Abstract
Resistin-like molecule α (Relm-α) is one of the most up-regulated gene products in allergen- and parasite-associated Th2 responses. Localized to alternatively activated macrophages, Relm-α was shown to exert an anti-inflammatory effect in parasite-induced Th2 responses, but its role in experimental asthma remains unexplored. Here, we analyzed the cellular source, the IL-4 receptors required to stimulate Relm-α production, and the role of Relm-α after experimental asthma induction by IL-4, IL-13, or multiple experimental regimes, including ovalbumin and Aspergillus fumigatus immunization. We demonstrate that Relm-α was secreted into the airway lumen, dependent on both the IL-13 receptor–α1 chain and likely the Type I IL-4 receptor, and differentially localized to epithelial cells and myeloid cells, depending on the specific cytokine or aeroallergen trigger. Studies performed with Retnla gene–targeted mice demonstrate that Relm-α was largely redundant in terms of inducing the infiltration of Th2 cytokines, mucus, and inflammatory cells into the lung. These results mirror the dispensable role that other alternatively activated macrophage products (such as arginase 1) have in allergen-induced experimental asthma and contrast with their role in the setting of parasitic infections. Taken together, our findings demonstrate the distinct utilization of IL-4/IL-13 receptors for the induction of Relm-α in the lungs. The differential regulation of Relm-α expression is likely determined by the relative expression levels of IL-4, IL-13, and their corresponding receptors, which are differentially expressed by divergent cells (i.e., epithelial cells and macrophages.) Finally, we identify a largely redundant functional role for Relm-α in acute experimental models of allergen-associated Th2 immune responses.
Keywords: resistin-like molecule–α, asthma, IL-4, IL-13Rα1
Clinical Relevance
We demonstrate the distinct utilization of IL-4 and IL-13 receptors for the induction of resistin-like molecule–α (Relm-α) in the lungs. We also identify a largely redundant functional role for Relm-α in acute experimental models of allergen-associated Th2 immune responses.
Asthma is a chronic and complex inflammatory disease of the airways characterized by airflow obstruction, mucus production, airway hyperresponsiveness (AHR), and airway inflammation. It is the most common chronic illness of childhood, affecting up to 20% of children and 7% of adults in Western countries, with a combined prevalence of approximately 300 million people worldwide (1).
Asthmatic responses are associated with increased numbers of pulmonary inflammatory cells, including activated T-lymphocytes and eosinophils, which correlate with disease severity (2, 3). T-lymphocytes of the Th2 phenotype are thought to induce asthma through the secretion of an array of cytokines, and in particular, IL-4 and IL-13 (4, 5). These cytokines are produced at elevated concentrations in allergic tissue, and are central regulators of many hallmark features of the disease, such as the production of IgE, Th2 differentiation, eosinophilia, mucus hypersecretion, chemokine induction, and airway hyperresponsiveness (AHR) (6). Notably, IL-13 is considered more of an effector cytokine in the pathogenesis of allergic airway disease compared with IL-4 because AHR and mucus production are predominantly IL-13–dependent (7, 8).
Inflammation triggered by IL-4 and IL-13 is mediated by the IL-4 and IL-13 receptors expressed by multiple parenchymal cell types (including epithelial cells, smooth muscle, and vascular endothelial cells) and by infiltrative cells such as macrophages, dendritic cells, and eosinophils (9). In bone marrow–derived cells, IL-4 exerts its activities by interacting with a specific cell-surface receptor (R) comprised of IL-4Rα and the common γ (γc) chain (designated Type I IL-4R), which is shared by multiple cytokine receptors. IL-4 can also use the Type II IL-4R, comprised of IL-4Rα and the IL-13 receptor–α1 chain (IL-13Rα1) (9–11), a receptor complex that is also the cognate functional receptor for IL-13 (11). Recent analyses of Il13ra1−/− mice demonstrated an essential role for this receptor in mediating the effects of IL-13 and allergen in the lungs (12–14).
Resistin-like molecule–α (Relm-α) belongs to a family of resistin-like molecules (Relms) including Relm-α, Relm-β, and Relm-γ that are potent innate immune-modulating molecules (15). Interestingly, Relm-α and Relm-β expression is tightly regulated by IL-13, IL-4, and signal transducer and activator of transcription protein–6 (16–18). Indeed, Relm family members are implicated in Th2-associated mucosal immune responses and fibrotic diseases (15). Relm-α was originally identified in inflammatory zones associated with an experimental allergic airway disease model and was therefore also called Found in Inflammatory Zone 1 (FIZZ1) (19). Although Relm-α has not been identified in the human genome, the expression pattern of human resistin is more similar to Relm-α than to murine resistin (20), suggesting that information obtained about murine Relm-α may relate to human resistin, at least in part. Notably, Relm-α can regulate insulin resistance, particularly in the setting of intestinal inflammation (16, 21). That property may constitute a particularly important molecular link in connecting impaired metabolism (i.e., obesity) with inflammation.
Relm-α is a hallmark signature gene of murine alternatively activated macrophages (22–25). However, we (and others) recently showed that intestinal epithelial cells and eosinophils can also express Relm-α (19, 23, 26). The exact function of Relm-α remains unclear, in part because its receptor has not been identified. We demonstrated a major proinflammatory role for Relm-α in dextran sodium sulfate–induced colonic inflammation (21, 27), as well as the eosinophil chemoattractant activity of Relm-α (28). Notably, recent studies using Th2-associated parasite infection murine models identified a surprising anti-inflammatory role for Relm-α because Retnla−/− mice display increased fibrosis, granuloma formation, IgE, and mucin gene expression (18, 23), consistent with the inhibition of Th2 cytokine production by Relm-α in some settings (23). Relm family members have key functions in pulmonary fibrosis (17, 28, 29). However, the function of Relm-α in the setting of experimental asthma, where it is one of the foremost induced genes (13, 30), has yet to be elucidated. In addition, the expression pattern (dependence on IL-4/IL-13 receptor components) and the cellular source of Relm-α after the induction of experimental asthma by distinct triggers remain unknown.
Here, we aimed to define the regulation and role of Relm-α in allergic lung responses. We demonstrate that IL-13Rα1 predominantly regulates increased Relm-α expression after Aspergillus fumigatus (Asp) allergen challenge, whereas after chicken egg ovalbumin (OVA) challenge, both IL-13Rα1 and probably Type I IL-4R contribute to the regulation of Relm-α expression. These findings were likely explained by the different sources of Relm-α expression and relatively higher IL-13/IL-4 ratio that was observed in the Asp model (14), suggesting that IL-13 directly induced Relm-α in lung epithelial cells and macrophages in vivo via the Type II IL-4R. Surprisingly, Relm-α was largely dispensable in the allergen-induced production of Th2 chemokines, cytokines, mucus production, and eosinophilia. Taken together, our results demonstrate that Relm-α is not essential for acute Th2-associated, allergen-driven lung responses, in contrast with its key role in helminth-induced pulmonary inflammation (18, 23).
Materials and Methods
Mice
The generation of Retnla−/−, Retnlb−/−, and Il13ra1−/− mice was previously described (13, 27). All experiments involving animals were approved by the Animal Experimentation Ethics Committees of the Cincinnati Children's Hospital Medical Center and Tel-Aviv University. BALB/c or C57BL/6 wild-type mice were obtained from Charles River (Wilmington, MA) or Harlan (Rehovot, Israel), and housed under specific pathogen-free conditions.
Real-Time PCR
Lung RNA samples (0.5–1 μg) were subjected to reverse transcription analysis with iScript reverse transcriptase (Bio-Rad Laboratories, Hercules, CA), according to the manufacturer's instructions. Murine Retnla (forward, CCCTCCACTGTAACGAAGACTC; reverse, CACACCCAGTAGCAGTCATCC) and Hprt (forward, CAGACTGAAGAGCTATTGTAATG; reverse, CCAGTGTCAATTATATCTTCCAC) were quantified by means of real-time PCR with the iQ5 instrument or CFX96 and SYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA). Results were then normalized to Hprt amplified from the same cDNA mix and expressed as fold induction relative to Hprt (31).
Cytokine-Induced Airway Inflammation
Three doses (10 μg/mouse) of IL-13 (Peprotech, Rocky Hill, NJ) were administered intratracheally every other day for 6 days. Mice were killed 48 hours after the final cytokine administration.
Allergen Sensitization and Challenges
Experimental asthma was induced by challenging mice with Asp or by sensitizing the mice to chicken egg OVA, followed by two intranasal challenges as previously described (13, 30, 32). In all experiments, mice were killed 24 to 48 hours after the final intranasal challenge.
Bronchoalveolar Lavage Collection and Analysis
Bronchoalveolar lavage collection was performed, and cytospin preparations were stained and determined, as described elsewhere (13, 32).
ELISA
Bronchoalveolar lavage fluid (BALF) cytokines and chemokines were measured with Duo-Set kits (R&D Systems, Minneapolis, MN). The lower detection limits for CCL11, CCL24, CCL2, CCL17, IL-4, IL-13, and IL-5 were 32.5, 15.6, 15.6, 3.9, 31.2, 6.25, and 31.2 pg/mL, respectively. The protein concentrations of Relm-α were determined by ELISA, using anti–Relm-α antibodies (Peprotech) according to the manufacturer's instructions, as detailed elsewhere (21, 27).
Immunofluorescence
Fixed, frozen sections were treated with 100% acetone and blocked with 3% goat serum in PBS. Slides were incubated with isotype controls (rat IgG1 and rabbit IgG; Vector, Burlingame, CA), anti–Mac-3 (BD Pharmingen, San Jose, CA), anti-MBP (kindly provided by James Lee, Mayo Clinic, Rochester, MN), and/or anti–Relm-α (Peprotech) (overnight at 4°C) followed by goat anti-rabbit Alexa 488 and donkey anti-rat Alexa 594 (Invitrogen, Grand Island, NY) and counterstained with 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI)/Supermount G solution (Southern Biotech, Birmingham, AL). Images were captured using a Zeiss microscope and Axioviewer image analysis software (Deutschland; Carl Zeiss Corp., Jena, Germany) (21).
Flow Cytometry
BALF cells were washed and incubated with anti–Gr-1–FITC and anti–F4/80-Alexa fluor 647 (eBioscience, San Diego, CA). At least 10,000 events were acquired using FACSCalibur (BD Biosciences, San Jose, CA) and analyzed with FlowJo version 8.8.6 (Tree Star, Ashland, OR).
Lung Histopathology
Hematoxylin and eosin or periodic acid–Schiff staining were performed and quantified as previously described (13).
Microarray Data Analysis
Whole-lung RNA was extracted and subjected to Affymetrix Gene Chip microarray analysis (Affymetrix, Santa Clara, CA), as previously reported (30).
Statistical Analysis
Data were analyzed by ANOVA followed by the Tukey post hoc test, using GraphPad Prism 4 (GraphPad, San Diego, CA). Data are presented as mean ± SD, and P < 0.05 was considered statistically significant.
Results
Regulation of Relm-α Expression by IL-13Rα1
Previous reports demonstrated that Relm-α is highly induced in settings of experimental asthma (33). Given the critical role of the IL-13–IL-13Rα1 pathway in experimental asthma, we aimed to identify allergen-induced genes that were differentially regulated by IL-13Rα1 (13). Consistent with previous reports (13, 19, 29), Relm-α was highly induced after allergen (i.e., OVA) challenge (Figure 1A). Interestingly, although Relm-α was highly induced by the direct administration of IL-13, the expression of Relm-α in OVA-induced experimental asthma was mostly IL-13Rα1–independent. In contrast, the induction of Relm-β after OVA allergen challenge was entirely dependent on IL-13Rα1 (Figure 1B).
Figure 1.
Regulation of resistin-like molecule–α (Relm-α) expression by IL-13 receptor–α1 chain (IL-13Rα1). Microarray analysis of whole-lung (A) Relm-α and (B) Relm-β expression after chicken egg ovalbumin allergen (OVA), IL-4, or IL-13 treatment of wild-type (WT) and Il13ra1−/−mice. Real-time PCR assessment of Relm-α expression was performed after (C) OVA and (E) Aspergillus fumigatus (Asp) challenges in WT and Il13ra1−/− mice. Assessment of Relm-α protein expression in bronchoalveolar lavage fluid (BALF) was performed after (D) OVA and (F) Asp challenges in WT and Il13ra1−/− mice. Data are representative of n = 3 (6–8 mice per group). ns, not significant; Sal, saline. *P < 0.05. **P < 0.01. ***P < 0.001.
Given that IL-4 can also use IL-13Rα1 to elicit some of its effects (13, 34), we examined whether IL-4–induced Relm-α and Relm-β were IL-13Rα1–dependent. Indeed, IL-4 delivery substantially increased the expression of Relm-α and Relm-β in the lungs (Figures 1A and 1B). Similar to our findings with OVA-induced experimental asthma, the expression of IL-4–induced Relm-α was predominantly independent of IL-13Rα1, whereas Relm-β expression was partly IL-13Rα1–dependent (Figures 1A and 1B).
The expression and dependence of Relm-α on IL-13Rα1 was also assessed by real-time PCR and ELISA. After OVA challenge, the increased mRNA expression of Relm-α was predominantly independent of IL-13Rα1 (Figure 1C), and the expression of Relm-α protein was partly IL-13Rα1–dependent (Figure 1D). To define whether the IL-13Rα1–independent regulation of Relm-α expression was allergen-specific, wild-type and Il13ra1−/− mice were subjected to experimental asthma, using a naturally occurring aeroallergen (Asp). Asp-challenged wild-type mice displayed a significant up-regulation in Relm-α expression, whereas Asp-challenged Il13ra1−/− mice showed no increase in Relm-α expression (Figure 1E). Notably, the IL-13Rα1–dependent expression of Relm-α was also observed at the protein level, as Asp-challenged Il13ra1−/− mice displayed no increase in expression of Relm-α protein (Figure 1F). Collectively, these results indicate that Relm-α expression is largely IL-13Rα1–independent after OVA challenge (and IL-4 delivery), but it is IL-13Rα1–dependent after Asp challenge. These results likely reflect the predominant utilization of Type I and Type II IL-4R by IL-4 and IL-13, respectively, for the induction of Relm-α. Further, our results identify a differential regulation of Relm-α compared with Relm-β because Relm-β remains critically dependent on IL-13Rα1 (e.g., the Type II IL-4 receptor), even after OVA challenge.
Assessment of Relm-α Cellular Expression after IL-13 and Allergen Challenge
Recent data demonstrate the expression of Relm-α in additional cells besides alternatively activated macrophages, including epithelial cells and eosinophils (18, 21, 23, 27). Thus, we aimed to define the cellular source of Relm-α expression after IL-13 or allergen challenge. Under normal conditions, Relm-α protein is expressed in epithelial cells, but not in alveolar macrophages or cells in the lung parenchyma (Figures 2A and 2B). After the administration of IL-13, Relm-α expression was highly up-regulated in lung epithelial cells and was often detected in the airway lumen (Figures 2D and 2F). In addition, Relm-α was also expressed in alveolar macrophages (Figure 2E). Similarly, after allergen challenge, Relm-α was up-regulated in airway epithelial cells and macrophages (Figures 2G–2L), but not in infiltrating eosinophils, although those eosinophils displayed substantial mRNA concentrations of Relm-α (Figures 2G–2L, and data not shown). Importantly, the attempt to stain lung tissue with an isotype control produced no staining (Figure 2C).
Figure 2.
Relm-α cellular expression after allergen challenge. Assessment of Relm-α cellular expression in a model of IL-13– and allergen-induced airway inflammation. Forty-eight hours after the final administration of saline (A, B), IL-13 (D–F), OVA (G–I), or Aspergillus fumigatus (Asp) (G–L) allergen challenge, the mice were killed, and Relm-α (red) expression was assessed in Mac-1–positive cells (green; B, E, H, and K) or eosinophil major basic protein–positive cells (green; I and L), using immunofluorescent analysis. Antibody control-stained slides are shown in C. Data are representative photomicrographs of n = 3 (6–8 mice per group).
The analysis of Relm-α expression in allergen-challenged Il13ra1−/− mice revealed that allergen-induced Relm-α expression in epithelial cells was entirely dependent on IL-13Rα1, because airway epithelial cells in allergen-challenged Il13ra1−/− mice showed expression similar to that of airway epithelial cells in saline-treated mice (Figures 3A, 3B, 3D, and 3E; magnification, ×100). Nonetheless, after OVA challenge, Relm-α expression in alveolar macrophages was IL-13Rα1–independent (Figure 3C; magnification, ×400), whereas its expression in macrophages after Asp challenge was IL-13Rα1–dependent (Figure 3F; magnification, ×400).
Figure 3.
Assessment of Relm-α cellular source in allergen-challenged Il13ra1−/− mice. Frozen lung sections obtained from allergen-challenged Il13ra1−/− mice were stained for Relm-α (red) and Mac-1 (green) expression after OVA (A–C) or Aspergillus fumigatus (Asp) challenges (D–F) and analyzed by immunofluorescence. Arrows indicate Mac1+ cells in the lung parenchyma, which are either positive (C) or negative (F) for Relm-α expression. Data are representative photomicrographs of n = 3 (4–6 mice per group). Numbers in parentheses indicate extent of magnification.
Roles of Relm-α in IL-13–Induced Lung Inflammation
Our findings defined a marked induction of Relm-α by IL-13 as well as by two distinct allergens (OVA and Asp), raising the question of the role of Relm-α in Th2-associated lung responses. We aimed to define the role of Relm-α in IL-13–induced lung pathology (9, 35). In response to IL-13 challenge, Retnla−/− mice displayed elevated concentrations of CCL24, CCL2, and CCL11 (Figures 4B and 4C, and data not shown), decreased CCL17, and a trend toward decreased CCL22 expression (Figures 4A and 4D) compared with IL-13–challenged wild-type (WT) mice. Given the key role of chemokines in the recruitment of inflammatory cells to the lung (36), we then assessed the role of Relm-α in inflammatory cell recruitment. No difference was evident in inflammatory cell recruitment in Retnla−/− mice in response to IL-13 (Figure 4E). Similarly, increased mucus production in response to IL-13 was similar in cytokine-challenged wild-type and Retnla−/− mice (data not shown).
Figure 4.
Effects of Relm-α on IL-13–induced lung responses. Relm-α–mediated responses were assessed in a model of IL-13–induced airway inflammation. Forty-eight hours after the final IL-13 challenge, mice were assessed for BALF chemokine expression (A–D) and BALF cellular infiltration (E). Data are representative of three experiments (6–8 mice per experimental group). ns, not significant; WT, wild-type. **P < 0.01. ***P < 0.001.
For comparison, we examined the role of Relm-β in IL-13–induced lung inflammation. Indeed, the regulation of IL-13–induced CCL17 and CCL24 was similar in Retnla−/− and Retnlb−/− mice, as both gene-targeted mice displayed decreased and augmented concentrations of CCL17 and CCL24, respectively, in response to IL-13 challenge (Figures 5A and 5B). Interestingly, Relm-β (and to a lesser extent, Relm-α) enhanced IL-13–induced CCL22, as IL-13–induced CCL22 expression was significantly reduced in IL-13–challenged Retnlb−/− mice in comparison with IL-13–challenged Retnla−/− and WT mice (Figure 5C). In contrast, the production of CCL2 was significantly increased in IL-13–challenged Retnlb−/− mice compared with IL-13–challenged Retnla−/− mice (Figure 5D). An assessment of IL-13–induced cellular recruitment into the lungs revealed that IL-13–challenged Retnlb−/− mice displayed a significant decrease in such neutrophil and eosinophil recruitment (Figure 5E). These data were confirmed by flow cytometric analysis using the F4/80 and Gr-1 markers, inasmuch as F4/80−/Gr1high cells (i.e., neutrophils) and F4/80dim/Gr-1dim cells were significantly reduced in the BALF of IL-13–challenged Retnlb−/− but not IL-13–challenged Retnla−/− and WT mice (Figures 5F and 5G).
Figure 5.
Effects of Relm-β on IL-13–induced lung responses. Relm-α–mediated and Relm-β–mediated responses were assessed in a model of IL-13–induced airway inflammation. Forty-eight hours after the final IL-13 challenge, mice were assessed for BALF chemokine expression (A–D), BALF cellular infiltration by differential cell counts (E), and cytometric analysis using anti–Gr-1 and F4/80 staining (F and G). Data are representative of three experiments (6–8 mice per experimental group). Flow cytometric dot plots are representative of n = 7 mice per group. ns, not significant. *P < 0.05. **P < 0.01.
Role of Relm-α in OVA-Induced Experimental Asthma
OVA-challenged WT mice displayed significantly increased CCL11, CCL24, CCL2, and CCL17 concentrations. Interestingly, OVA-challenged Retnla−/− mice displayed significantly reduced CCL17 concentrations but comparable concentrations of CCL11, CCL22, and CCL24 in comparison with OVA-challenged WT mice (Figures 6A–6D). Consistent with these data, Retnla−/− mice displayed similar inflammatory cellular recruitment into the BALF as did WT mice (Figure 6E).
Figure 6.
Effects of Relm-α on OVA-induced allergic airway inflammation. Twenty-four hours after the final allergen challenge, mice were examined for BALF chemokine production (A–D) as well as cellular infiltration (E), cytokine production (F–I), and mucus production (J and K). Data are representative of one of three experiments (6–17 mice per experimental group). ns, not significant. ***P < 0.001.
An assessment of the major Th2 cytokines in the BALF of OVA-challenged mice indicated that Retnla−/− mice displayed similar concentrations of IL-4, IL-13, and IL-5 as WT mice (Figures 6F–6H). Moreover, OVA-challenged WT and Retnla−/− mice showed similar concentrations of IL-10 (Figure 6I).
Finally, an assessment of the OVA-induced epithelial-cell pathology that is associated with asthma showed that OVA-challenged Retnla−/− mice displayed similar levels of goblet cell hyperplasia and mucus production as did WT mice (Figures 6J and 6K).
Role of Relm-α in Asp-Induced Experimental Asthma
We hypothesized that the lack of activity for Relm-α in the “classic” OVA/alum experimental asthma model may be attributable to the effects of artificial adjuvant sensitization, which may override many features of natural mucosal sensitization (especially those driven by IL-13, which is more prominent in the Asp experimental asthma model). Thus, Retnla−/− mice were subjected to an additional experimental asthma model using Asp. However, intranasal Asp delivery to Retnla−/− mice resulted in no significant alterations in the Asp-induced production of CCL17 and CCL22 (Figures 7A–7B). Similarly, concentrations of CCL11 and CCL24 were found to be similar in Asp-challenged Retnla−/− mice (Figures 7C and 7D). The recruitment of eosinophils into the BALF was only modestly but statistically significantly reduced (35% ± 8.2%) in Retnla−/− mice (Figures 7E and 7F). The assessment of BALF and the lung Th2 cytokine profile demonstrated no change in IL-4 and IL-13 concentrations (Figures 7G and 7H). In addition, Asp-challenged Retnla−/− mice revealed similar levels of goblet cell hyperplasia and mucus production compared with WT mice (data not shown).
Figure 7.
The effects of Relm-α on Aspergillus fumigatus (Asp)–induced allergic airway inflammation. Forty-eight hours after the final allergen challenge, mice were examined for BALF chemokine production (A–D) and BALF cells (E). (F) In addition, paraffin-embedded, allergen-challenged lungs were analyzed for eosinophilic infiltration, using anti-eosinophil major basic protein immunohistochemistry. (G and H) BALF samples were analyzed for IL-13 and IL-4 expression. Data are representative of one of three experiments (6–12 mice per experimental group). ns, not significant. *P < 0.05. **P < 0.01.
Discussion
The Relm family of proteins was originally identified in the lung and gastrointestinal tract and is strongly linked with the induction of Th2 immune responses and mucosal immunity, involving asthma, helminthic parasites, and inflammatory bowel disease (15–17, 26, 37–39). Relm-α is a hallmark signature gene of murine alternatively activated macrophages (25). However, epithelial cells, eosinophils, and adipose tissue may also express Relm-α (16, 27, 33, 37). Surprisingly, despite intensive research into Relm-α, its role in models of asthma remains unknown.
In this study, we demonstrate several key and unexpected results regarding the regulation and roles of Relm-α, using acute models of experimental asthma. First, we demonstrate the differential regulation of Relm-α by IL-13Rα1, and likely the Type I IL-4R, depending on the experimental asthma model. In particular, we demonstrate that IL-13Rα1 critically regulates Relm-α expression after Asp challenge. However, after OVA + alum–induced experimental asthma, Relm-α expression is regulated by both IL-13Rα1 and most likely the Type I IL-4R. Second, we demonstrate that baseline Relm-α expression is restricted to airway epithelial cells, whereas after the induction of experimental asthma, airway epithelial cells and macrophages express Relm-α, consistent with the presence of alternatively activated macrophages only after the induction of Th2-associated lung disease. Third, we demonstrate that Relm-α partly regulates IL-13–induced lung chemokine production. In particular, Relm-α–deficient mice display elevated concentrations of CCL24, CCL2, and CCL11 and decreased concentrations of CCL17 and CCL22. Notably, IL-13–challenged Retnlb−/− mice displayed significantly more CCL2 and less CCL22 than IL-13–challenged Retnla−/− mice. Finally, using two models of experimental asthma, we demonstrate that Relm-α does not have a marked role in the overall Th2 response in the lung, as assessed by the production of lung Th2 cytokine, chemokine, cellular recruitment, and mucus production.
Our results demonstrate that IL-13Rα1 differentially regulates Relm-α expression. After OVA + alum sensitization and consequent intranasal OVA challenge, Relm-α expression is predominantly IL-13Rα1–independent, whereas after mucosal sensitization and challenge (using Asp extract), the expression of Relm-α was IL-13Rα1–dependent. Whereas airway epithelial cells predominantly express Type II IL-4R, which mediates IL-4 and IL-13 signaling, infiltrating hematopoietic cells predominantly express Type I IL-4R (40). Indeed, we demonstrate that after allergen challenge, Relm-α is expressed by both airway epithelial cells and macrophages. Therefore, the differential regulation and expression of Relm-α are likely driven by the marked differences between the OVA + alum and Asp models and may result from differential IL-4 versus IL-13 production (14), as the ratio between IL-13 and IL-4 is substantially higher after Asp inoculation than after OVA inoculation (13, 14). Despite our finding that lung eosinophils express Relm-α mRNA and that gastrointestinal eosinophils express Relm-α protein, murine eosinophils did not express Relm-α protein after IL-13 challenge or allergen challenge. These results may indicate different roles for eosinophils or eosinophil-derived Relm-α in innate-immune gastrointestinal inflammatory settings compared with allergic airway inflammation.
Given the strong association between IL-13 and Relm-α induction and the ability of IL-13 to induce Relm-α directly, we hypothesized that Relm-α would regulate IL-13–induced lung responses. In particular, IL-13–treated Retnla−/− mice displayed altered chemokine induction. CCL17 and CCL22 were decreased in Retnla−/− mice, indicating a role for Relm-α in the induction of these chemokines. CCL17 and CCL22 are mainly implicated in the recruitment of Th2 T-cells (41). Although we could not detect any alterations in IL-13–induced T-cell recruitment into the lung, in different settings, Relm-α may be able to modulate T-cell responses by governing their chemotactic signals. Moreover, CCL24 (a hallmark eosinophil chemokine) (42, 43) and CCL2 (which recruits monocytes and dendritic cells) (44) were increased in IL-13–challenged Retnla−/− mice, indicating a suppressive role for Relm-α. Collectively, these data suggest that the effect of Relm-α was predominantly attributable to the effects of Relm-α on airway structural cells (such as epithelial cells), as these are responsive to IL-13 in the induction of chemokine production (40). Furthermore, given the structural similarities between Relm-α and Relm-β (15, 39), we were interested in determining whether Relm-regulated IL-13–induced lung chemokine production was Relm-α–specific. The regulatory effects of Relm-α and Relm-β on IL-13–induced chemokine production were similar, although Relm-β was more potent at increasing CCL24 and CCL2 and decreasing CCL17 and CCL22. Although the receptors for Relm-α and Relm-β remain unknown, the different potencies of Relm-α and Relm-β in regard to IL-13–induced chemokine production may partly attributable to their respective receptor expression or the induction of intracellular signaling.
Recent studies indicate a key role for Relm-α in helminth-induced Th2 responses (Table 1) (18). Indeed, Nippostrongylus brasiliensis–infected Retnla−/− mice display significantly increased Th2 cytokine production (including IL-4, IL-5, and IL-13) 7 days after infection. Furthermore, Schistosoma mansoni–infected Retnla−/− mice displayed increased lung pathology (increased size of egg-induced granulomas, and elevated fibrosis), which was associated with elevated Th2 cytokines and IgE production (23). In fact, macrophage-derived Relm-α was shown to negatively regulate Th2 cytokine production from anti-CD3/anti-CD28–stimulated splenocytes. Collectively, these data suggest that Relm-α would also be a negative regulator of allergen-induced allergic airway inflammation. Nevertheless, in response to allergen challenge, using two distinct experimental asthma models, Retnla−/− mice displayed similar Th2 cytokine production compared with WT mice. Furthermore, mucus production and chemokine induction were similar in allergen-exposed Retnla−/− and WT mice.
TABLE 1.
COMPREHENSIVE SUMMARY COMPARING EFFECTS REGULATED BY RELM-α AND ARGINASE 1 IN EXPERIMENTAL ASTHMA AND HELMINTH INFECTIONS
| Relm-α |
Arginase I |
|||
| Property | Asthma | Parasites | Asthma | Parasites |
| Expression | Up-regulated: Epi Cells, Mac, and Eos (RNA only) | Up-regulated: Epi Cells, Mac, and Eos (protein + RNA) | Up-regulated: bone marrow–derived cells | Up-regulated: bone marrow–derived cells |
| Urea concentrations | NA | NA | No | Yes |
| Antibody production | No | Yes | No | Yes |
| Eosinophilia | Model-dependent | Yes | No | Unknown |
| AHR | No | Unknown | Model-dependent (47, 48) | Unknown |
| Fibrosis | No | Yes | No | Yes |
| Granuloma | NR | Yes | NR | Yes |
| Mucus | No | Yes | No | Yes |
| Th1 cytokines | No | Unknown | Unknown | Unknown |
| Th2 cytokines | No | Inhibitory | No | Dual activating (60) and inhibitory (46) |
| Chemokines | No | Unknown | Unknown | Unknown |
Definition of abbreviations: AHR, airway hyperresponsiveness; Eos, eosinophils; Epi, epithelial; Mac, macrophages; NA, not assessed; NR, not relevant; Relm-α, resistin-like molecule–α.
Interestingly, after exposure to Asp, Retnla−/− mice displayed a minor (but statistically significant) decrease in lung eosinophilia. Similar to Relm-α, arginase I is another hallmark gene of alternatively activated macrophages and is induced after allergen challenge and helminth infection. Although the cationic amino-acid transporter–2 and arginase I were shown to play key roles in response to helminth infection (45, 46), arginase I is not required for allergen-induced inflammation, AHR, or collagen deposition (47). Furthermore (and similar to our data demonstrating a role for Relm-α only in IL-13–induced responses but not allergen challenge), RNA interference targeting arginase 1 abrogated the development of IL-13–induced AHR (48), but not allergen-induced AHR (47).
Collectively, these data suggest that the classic and major products of alternatively activated macrophages (Relm-α and arginase I) play key roles in helminth-induced immune responses, but limited roles in allergen-induced airway allergic inflammation (Table 1). This effect could be attributable to the lack of chronicity of allergen or antigen exposure. Although allergen exposure is rather limited, the exposure to helminth antigens driving the Th2 response may be more chronic. Because our experimental regimes were mainly conducted in models that mimic acute allergic airway inflammation, we cannot exclude the possibility that Relm-α may play a more important role after chronic exposure to allergens. In addition, the role of Relm-α may be dependent on its cellular source and its synergy with other secreted molecules that may be present in the inflammatory milieu, which may differ in allergic and helminth infection. For example, we recently established a proinflammatory and synergistic role for Relm-α in LPS-induced macrophage activation (27). In the presence of LPS, Relm-α induced macrophage IL-6 and TNF-α secretion, while decreasing IL-10 secretion (27). Thus, the role of Relm-α may be dependent on its synergism with LPS or other pattern recognition–dependent pathways, which may largely vary between allergic settings and parasitic infections. For example, recent studies highlighted key roles for low doses of LPS and Toll-like receptor 4 in allergenicity. In contrast to allergens, which require narrow (but necessary) innate immune activation (49, 50), helminth infections may activate numerous innate immune pathways, including various pattern-recognition receptors (e.g., Toll-like receptors, C type lectin receptors, protease-activated receptors, and nod-like receptors) (51). In fact, parasites can activate multiple innate immune components via chitin, proteases, lectins, and secretory components (e.g., lacto-N-fucopentaose III, schistosome-derived lysophosphatidylserine, and phosphorylcholine-rich glycoprotein), whereas the repertoire of innate immune activation by allergens is more limited (49–58). It would be interesting to determine whether any of the aforementioned components up-regulate Relm-α expression and whether Relm-α regulates LPS-induced effects in the lungs. Moreover, given the proposed role of Relm-α in innate immune responses and in helminth-induced Th2 responses (23, 26), to assess its function in infection-associated asthma would be intriguing. For example, rats infected with localized pulmonary cryptococcal infection display increased IL-13 expression and consequent disease pathology (including AHR and mucus production) (60). Thus, Relm-α may play a more significant role in disease settings that involve increased IL-13 responsiveness.
In conclusion, we demonstrate that Relm-α is secreted into the airway lumen and is differentially dependent on IL-13Rα1 and Type I IL-4 receptors after OVA and Asp challenges, respectively. The differing cellular sources of Relm-α after exposure to these two allergens are likely explained by the differential IL-4R requirement and the relative induction of IL-4 and IL-13 in response to distinct allergens (14). Indeed, increased IL-13 concentrations will promote a predominant Type II IL-4R–dependent response pathway because IL-13–induced Relm-α expression mainly occurs in epithelial cells. Functionally, using Relm-α gene–targeted mice, we showed that Relm-α was largely redundant in terms of inducing Th2 cytokines, mucus, and inflammatory cell infiltration into the lung. These results mirror the dispensable role that other alternatively activated macrophage products (such as arginase 1) play in acute models of allergen-induced experimental asthma and contrast with their role in the setting of parasitic infections. These data suggest a divergence between allergen-induced responses and helminth-induced Th2-type immunity, based on our collective data concerning Relm-α.
Supplementary Material
Footnotes
This work was supported by National Institutes of Health grants AI83450, AI045898, and DK076893, the Buckeye Foundation, the Food Allergy Initiative, and the Campaign Urging Research For Eosinophilic Disease (M.E.R.); by United States–Israel Bi-National Science Foundation grant 2009222 and an FP7 Marie-Curie Reintegration grant (A.M.); and by National Institutes of Health grant HL097360 and a Veterans Administration Merit Award (F.D.F.).
Originally Published in Press as DOI: 10.1165/rcmb.2011-0391OC on January 12, 2012
Author disclosures are available with the text of this article at www.atsjournals.org.
References
- 1.Busse WW, Lemanske RF Jr. Asthma. N Engl J Med 2001;344:350–362 [DOI] [PubMed] [Google Scholar]
- 2.Foster P, Hogan S, Ramsay A, Matthaei K, Young I. Interleukin-5 deficiency abolishes eosinophilia, airway hyperreactivity and lung damage in mouse asthma model. J Exp Med 1996;183:195–201 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Hogan S, Mould A, Young J, Rothenberg M, Ramsay A, Matthaei K, Young IG, Foster PS. Cellular and molecular regulation of eosinophil trafficking to the lung. Immunol Cell Biol 1998;76:454–460 [DOI] [PubMed] [Google Scholar]
- 4.Wills-Karp M. Immunologic basis of antigen-induced airway hyperresponsiveness. Annu Rev Immunol 1999;17:255–281 [DOI] [PubMed] [Google Scholar]
- 5.Kelly-Welch AE, Hanson EM, Boothby MR, Keegan AD. Interleukin-4 and interleukin-13 signaling connections maps. Science 2003;300:1527–1528 [DOI] [PubMed] [Google Scholar]
- 6.Wills-Karp M. IL-12/IL-13 axis in allergic asthma. J Allergy Clin Immunol 2001;107:9–18 [DOI] [PubMed] [Google Scholar]
- 7.Wills-Karp M, Luyimbazi J, Xu X, Schofield B, Neben TY, Karp CL, Donaldson DD. Interleukin-13: central mediator of allergic asthma. Science 1998;282:2258–2261 [DOI] [PubMed] [Google Scholar]
- 8.Grunig G, Warnock M, Wakil AE, Venkayya R, Brombacher F, Rennick DM, Sheppard D, Mohrs M, Donaldson DD, Locksley RM, et al. Requirement for IL-13 independently of IL-4 in experimental asthma. Science 1998;282:2261–2263 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Wynn TA. IL-13 effector functions. Annu Rev Immunol 2003;21:425–456 [DOI] [PubMed] [Google Scholar]
- 10.Matthews DJ, Hibbert L, Friedrich K, Minty A, Callard RE. X-SCID B cell responses to interleukin-4 and interleukin-13 are mediated by a receptor complex that includes the interleukin-4 receptor alpha chain (p140) but not the gamma C chain. Eur J Immunol 1997;27:116–121 [DOI] [PubMed] [Google Scholar]
- 11.Miloux B, Laurent P, Bonnin O, Lupker J, Caput D, Vita N, Ferrara P. Cloning of the human IL-13R alpha1 chain and reconstitution with the IL4R alpha of a functional IL-4/IL-13 receptor complex. FEBS Lett 1997;401:163–166 [DOI] [PubMed] [Google Scholar]
- 12.Wilson MS, Elnekave E, Mentink-Kane MM, Hodges MG, Pesce JT, Ramalingam TR, Thompson RW, Kamanaka M, Flavell RA, Keane-Myers A, et al. IL-13Ralpha2 and IL-10 coordinately suppress airway inflammation, airway-hyperreactivity, and fibrosis in mice. J Clin Invest 2007;117:2941–2951 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Munitz A, Brandt EB, Mingler M, Finkelman FD, Rothenberg ME. Distinct roles for IL-13 and IL-4 via IL-13 receptor alpha1 and the Type II IL-4 receptor in asthma pathogenesis. Proc Natl Acad Sci USA 2008;105:7240–7245 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Rothenberg ME, Wen T, Shik D, Cole ET, Mingler MM, Munitz A. IL-13 receptor {alpha}1 differentially regulates aeroallergen-induced lung responses. J Immunol 2011;187:4873–4880 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Patel SD, Rajala MW, Rossetti L, Scherer PE, Shapiro L. Disulfide-dependent multimeric assembly of resistin family hormones. Science 2004;304:1154–1158 [DOI] [PubMed] [Google Scholar]
- 16.Steppan CM, Brown EJ, Wright CM, Bhat S, Banerjee RR, Dai CY, Enders GH, Silberg DG, Wen X, Wu GD, et al. A family of tissue-specific resistin-like molecules. Proc Natl Acad Sci USA 2001;98:502–506 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Liu T, Jin H, Ullenbruch M, Hu B, Hashimoto N, Moore B, McKenzie A, Lukacs NW, Phan SH. Regulation of found in inflammatory zone 1 expression in bleomycin-induced lung fibrosis: role of IL-4/IL-13 and mediation via STAT-6. J Immunol 2004;173:3425–3431 [DOI] [PubMed] [Google Scholar]
- 18.Pesce JT, Ramalingam TR, Wilson MS, Mentink-Kane MM, Thompson RW, Cheever AW, Urban JF, Jr, Wynn TA. Retnla (Relmalpha/FIZZ1) suppresses helminth-induced Th2-type immunity. PLoS Pathog 2009;5:e1000393. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Holcomb IN, Kabakoff RC, Chan B, Baker TW, Gurney A, Henzel W, Nelson C, Lowman HB, Wright BD, Skelton NJ, et al. FIZZ1, a novel cysteine-rich secreted protein associated with pulmonary inflammation, defines a new gene family. EMBO J 2000;19:4046–4055 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Nair MG, Guild KJ, Artis D. Novel effector molecules in Type 2 inflammation: lessons drawn from helminth infection and allergy. J Immunol 2006;177:1393–1399 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Munitz A, Seidu L, Cole ET, Ahrens R, Hogan SP, Rothenberg ME. Resistin-like molecule alpha decreases glucose tolerance during intestinal inflammation. J Immunol 2009;182:2357–2363 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Gordon S. Alternative activation of macrophages. Nat Rev Immunol 2003;3:23–35 [DOI] [PubMed] [Google Scholar]
- 23.Nair MG, Du Y, Perrigoue JG, Zaph C, Taylor JJ, Goldschmidt M, Swain GP, Yancopoulos GD, Valenzuela DM, Murphy A, et al. Alternatively activated macrophage-derived Relm-{alpha} is a negative regulator of Type 2 inflammation in the lung. J Exp Med 2009;206:937–952 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Mylonas KJ, Nair MG, Prieto-Lafuente L, Paape D, Allen JE. Alternatively activated macrophages elicited by helminth infection can be reprogrammed to enable microbial killing. J Immunol 2009;182:3084–3094 [DOI] [PubMed] [Google Scholar]
- 25.Raes G, De Baetselier P, Noel W, Beschin A, Brombacher F, Hassanzadeh Gh G. Differential expression of FIZZ1 and Ym1 in alternatively versus classically activated macrophages. J Leukoc Biol 2002;71:597–602 [PubMed] [Google Scholar]
- 26.Holcomb IN, Kabakoff RC, Chan B, Baker TW, Gurney A, Henzel W, Nelson C, Lowman HB, Wright BD, Skelton NJ, et al. FIZZ1, a novel cysteine-rich secreted protein associated with pulmonary inflammation, defines a new gene family. EMBO J 2000;19:4046–4055 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Munitz A, Waddell A, Seidu L, Cole ET, Aherens R, Hogan SP, et al. Resistin like molecule alpha enhances myeloid cell activation and promotes colitis. J Allergy Clin Immunol 2008;122:1200–1207 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Liu T, Dhanasekaran SM, Jin H, Hu B, Tomlins SA, Chinnaiyan AM, Phan SH. FIZZ1 stimulation of myofibroblast differentiation. Am J Pathol 2004;164:1315–1326 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Liu T, Baek HA, Yu H, Lee HJ, Park BH, Ullenbruch M, Liu J, Nakashima T, Choi YY, Wu GD, et al. FIZZ2/Relm-beta induction and role in pulmonary fibrosis. J Immunol 2011;187:450–461 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Zimmermann N, King NE, Laporte J, Yang M, Mishra A, Pope SM, Muntel EE, Witte DP, Pegg AA, Foster PS, et al. Dissection of experimental asthma with DNA microarray analysis identifies arginase in asthma pathogenesis. J Clin Invest 2003;111:1863–1874 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Blanchard C, Wang N, Stringer KF, Mishra A, Fulkerson PC, Abonia JP, Jameson SC, Kirby C, Konikoff MR, Collins MH, et al. Eotaxin-3 and a uniquely conserved gene-expression profile in eosinophilic esophagitis. J Clin Invest 2006;116:536–547 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Munitz A, Bachelet I, Finkelman FD, Rothenberg ME, Levi-Schaffer F. CD48 is critically involved in allergic eosinophilic airway inflammation. Am J Respir Crit Care Med 2007;175:911–918 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Rajala MW, Lin Y, Ranalletta M, Yang XM, Qian H, Gingerich R, Barzilai N, Scherer PE. Cell type–specific expression and coregulation of murine resistin and resistin-like molecule–alpha in adipose tissue. Mol Endocrinol 2002;16:1920–1930 [DOI] [PubMed] [Google Scholar]
- 34.Ramalingam TR, Pesce JT, Sheikh F, Cheever AW, Mentink-Kane MM, Wilson MS, et al. Unique functions of the Type II interleukin 4 receptor identified in mice lacking the interleukin 13 receptor alpha1 chain. Nat Immunol 2008;9:25–33 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Perkins C, Wills-Karp M, Finkelman FD. IL-4 induces IL-13–independent allergic airway inflammation. J Allergy Clin Immunol 2006;118:410–419 [DOI] [PubMed] [Google Scholar]
- 36.Pease JE, Williams TJ. Chemokines and their receptors in allergic disease. J Allergy Clin Immunol 2006;118:305–318, quiz 19–20 [DOI] [PubMed] [Google Scholar]
- 37.Wang ML, Shin ME, Knight PA, Artis D, Silberg DG, Suh E, Wu GD. Regulation of Relm/FIZZ isoform expression by CDX2 in response to innate and adaptive immune stimulation in the intestine. Am J Physiol Gastrointest Liver Physiol 2005;288:G1074–G1083 [DOI] [PubMed] [Google Scholar]
- 38.Hogan SP, Seidu L, Blanchard C, Groschwitz K, Mishra A, Karow ML, Ahrens R, Artis D, Murphy AJ, Valenzuela DM, et al. Resistin-like molecule beta regulates innate colonic function: barrier integrity and inflammation susceptibility. J Allergy Clin Immunol 2006;118:257–268 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Banerjee RR, Lazar MA. Dimerization of resistin and resistin-like molecules is determined by a single cysteine. J Biol Chem 2001;276:25970–25973 [DOI] [PubMed] [Google Scholar]
- 40.Junttila IS, Mizukami K, Dickensheets H, Meier-Schellersheim M, Yamane H, Donnelly RP, Paul WE. Tuning sensitivity to IL-4 and IL-13: differential expression of IL-4Ralpha, IL-13Ralpha1, and gammaC regulates relative cytokine sensitivity. J Exp Med 2008;205:2595–2608 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Bisset LR, Schmid-Grendelmeier P. Chemokines and their receptors in the pathogenesis of allergic asthma: progress and perspective. Curr Opin Pulm Med 2005;11:35–42 [DOI] [PubMed] [Google Scholar]
- 42.Pope SM, Zimmermann N, Stringer KF, Karow ML, Rothenberg ME. The eotaxin chemokines and CCR3 are fundamental regulators of allergen-induced pulmonary eosinophilia. J Immunol 2005;175:5341–5350 [DOI] [PubMed] [Google Scholar]
- 43.Pope SM, Fulkerson PC, Blanchard C, Akei HS, Nikolaidis NM, Zimmermann N, Molkentin JD, Rothenberg ME. Identification of a cooperative mechanism involving interleukin-13 and eotaxin-2 in experimental allergic lung inflammation. J Biol Chem 2005;280:13952–13961 [DOI] [PubMed] [Google Scholar]
- 44.Rose CE, Jr, Sung SS, Fu SM. Significant involvement of CCL2 (MCP-1) in inflammatory disorders of the lung. Microcirculation 2003;10:273–288 [DOI] [PubMed] [Google Scholar]
- 45.Herbert DR, Orekov T, Roloson A, Ilies M, Perkins C, O'Brien W, Cederbaum S, Christianson DW, Zimmermann N, Rothenberg ME, et al. Arginase I suppresses IL-12/IL-23p40–driven intestinal inflammation during acute schistosomiasis. J Immunol 2010;184:6438–6446 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Pesce JT, Ramalingam TR, Mentink-Kane MM, Wilson MS, El Kasmi KC, Smith AM, Thompson RW, Cheever AW, Murray PJ, Wynn TA. Arginase-1–expressing macrophages suppress Th2 cytokine–driven inflammation and fibrosis. PLoS Pathog 2009;5:e1000371. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Niese KA, Collier AR, Hajek AR, Cederbaum SD, O'Brien WE, Wills-Karp M, Rothenberg ME, Zimmermann N. Bone marrow cell derived arginase I is the major source of allergen-induced lung arginase but is not required for airway hyperresponsiveness, remodeling and lung inflammatory responses in mice. BMC Immunol 2009;10:33. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Yang M, Rangasamy D, Matthaei KI, Frew AJ, Zimmmermann N, Mahalingam S, Webb DC, Tremethick DJ, Thompson PJ, Hogan SP, et al. Inhibition of arginase I activity by RNA interference attenuates IL-13–induced airways hyperresponsiveness. J Immunol 2006;177:5595–5603 [DOI] [PubMed] [Google Scholar]
- 49.Hammad H, Chieppa M, Perros F, Willart MA, Germain RN, Lambrecht BN. House dust mite allergen induces asthma via Toll-like receptor 4 triggering of airway structural cells. Nat Med 2009;15:410–416 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Trompette A, Divanovic S, Visintin A, Blanchard C, Hegde RS, Madan R, Thorne PS, Wills-Karp M, Gioannini TL, Weiss JP, et al. Allergenicity resulting from functional mimicry of a Toll-like receptor complex protein. Nature 2009;457:585–588 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Friberg IM, Bradley JE, Jackson JA. Macroparasites, innate immunity and immunoregulation: developing natural models. Trends Parasitol 2010;26:540–549 [DOI] [PubMed] [Google Scholar]
- 52.Thomas WR. Molecular mimicry as the key to the dominance of the house dust mite allergen Der p 2. Expert Rev Clin Immunol 2009;5:233–237 [DOI] [PubMed] [Google Scholar]
- 53.Page K, Ledford JR, Zhou P, Dienger K, Wills-Karp M. Mucosal sensitization to German cockroach involves protease-activated receptor–2. Respir Res 2010;11:62. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Sookrung N, Chaicumpa W. A revisit to cockroach allergens. Asian Pac J Allergy Immunol 2010;28:95–106 [PubMed] [Google Scholar]
- 55.Lee SE, Jeong SK, Lee SH. Protease and protease-activated receptor–2 signaling in the pathogenesis of atopic dermatitis. Yonsei Med J 2010;51:808–822 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Perrigoue JG, Marshall FA, Artis D. On the hunt for helminths: innate immune cells in the recognition and response to helminth parasites. Cell Microbiol 2008;10:1757–1764 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Lenardon MD, Munro CA, Gow NA. Chitin synthesis and fungal pathogenesis. Curr Opin Microbiol 2010;13:416–423 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Harn DA, McDonald J, Atochina O, Da'dara AA. Modulation of host immune responses by helminth glycans. Immunol Rev 2009;230:247–257 [DOI] [PubMed] [Google Scholar]
- 59.Goldman DL, Davis J, Bommarito F, Shao X, Casadevall A. Enhanced allergic inflammation and airway responsiveness in rats with chronic Cryptococcus neoformans infection: potential role for fungal pulmonary infection in the pathogenesis of asthma. J Infect Dis 2006;193:1178–1186 [DOI] [PubMed] [Google Scholar]
- 60.Thompson RW, Pesce JT, Ramalingam T, Wilson MS, White S, Cheever AW, Ricklefs SM, Porcella SF, Li L, Ellies LG, et al. Cationic amino acid transporter–2 regulates immunity by modulating arginase activity. PLoS Pathog 2008;4:e1000023. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.







