothelial cells.

Methods

Expression of tumor markers, discriminative for nucleated blood cells and urothelium, was evaluated by quantitative (q) RT-PCR on RNA isolated from peripheral blood samples of 51 patients who underwent TURBT for ≥cT1c bladder tumors.

Results

Four of 14 studied genes, epidermal growth factor receptor (EGFR), Collagen α-1(I) chain, Mast/stem cell growth factor receptor (KIT) and CD47, exhibited significant differences in gene expression between controls and cancer patients. While TURBT did not significantly increase the number of PCR-positive results of any transcripts, positive RT-PCR detection for EGFR was significantly less frequent on day 30 compared to results obtained before surgery.

Conclusions

Although the results of our study do not provide evidence for increased tumor cell release into the peripheral blood after TURBT, they seem to indicate that EGFR mRNA measurement in the blood may provide useful information for urologists.

Electronic supplementary material

The online version of this article (doi:10.1007/s11255-011-0102-z) contains supplementary material, which is available to authorized users.

Keywords: Bladder tumor, Circulating tumor cells, Gene expression, mRNA, RT-PCR

Introduction

Most bladder cancers (BCa) are derived from the uroepithelium. Tumors confined to the bladder lining are regarded as non-invasive, while those that invade the bladder muscle are invasive. Transurethral resection of the bladder tumor via a wire loop (TURBT) remains a standard procedure for the diagnosis of BCa, as well as for the treatment of non-muscle invasive tumors [1].

While circulating tumor cells (CTCs) in the peripheral blood have been reported in patients with several cancer types, including BCa [2–9], it is well documented that diagnostic and therapeutic procedures [6, 9] can additionally release dysplastic cells from the tumor and may affect the level of CTCs in the peripheral blood. In turn, dissemination of tumor cells from locally advanced tumors may significantly increase risk for metastatic disease, although only limited number of CTCs may colonize distant sites propagating the metastases.

An optimal method for detecting CTCs should be sufficiently specific and sensitive with the most popular methods utilizing polymerase chain reaction (PCR)-based analyses. They allow detection of expression of so-called epithelium-specific genes, which are expressed in cancer cells but not in nucleated cells of the blood. While the detection of mRNA markers specific for CTCs by reverse transcription (RT)-PCR is sensitive, its specificity may significantly differ depending on the marker. Therefore, marker selection is considered vital for a proper analysis of CTCs.

Here, we asked the question whether the electroresection of a bladder tumor, which uses high pressure of washing fluid, may induce a spread of cells from resected tissues into blood stream leading to the increase level of circulating urothelial cells in the peripheral blood. To answer it, we used quantitative RT-PCR to amplify the transcripts of selected genes, which might be specific and sensitive indicators of circulating urothelial cells.

Methods

Patients

A total number of 51 patients (43 men and 8 women; mean age 67.5 years, range 34–89) with primary or recurrent urothelial BCa submitted to TURBT between April 2009 and May 2010 were prospectively selected for the study. Pathological staging was as follows: pTa—2 pts (2 patients; 4%), pT1—26 pts (26 patients; 51%), pT2—11 pts (11 patients; 21%), while in 12 cases (24%) primary tumor stage could not have been definitely assessed (pT ≥1; lack of muscularis propria in the specimen). The grade of the tumor was defined as G1, G2 and G3 according to 1973 WHO classification in 8 (16%), 25 (49%) and 18 (35%) cases, respectively. Details on patient’s age, sex and pathological diagnosis are given in the Online Resource 1. The control group consisted of 32 healthy volunteers, 17 among them were recruited from the laboratory staff and 15 were selected among individuals who underwent a screening colonoscopy with no known history of any malignancy. The study protocol was approved by the Ethics Committee, and all patients signed informed consent before inclusion.

Urothelial-specific genes

Literature searching [10–19] allowed selection of the following genes: uroplakin 2 (UPK2), EGFR, α-type platelet-derived growth factor receptor (PDGFRA), Insulin-like growth factor-binding protein 7 (IGFBP7), Sorting nexin-16 (SNX16), TP53, KIT, Vascular endothelial growth factor A (VEGFA), CD47 and telomerase reverse transcriptase (TERT), which expression was reported previously to be highly specific and sensitive markers for the detection of CTCs, including circulating urothelial cells. In addition, computation of the fold change of transcript levels between nucleated blood cells and urothelium was performed in searching for new candidate biomarkers of CTCs. Appropriate data were imported from the GSE4251 [20] dataset, which contained gene expression measurements for blood cells analyzed in three healthy subjects, and from the GSE3167 [21] and GSE5287 [22] datasets, which contained measurements of normal bladder and various dysplastic lesions. Datasets were deposited in the Gene Expression Omnibus [23] database and represented measurements performed on Affymetrix® Human Genome U133A and U133A 2.0 platforms, respectively. All imported measurements were processed with the GCRMA algorithm [24] and then averaged and sorted according to minimal fold change between any given blood cell population (white blood cells, peripheral blood monocytes and T lymphocytes) and urothelia. Calculation basing on the highest minima transcript levels has selected several urothelial-specific genes (not shown). Of them, four genes, COL1A1, COL3A1, KRT7 and AGR2, were considered as potential markers of circulating urothelial cells.

RNA studies

Blood samples were collected a day before, immediately after (1 day) and 3, 7 and 30 days after surgery by venipuncture into PAXgene Blood RNA Tubes (QIAGEN) and were kept at –80°C until further use. Total RNA from blood samples was isolated using the PAXgene Blood RNA Kit following the manufacturer’s instructions. One μg of RNA was used in reverse transcription (RT) reactions performed with the SuperScript II Reverse Transcriptase (Invitrogen Co., Carlsbad, CA, USA) as per the manufacturer’s protocol. Quantitative evaluation of cDNA was performed on the ABI 7900HT Real Time PCR system (Applied Biosystems) using either Sensimix SYBR or Probe Kit (Bioline, UK) in a 5 μl reaction mixture containing 2.5 μl 2 × Sensimix, 2 μl cDNA (1:5 dilution) and 200 nM primers or preformulated TaqMan Gene Expression Assays (Applied Biosystems). Q-PCR was carried out at 40 cycles, consisting of 15 s of denaturation at 95°C and hybridization for 1 min at 60°C in a 384-well reaction plate. Five serial dilutions of cDNA from normal colon tissue samples (pool of cDNAs) were used to construct the standard curves. The gene expression was regarded as continuous when amplification signal was detected across all the samples, and relative transcripts levels were calculated using the ΔΔCT method. For the transcripts with dichotomous expression (positive/negative signal of expression), we calculated the percent of positive results for a group of patients. Oligonucleotide primers for the analyzed gene transcripts, used for Sybr Green I Dye Assays, were either designed using Primer Express Software (Applied Biosystems) or taken from qPrimer Depot database [25] and are listed in Table 1.

Table 1.

Number of positive qRT-PCR results for mRNAs selected from published reports (genes 1–10) or from analysis of microarray data (genes 11–14) in blood samples collected from two groups of controls: group A—healthy subjects recruited from the laboratory staff; group B—healthy subjects with no illnesses or known history of malignancy selected among individuals who underwent a screening colonoscopy

Candidate markers No. Gene name Control subjects qRT-PCR primers sequences 5′ ≥ 3′ (Sybr Green chemistry) or Taqman Gene Expression assay ID
Group A (n = 17) Group B (n = 15)
Literature-based 1 EGFR 0 0 Hs01076092_m1
2 UPK2 1 14 Hs00171854_m1
3 CD47 17 15 Hs00179953_m1
4 IGFBP7 17 15

F:TGCGAGCAAGGTCCTTCCATA†

R:ATGAGGACAGGTGTCGGGATTC‡

5 SNX16 17 15

F:AGTCCTCTGCACTTGAGGTTGA

R:CAGCATCATATGCCACTTCTGCT

6 TP53 17 15

F:TTGCAATAGGTGTGCGTCAGA

R:AGTGCAGGCCAACTTGTTCAG

7 KIT 17 15

F:GGCGACGAGATTAGGCTGTT

R:CATTCGTTTCATCCAGGATCTCA

8 PDGFRA 17 15

F:GGCATTCTTTGCAATACTGCTTAA

R:CATCTGCCGATAGCACAGTGA

9 TERT 16 14 Hs99999022_m1
10 VEGF 17 15

F:AGGAGGAGGGCAGAATCATCA

R:CTCGATTGGATGGCAGTAGCT

Microarray-based 11 COL1A1 1 0 Hs00164004_m1
12 COL3A1 2 7 Hs00943809_m1
13 KRT7 5 8 Hs00559840_m1
14 AGR2 1 0 Hs00180702_m1

† Forward primer sequence; ‡ Reverse primer sequence

The results of gene expression levels were analyzed with the Mann–Whitney U test, and differences between numbers of samples with detectable signal were analyzed using the Fisher’s exact test. P values of less than 0.01 were considered significant.

Results

Selection of potential biomarkers

Gene expression was analyzed using qRT-PCR with 40 amplification cycles using either pairs of designed primers with SYBR Green chemistry or TaqMan Gene Expression Assay. To determine the potential specificity of both literature- and microarray-selected genes (listed in the ‘Methods’ section), analyses of expression were firstly conducted on RNA isolated from blood samples collected from two groups of control subjects: 17 controls recruited from the laboratory staff and 15 controls from whom blood samples were taken immediately before colonoscopy.

As shown in Table 1, while the expression of 8 of 14 studied genes was found for most control blood samples, detectable signals of EGFR, COL1A1 and AGR2 could be determined for only a few control samples. Expression of TERT, TP53, SNX16 and VEGFA significantly varied between series of PCR assays due to very low signal level (detectable above 37 cycles of amplification), which led to low reproducibility of results. In addition, qRT-PCR analyses revealed significant differences in expression of two genes between the two control groups. The detectable signal of UPK2 mRNA was found in one of 17 control blood samples obtained from laboratory staff and in 14 of 15 blood samples collected immediately before colonoscopy (P = 8,551E−07). Also, the relative levels of KIT expression were significantly higher (P = 4,55E−06) in blood samples collected in healthy controls before colonoscopy compared to laboratory staff controls.

Biomarkers differentiating between healthy controls and bladder cancer patients

Then, we compared gene expression estimated in blood samples collected from BCa patients a day before TURBT and from control individuals. The expression level of CD47 was significantly higher in blood samples collected from BCa patients compared to both control groups (P = 1.19E−12 and P = 1.83E−12, respectively), and the expression of KIT was significantly higher compared to controls selected only from laboratory staff (P = 3.68E−03). Among genes with expression detected in a limited number of blood samples, mRNAs of EGFR and COL1A1 were found significantly more frequently in cancer patient samples than in controls (P = 0.000605 and P = 0.006737, respectively). Expression of AGR2 was not detectable in blood samples from cancer patients. Expression of all other genes selected for this study did not differentiate the bladder cancer patient group from healthy controls.

Histological grading is an important prognostic factor for bladder tumors, especially for prediction of progression [1, 26, 27]. Superficial low-grade cancers frequently recur, but they exhibit a minimal risk for progression, while high-grade, locally advanced tumors often metastasize and therefore, result in poor clinical outcome [28]. However, we could not find any correlation between the level of expression or the PCR-positive-signal frequency of any of the studied markers for CTCs with the grading of bladder tumor (not shown).

Blood biomarkers levels after TURBT

To detect whether TURBT may influence the level of the circulating urothelial cells, in the peripheral blood, expression of all studied marker genes was analyzed in blood samples collected before and 1, 3, 7 and 30 days after surgery. Four genes (Table 2) exhibited significant differences in gene expression between controls and cancer patients found at least at one time point after TURBT. While TURBT did not significantly increase the number of PCR-positive results of any transcripts, a positive EGFR expression was significantly less frequent (P = 0.0021) at 30th day compared to results obtained on day 0.

Table 2.

Percent of positive qRT-PCR signal for EGFR, COL1A1 and COL3A1 mRNAs and relative expression levels of KIT and CD47 in blood samples collected from controls and patients treated for bladder tumors

Controls Days after TURBT (P values)
Before 1 3 7 30
Positive signal of expression (percent)
EGFR 0%

27%

(0.0006)

20%

(0.005)

14%

N.S.

10%

N.S.

4%

N.S.

COL1A1 3%

27%

(0.007)

45%

(0.0004)

25%

(0.007)

36%

(0.0004)

23%

N.S.

COL3A1 28%

40%

N.S.

38%

N.S.

30%

N.S.

36%

N.S.

22%

N.S.

Relative expression levels
KIT 0.061†

0.231

(8.66E−07)

0.265

(0.003)

0.224

(1.43E−06)

0.258

(1.70E−06)

0.291

(1.23E−06)

CD47 0.020

0.279

(2.71E−08)

0.233

(1.09E−08)

0.264

(1.30E−07)

0.219

(1.10E−08)

0.200

(8.46E−08)

† Control group consisted of 17 healthy volunteers selected from laboratory staff

Discussion

The detection of CTCs has been demonstrated in the blood of patients with colon, breast, prostate and other cancers [4–8]. Some of these markers may specifically detect circulating urothelial cells. Most reported studies employed RT-PCR-based analyses, and while they generally exhibited well-documented sensitivity, their specificity might be questionable.

Analysis of epithelial-specific mRNAs by a qRT-PCR is a sensitive technique that allows CTCs identification in the peripheral circulation. However, because of the limited specificity of these assays, leading to both false-positive and false-negative results, proper selection of mRNA markers strongly determines the final results of the study. Therefore, the study started with the identification of urothelium-specific genes. As a result, circulating EGFR mRNA-positive cells were found in 27% of blood samples collected from bladder cancer patients and in none of the control blood samples. Also, positive RT-PCR signals for COL1A1 and CD47 mRNAs were found significantly more frequent and at higher levels, respectively, in blood samples collected from cancer patients compared to controls. EGFR and COL1A1 are not expressed in hemopoietic cells [20], while expression of CD47 seems to be significantly lower in those cells compared to expression in epithelial cells. Thus, from potential molecular markers selected for our analyses, expression of only few genes exhibited the desired specificity.

It should however be noted that the results of our statistical analysis may be underestimated. Comparisons utilizing only qualitative information in datasets of moderate size, such as employed in this study, require large relative frequency differences to conclude significant group bias. Moreover, results are susceptible even to single sample readout alteration. For example, when one group features 20/31 pos/neg ratio, there is no possibility of proving significantly lower pos/neg proportions in other groups using 17 samples (assuming P value < 0.01). Only a 14/3 (or higher) pos/neg ratio is significant in that group (Fisher test, significance level = 0.01, Online Resource 2).

Previous studies have reported EGFR expression in 30–50% of bladder tumors [29], and the presence of EGFR transcript in peripheral blood was proposed as a marker for circulating BCa cell detection [13]. A study by De Luca et al. [30], which detected EGFR-expressing cells in the blood of lung, breast and colon cancer patients, suggests that this assay rather may be used in detecting cancer cells of epithelial origin than different carcinoma types. Nevertheless, the combination of several markers could increase specific cancer type detection, and such molecular indicators were also proposed for BCa.

Expression of UPK2 was found to be highly specific to the uroepithelia [31, 32] and was suggested as a highly specific but not sensitive blood marker for CTCs in bladder cancer patients [3]. However, in our study, a standard bowel preparation by polyethylene glycol (Fortrans) followed by a cleansing phosphate enema 30 min before the colonoscopy significantly affected expression of UPK2 and KIT in blood samples from healthy subjects. Therefore, bowel preparation before colonoscopy may release epithelial cells into circulation or activate transcription of epithelia-specific genes in hemopoietic cells or both.

An optimal method for detecting CTCs should be not only sufficiently specific but also sensitive enough to define the relatively low number of tumor cells in blood samples. Recently, the most popular methods employed for analyzing CTCs have used PCR detection of so-called epithelium-specific genes, which are potentially expressed in CTCs but not in blood nuclear cells. However, most analyzed transcripts exhibited variability in RT-PCR signals that hampered their recognition as specific markers for CTCs. This variability may be caused by many reasons. Although qRT-PCR greatly increases the sensitivity of mRNA detection, its usefulness as a specific method for CTC detection, specifically in blood specimens, is questionable. A low PCR signal significantly decreases the reproducibility of inter- and intra-measurement results. In addition, PCR-based methods may detect both malignant and non-malignant epithelial cells circulating in the blood. Both cell types may be released into the blood due to undefined reasons and with undefined intervals [3], leading to their inconsistent presence in the circulation. For these reasons, the existing PCR-based methods of detecting CTCs have limited usefulness for clinical use.

Despite the above-mentioned reservations, we can draw two conclusions from our study: (1) expression of EGFR in the blood may be considered to be a specific marker for the detection of circulating urothelial cells and its mRNA measurement in the blood may provide useful information for urologists; (2) the results of this study do not provide evidence for increased tumor cell release into the peripheral blood after TURBT.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Acknowledgments

This work was supported by Medical Center of Postgraduate Education grant 501-1-23-18-09.

Conflicts of interest

The authors declare that they have no conflict of interest.

Open Access

This article is distributed under the terms of the Creative Commons Attribution Noncommercial License which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited.

Footnotes

Artur A. Antoniewicz and Agnieszka Paziewska contributed equally.

References

  • 1.Otto W, Denzinger S, Fritsche H-M, Burger M, Wieland WF, et al. The WHO classification of 1973 is more suitable than the WHO classification of 2004 for predicting survival in pT1 urothelial bladder cancer. BJU Int. 2011;107:404–408. doi: 10.1111/j.1464-410X.2010.09515.x. [DOI] [PubMed] [Google Scholar]
  • 2.Naoe M, Ogawa Y, Morita J, Omori K, Takeshita K, et al. Detection of circulating urothelial cancer cells in the blood using the cell search system. Cancer. 2007;109:1439–1445. doi: 10.1002/cncr.22543. [DOI] [PubMed] [Google Scholar]
  • 3.Nezos A, Pissimisis N, Lembessis P, Sourla A, Dimopoulos P, et al. Detection of circulating tumor cells in bladder cancer patients. Cancer Treat Rev. 2009;35:272–279. doi: 10.1016/j.ctrv.2008.11.003. [DOI] [PubMed] [Google Scholar]
  • 4.Kruck S, Gakis G, Stenzl A. Disseminated and circulating tumor cells for monitoring chemotherapy in urological tumors. Anticancer Res. 2011;31:2053–2057. [PubMed] [Google Scholar]
  • 5.Lianidou ES, Markou A. Circulating tumor cells as emerging tumor biomarkers in breast cancer. Clin Chem Lab Med. 2011;49:1579–1590. doi: 10.1515/CCLM.2011.628. [DOI] [PubMed] [Google Scholar]
  • 6.Sato N, Hayashi N, Imamura Y, Tanaka Y, Kinoshita K et al (2011) Usefulness of transcription-reverse transcription concerted reaction method for detecting circulating tumor cells in patients with colorectal cancer. Ann Surg Oncol. doi:10.1245/s10434-011-1889-7 [DOI] [PubMed]
  • 7.Danila DC, Fleisher M, Scher HI. Circulating tumor cells as biomarkers in prostate cancer. Clin Cancer Res. 2011;17:3903–3912. doi: 10.1158/1078-0432.CCR-10-2650. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Armstrong AJ, Marengo MS, Oltean S, Kemeny G, Bitting RL. Circulating tumor cells from patients with advanced prostate and breast cancer display both epithelial and mesenchymal markers. Mol Cancer Res. 2011;9:997–1007. doi: 10.1158/1541-7786.MCR-10-0490. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Sun Y-F, Yang X-R, Zhou J, Qiu S-J, Fan J, et al. Circulating tumor cells: advances in detection methods, biological issues, and clinical relevance. J Cancer Res Clin Oncol. 2011;137:1151–1173. doi: 10.1007/s00432-011-0988-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Yuasa T, Yoshiki T, Isono T, Tanaka T, Hayashida H, et al. Expression of transitional cell-specific genes, uroplakin Ia and II, in bladder cancer: detection of circulating cancer cells in the peripheral blood of metastatic patients. Int J Urol. 1999;6:286–292. doi: 10.1046/j.1442-2042.1999.00064.x. [DOI] [PubMed] [Google Scholar]
  • 11.Osman I, Kang M, Lee A, Deng F-M, Polsky D, et al. Detection of circulating cancer cells expressing uroplakins and epidermal growth factor receptor in bladder cancer patients. Int J Cancer. 2004;111:934–939. doi: 10.1002/ijc.20366. [DOI] [PubMed] [Google Scholar]
  • 12.Gazzaniga P, Nofroni I, Gandini O, Silvestri I, Frati L, et al. Tenascin C and epidermal growth factor receptor as markers of circulating tumoral cells in bladder and colon cancer. Oncol Rep. 2005;14:1199–1202. [PubMed] [Google Scholar]
  • 13.Gazzaniga P, Gandini O, Giuliani L, Magnanti M, Gradilone A, et al. Detection of epidermal growth factor receptor mRNA in peripheral blood: a new marker of circulating neoplastic cells in bladder cancer patients. Clin Cancer Res. 2001;7:577–583. [PubMed] [Google Scholar]
  • 14.Osman I, Bajorin DF, Sun T–T, Zhong H, Douglas D, et al. Novel blood biomarkers of human urinary bladder cancer. Clin Cancer Res. 2006;12:3374–3380. doi: 10.1158/1078-0432.CCR-05-2081. [DOI] [PubMed] [Google Scholar]
  • 15.Pignot G, Bieche I, Vacher S, Güet C, Vieillefond A, et al. Large-scale real-time reverse transcription-PCR approach of angiogenic pathways in human transitional cell carcinoma of the bladder: identification of VEGFA as a major independent prognostic marker. Eur Urol. 2009;56:678–688. doi: 10.1016/j.eururo.2008.05.027. [DOI] [PubMed] [Google Scholar]
  • 16.Chan KS, Espinosa I, Chao M, Wong D, Ailles L, et al. Identification, molecular characterization, clinical prognosis, and therapeutic targeting of human bladder tumor-initiating cells. Proc Natl Acad Sci USA. 2009;106:14016–14021. doi: 10.1073/pnas.0906549106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Xie X-Y, Yang X, Zhang J-H, Liu Z-J. Analysis of hTERT expression in exfoliated cells from patients with bladder transitional cell carcinomas using SYBR green real-time fluorescence quantitative PCR. Ann Clin Biochem. 2007;44:523–528. doi: 10.1258/000456307782268093. [DOI] [PubMed] [Google Scholar]
  • 18.Badawy T, El-Abd S, Zahra M, Eid M, Abdou S, et al. Quantitative measurement of telomerase reverse transcriptase mRNA and chromosomal analysis of urine by M-FISH in the diagnosis and follow-up of bladder cancer. Mol Med Rep. 2008;1:325–333. [PubMed] [Google Scholar]
  • 19.Bowles L, Bialkowska-Hobrzanska H, Bukala B, Nott L, Razvi H. A prospective evaluation of the diagnostic and potential prognostic utility of urinary human telomerase reverse transcriptase mRNA in patients with bladder cancer. Can J Urol. 2004;11:2438–2444. [PubMed] [Google Scholar]
  • 20.Büttner P, Mosig S, Lechtermann A, Funke H, Mooren FC. Exercise affects the gene expression profiles of human white blood cells. J Appl Physiol. 2007;102:26–36. doi: 10.1152/japplphysiol.00066.2006. [DOI] [PubMed] [Google Scholar]
  • 21.Dyrskjøt L, Kruhøffer M, Thykjaer T, Marcussen N, Jensen JL, et al. Gene expression in the urinary bladder: a common carcinoma in situ gene expression signature exists disregarding histopathological classification. Cancer Res. 2004;64:4040–4048. doi: 10.1158/0008-5472.CAN-03-3620. [DOI] [PubMed] [Google Scholar]
  • 22.Als AB, Dyrskjøt L, von der Maase H, Koed K, Mansilla F, et al. Emmprin and survivin predict response and survival following cisplatin-containing chemotherapy in patients with advanced bladder cancer. Clin Cancer Res. 2007;13:4407–4414. doi: 10.1158/1078-0432.CCR-07-0109. [DOI] [PubMed] [Google Scholar]
  • 23.Barrett T, Edgar R. Gene expression omnibus: microarray data storage, submission, retrieval, and analysis. Meth Enzymol. 2006;411:352–369. doi: 10.1016/S0076-6879(06)11019-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Skrzypczak M, Goryca K, Rubel T, Paziewska A, Mikula M, et al. Modeling oncogenic signaling in colon tumors by multidirectional analyses of microarray data directed for maximization of analytical reliability. PLoS ONE. 2010;57:e13091. doi: 10.1371/journal.pone.0013091. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Cui W, Taub DD, Gardner K. qPrimerDepot: a primer database for quantitative real time PCR. Nucleic Acids Res. 2007;35:D805–D809. doi: 10.1093/nar/gkl767. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Cheng L, Montironi R, Davidson DD, Lopez-Beltran A. Staging and reporting of urothelial carcinoma of the urinary bladder. Mod Pathol. 2009;22(Suppl 2):S70–S95. doi: 10.1038/modpathol.2009.1. [DOI] [PubMed] [Google Scholar]
  • 27.van Rhijn BWG, van Leenders GJLH, Ooms BCM, Kirkels WJ, Zlotta AR, et al. The pathologist’s mean grade is constant and individualizes the prognostic value of bladder cancer grading. Eur Urol. 2010;57:1052–1057. doi: 10.1016/j.eururo.2009.09.022. [DOI] [PubMed] [Google Scholar]
  • 28.Bollmann D, Bollmann M, Bankfalvi A, Heller H, Bollmann R, et al. Quantitative molecular grading of bladder tumours: a tool for objective assessment of the biological potential of urothelial neoplasias. Oncol Rep. 2009;21:39–47. [PubMed] [Google Scholar]
  • 29.Sauter G, Haley J, Chew K, Kerschmann R, Moore D, et al. Epidermal-growth-factor-receptor expression is associated with rapid tumor proliferation in bladder cancer. Int J Cancer. 1994;57:508–514. doi: 10.1002/ijc.2910570412. [DOI] [PubMed] [Google Scholar]
  • 30.De Luca A, Pignata S, Casamassimi A, D’Antonio A, Gridelli C, et al. Detection of circulating tumor cells in carcinoma patients by a novel epidermal growth factor receptor reverse transcription-PCR assay. Clin Cancer Res. 2000;6:1439–1444. [PubMed] [Google Scholar]
  • 31.Kong X-T, Deng F-M, Hu P, Liang F-X, Zhou G, et al. Roles of uroplakins in plaque formation, umbrella cell enlargement, and urinary tract diseases. J Cell Biol. 2004;167:1195–1204. doi: 10.1083/jcb.200406025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Wu X, Kakehi Y, Zeng Y, Taoka R, Tsunemori H, et al. (2005) Uroplakin II as a promising marker for molecular diagnosis of nodal metastases from bladder cancer: comparison with cytokeratin 20. J Urol 174: 2138–2142, discussion 2142–2143 [DOI] [PubMed]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials


Articles from International Urology and Nephrology are provided here courtesy of Springer

RESOURCES