Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2013 May 1.
Published in final edited form as: Anat Rec (Hoboken). 2012 Mar 7;295(5):864–871. doi: 10.1002/ar.22436

Ontogeny of Proteolytic Signaling and Anti-oxidant Capacity in Fetal and Neonatal Diaphragm

Yong Song 1,2, J Jane Pillow 1,2,3,*
PMCID: PMC3360929  NIHMSID: NIHMS371082  PMID: 22396157

Abstract

Whereas upregulation of protein degradation pathways contributes to the development of muscle weakness in response to muscle injury and inflammation in the adult diaphragm, less is known about the preterm diaphragm. Muscle development during the antenatal and early postnatal periods normally results in net growth. However, the structural and functional immaturity of the preterm diaphragm may predispose it to injury and inflammation induced by adverse antenatal and postnatal exposures. Characterization of the ontogeny of diaphragm protein degradation pathways in early life is essential to recognise altered signaling pathways under pathologic conditions in preterm babies.

We assessed the relative role of the major proteolytic pathways and antioxidant capacity during muscle maturation in ovine fetuses and lambs from 75 d to 200 d post-conceptual age. Gene expression and protein content of calpain and caspase 3 exhibited a similar profile with advancing gestation, increasing from 75 d to 100 d/128 d and subsequently decreasing gradually toward the end of gestation. In contrast, ubiquitin conjugating and ligase genes do not change during gestation. All proteolytic genes examined (except Ubiquitin) are up-regulated rapidly after delivery, with a similar developmental trend observed in calpain II protein content as well as calpain protease activity. In contrast, antioxidant gene expression demonstrated a steady increase from 75 d gestation until 24 h after birth, followed by a significant reduction at 7 w of postnatal age (p ≤ 0.002). The proteolytic signaling and antioxidant capacity patterns reflect the adaptive process to metabolic change and muscle maturity with development.

Keywords: ontogeny, diaphragm, calpain, caspase 3, ubiquitin-proteasome pathway, reactive oxygen species

INTRODUCTION

The diaphragm is a critical muscle for the successful establishment of spontaneous breathing. Inspiratory muscle weakness and atrophy are implicated in many pathological conditions such as cancer, sepsis or diabetes and ventilator-induced diaphragmatic dysfunction (VIDD). However, most studies of muscle atrophy are focused on the adult diaphragm (Powers et al., 2005; Ottenheijm et al., 2007; Supinski and Callahan, 2007). Preterm infants may be at increased risk of respiratory muscle weakness due to structural and functional immaturity of the diaphragm and intercostal muscles. Respiratory muscle immaturity may be further compromised by antenatal and early postnatal exposures such as malnutrition, steroids, chorioamnionitis, or postnatal mechanical ventilation, given these factors are known to affect diaphragm integrity in adult animal models (Dureuil and Matuszczak, 1998; Supinski and Callahan, 2007; Sassoon et al., 2008; Powers et al., 2009).

Although the underlying mechanisms are not fully understood, the development of muscle weakness is mainly attributed to accelerated protein degradation. Three well characterized major cell proteolytic systems act in a potentially coordinated manner to govern catabolic processes including the ubiquitin-proteasome pathway (UPP), calpain and caspase pathways. The UPP is a principal regulator of these dynamic processes for selective degradation of intracellular proteins and is constitutively active in muscle fibres, modulating both intracellular signaling events and normal protein metabolism (Reid, 2005). Whereas the proteasome system can break down monomeric contractile proteins (i.e., actin and myosin), it is unable to degrade the intact actinomyosin complexes that account for 50–70% total muscle proteins (Powers et al., 2007). Thus, apart from the definitive role of caspase 3 in directing cell apoptosis, activation of calpain and caspase 3 appears necessary for promoting disassociation of myofilaments from the sarcomere as monomeric proteins prior to UPP degradation (Powers et al., 2007). The UPP, calpain and caspase 3 systems were all activated and involved in muscle protein proteolysis in several different animal models (Reid, 2005; Powers et al., 2009) though the functional interconnection of their signaling mechanisms are not well understood.

Reactive oxygen species (ROS) are also prominent contributors to numerous cellular signaling pathways that mediate muscle wasting (Powers et al., 2005; Powers et al., 2007; Whidden et al., 2010). Protein breakdown associated disuse muscle atrophy is retarded by the delivery of exogenous antioxidants indicative of a link between oxidative injury and proteolysis (McClung et al., 2007; McClung et al., 2008; Whidden et al., 2010).

The developmental regulation of proteolytic signaling in the diaphragm is relatively unexplored but is essential in order to understand how adverse antenatal exposures (such as malnutrition, maternal glucocorticoid treatment and fatal inflammation secondary to chorioamnionitis) or postnatal events (mechanical ventilation of the preterm diaphragm) may cause diaphragm weakness and atrophy, For the healthy naïve subject, we hypothesised that proteolytic proteins and activity will either not change or decrease with advancing gestation, consistent with net diaphragm growth prior to birth. Further, we anticipated that the inclusion of a respiratory load postnatally may be associated with reactivation of proteolytic signaling and increased proteolytic protein expression. In the current study we aimed to characterise the ontogeny of proteolytic signaling and antioxidant capacity in healthy fetal and postnatal lambs to provide a baseline for subsequent investigations. The newborn lamb was used in the study as it is a convenient experimental model in which to further investigate adverse effects of antenatal exposure to inflammation, steroid and malnutrition and postnatal ventilation on diaphragm development.

MATERIALS AND METHODS

Animals

The study was approved by the Animal Ethics Committee of The University of Western Australia.

Caesarean delivery and sample collection

Anesthesia was induced in pregnant ewes at 75 d (n=3), 100 d (n=8), 128 d (n=12), or 145 d (n=8) gestation with medetomidine (0.02 mg/kg; Pfizer Animal Health, USA) and ketamine (10 mg kg−1; Troy Laboratories, Australia). Regional anesthesia was established with a 3 mL spinal injection of lignocaine (2 %, 20 mg/mL, Troy Laboratories, Australia) prior to midline abdominal incision, delivery, euthanasia (pentobarbitone, 100 mg/kg IV) and weighing of the fetus. An additional 14 lambs delivered spontaneously at full term (150 d), were allowed to breathe spontaneously for 24 h (n=7) and 7 w (n=7) respectively prior to euthanasia. Muscle biopsies were obtained immediately after death from the left costal hemi-diaphragm. The samples were frozen immediately in liquid nitrogen and stored at −80 °C until further analysis.

Gene expression assay

Total RNA was isolated from 30 mg of homogenized diaphragm tissue using the RNeasy Mini Kit according to manufacturer's instructions. Contaminating genomic DNA was removed by an on-column DNase I digestion performed using the DNase I digestion kit. Isolated RNA was reverse transcribed into complementary DNA (cDNA) in a 20 µL reaction with QuantiTect® Reverse Transcription Kit. All commercially available products were purchased from Qiagen (Doncaster, Australia).

The cDNA samples were diluted to a final volume of 60 µL in DNase-free water and 1 µL was added to a 25 µL qPCR reaction using Rotor-Gene SYBR Green PCR Kit (Qiagen Pty Ltd., Doncaster, Australia). Primers were designed to target the specific mRNA regions of the corresponding genes (see Table 1). Amplification and detection of the specific products were conducted on the Rotor-gene 3000 real time PCR system (Corbett Life Science, Mortlake, Australia). The cycling conditions for all genes were as follows: 5 min at 95 °C, 40 cycles of 5 s at 95 °C, 20 s at optimised annealing temperature (Table 1) and 20 s at 72 °C. The expression levels of genes of interest were normalized against 18S RNA (Van Harmelen et al., 2000) using 2−ΔΔCT method (Livak and Schmittgen, 2001). The near term group (145 d) was used as the reference control group, being representative of the normal starting condition for postnatal life.

Table 1.

Primer sequences designed for real time PCR.

Gene Primer sequence (5’-3’) Accession No. Tm
(°C)		 Size
(bp)
Calpain I F AGATCCGGCTGGAGGAGACGG AF316574 61 205
R AAGTCTCGCTTCAGATGCACGG
Calpain II F CTGATACACTCACCAGTGACACC AF071576 60 192
R ACCAGGAAGGTGCAGCCGCTCT
Caspase 3 F GACGTGGATGCAGCAAACCTCA AF068837 60 163
R TTCACCATGGCTTAGAAGCACG
E2 F AGCCGCCAACTGTTAGGTTTT GU551939 60 101
R TGTTGGACTCCATCTATTCTG
C8 F GAAGAAGGTTCCAACAAACGAC GU551938 60 76
R AGAACGAGCGTCTGCCAAC
Ubiquitin F CTTCGCATTCATTCACAGGTC NM_001009202 60 73
R CCTCCAGGGTGATGGTCTTG
MuRF-1 F GGCTGCCAATCCCTACTGGA EU525163 60 128
R GATTCCGCTGCAGGCCGTACACTC
MAFbx F GGTACTGAAAGTCCTTGAAGACC EU492872 60 198
R GGCCTGGTGATTTGGATGTTG
SOD F CGGCCTACGTGAACAACCTCAA AY221462 60 204
R CACGTTTGATGGCTTCCAGCAA
GPX-1 F AGGTGCTGCTCATTGAGAACG NM_174076.3 60 181
R TACTTCAGGCAATTCAGGATC
Open in a new tab

F - Forward; R - Reverse; MuRF – muscle ring finger; MAFbx – muscle atrophy box factor (atrogen-1); SOD – superoxide dismutase; GPX – glutathione peroxidase.

Protein extraction

Muscle samples were homogenized in ice-cold lysis buffer containing 20 mM HEPES pH 7.7, 2.5 mM MgCl2, 0.1 mM EDTA, 20 mM ²-glycerophosphate, 100 mM NaCl, 0.1 % Triton 100, 500 µM DTT, 100 µM Na3Vo4, 100 mM PMSF, 0.01 %NP40 and protease inhibitor cocktail tablet (Roche, Castle Hill, Australia). Homogenates were subjected to 6 cycles of freeze – thaw. The supernatant was centrifuged at 10 000 g for 25 min at 4 °C and total protein concentration measured by Bradford protein assay (Bradford, 1976).

Western blot analysis

Equal amounts (50 µg) of total lysate proteins were denatured in SDS loading buffer, boiled for 5 min, followed by centrifuging at 14 000 rpm for 5 min to remove insoluble material and then separated by 12 % SDS-PAGE and transferred to nitrocellulose membranes. After blocking in PBS containing 5 % non-fat dry milk, the membranes were incubated with primary antibodies against caspase 3, calpain II and α-Tubulin for 2 h at room temperature. Bound antibodies were detected with anti-rabbit immunoglobulin conjugated with horseradish peroxidise (HRP) for 1 h. All antibodies were purchased from Cell Signaling (USA) and used with 1:1000 dilutions. The blots were developed by adding a chemiluminescent substrate (Thermo Scientific, Massachusetts, USA) and quantified by computerized image analysis (ImageQuant™ 350, GE Healthcare). To avoid the variation across membranes arsing from different exposure time and transferring/blotting efficiency, a same control sample was added in each test. The values for each protein were standardized with the control sample and then normalized into α-Tubulin abundance.

Calpain activity assay

Calpain activity of the muscle samples was determined using a commercial kit (abcam, Waterloo, Australia) by quantifying cleavage of calpain substrate Ac-LLY-AFC in a fluorescence plate reader. The activity was expressed as Relative Fluorescent Unit (RFU) / per milligram protein of each sample.

20S proteasome assay

The chymotrypsin-like peptidase activity of the 20S proteasome was measured fluorometrically in crude extracts by following the release of free 7-amido-4-methylcoumarin (AMC) from synthetic peptide (Suc-LLVY-AMC) substrates (Enzo Life Sciences, Plymouth Meeting, USA).

Antioxidant enzyme activities

The total antioxidant capacity of diaphragmatic cell lysate was assessed using Antioxidant assay kit (Cayman Chemical, Ann Arbor, USA). The capacity of the antioxidants in the sample to prevent ABTS® oxidation was compared with that of Trolox and expressed as millimolar Trolox equivalents.

Statistical analysis

Sigmaplot (version 11.0, Systat Software Inc, San Jose, USA) was used for statistical analysis. For normally distributed (parametric) data, differences among multiple groups were determined using one-way ANOVA, followed by the Holm-Sidak/Dunn’s test as a post-hoc analysis if ANOVA indicated significance of the main effect significance. Nonparametric data were analysed using ANOVA on ranks. Fold change in mRNA expression was referenced to baseline expression at term (145 d) gestation, as representative of the naïve healthy state at birth. Correlations between outcome measure and maturational stage are presented as Pearson correlation coefficient. Statistical significance was accepted as p < 0.05. Data are presented as mean (SEM) or median (range).

RESULTS

Calpain and caspase 3 pathways

Progressive down-regulation of calpain I, calpain II and caspase 3 was observed with increasing fetal maturation (Fig 1A–C). Up-regulation of calpain II gene expression was evident within 24 h after delivery and onset of spontaneous breathing, with a similar trend evident for Caspase 3 mRNA gene expression. Caspase 3 expression correlated positively with both calpain I (r2 = 0.595, p < 0.001) and calpain II (r2 = 0.692, p < 0.001).

Figure 1. Calpain I (A), calpain II (B) and caspase 3 (C) mRNA expression.

Figure 1

Open in a new tab

samples obtained from fetal ovine diaphragm at 75 d, 100 d, 128 d and 145 d (near term) gestation and post-natal ages (150 d gestation) of 24 h and 7 w. Values are median (25th,75th centile) fold change relative to 145 d group. Error bars show 5th and 95th centiles. Horizontal dashed bar indicates median of reference (145 d) group. Vertical dotted line indicates change from fetal to postnatal life. * indicates p < 0.05 compared with 145 d (near-term) group. Bars indicate linear correlations.

Both calpain II and caspase 3 protein content exhibited similar developmental patterns, increasing from 75 d until 128 d with a fall between 128 d and 24 h postnatal age, followed by re-elevated protein content at 7 w (Fig 2A–C). There was a 5.7 fold increase in calpain II from 24 h to 7 w age. There was a significant, albeit weak, correlation between calpain II and caspase 3 protein content (r2= 0.138, p < 0.05). Additionally calpain II activity level was markedly higher in the 24 h group compared with 75 d (Fig 2D).

Figure 2. Calpain II and caspase 3 protein content and calpain Protease activity.

Figure 2

Open in a new tab

A) Western blots illustrate expression of calpain II and caspase 3 using representative samples from each group. Graphs show B) calpain II and C) caspase 3 (C) proteins and D) calpain activity in costal diaphragm at 75 d, 100 d, 128 d and 145 d (near term) gestation and post-natal ages of 24 h and 7 w. Values are median (25th,75th centile). Vertical dotted line indicates change from fetal to postnatal life. # p < 0.05 compared with 24 h group.

Ubiquitin-proteasome pathway

Three genes coding UPP E2 molecules (E2, C8 and Ubiquitin; Fig 3A–C) and two genes of UPP E3 (MAFbx and MuRF1; Fig 3D–E) were examined. There was no change in either UPP E2 or UPP E3 gene expression during fetal maturation. After birth, the mRNA level for E2, C8, MAFbx and MuRF1 increased, with a peak expression at 24 h for C8 and 7 w for E2, MAFbx and MuRF1 (p < 0.05). No significant changes in the 20S proteasome activity were observed across the different groups (Fig 3F).

Figure 3. Expression of ubiquitin-proteasome pathway components and proteasome activity.

Figure 3

Open in a new tab

Graphs show E2 (A), C8 (B), Ubiquitin (C), MuRF1 (D) and MAFbx (E) mRNA fold expression and 20S proteasome activity (F) in diaphragm at 75 d, 100 d, 128 d and 145 d (near term) gestation and post-natal ages (150 d gestation) of 24 h and 7 w. Values for mRNA expression are median (25th, 75th centile) with error bars showing 5th and 95th centile. Proteasome activity is expressed as mean (SEM). Horizontal dashed bar indicates median of reference (145 d) group. Vertical dotted line indicates change from fetal to postnatal life. ^,&,*,# p<0.05 vs 75 d, 100 d, and 145 d respectively.

Antioxidant system

There was a steady increase in glutathione peroxidise 1 (GPX1) mRNA expression from 128 d gestation until 24 h after birth (Fig 4A), with a similar pattern for SOD from 75 d gestation until 24 h post-delivery (Fig 4B). mRNA levels for both GPX1 and SOD at 7 w were decreased in comparison to measured levels at 24 h (p ≤ 0.002), to a level comparable with that in late gestation prior to onset of spontaneous breathing, but remained elevated compared to early fetal (75–100 d) levels (p ≤ 0.002). Antioxidant activity increased with fetal maturation, with a plateau occurring at 128 d gestation (r2 = 0.48, p< 0.001, Fig 4C).

Figure 4. Expression of anti-oxidant genes and antioxidant activity.

Figure 4

Open in a new tab

GPX1 (A) and SOD (B) mRNA and antioxidant activity (C) in diaphragm at 75 d, 100 d, 128 d and 145 d (near term) gestation and post-natal ages (150 d gestation) of 24 h and 7 w. Values for mRNA expression are median (25th,75th centile). The error bars show 5th and 95th centile. Antioxidant activity is expressed as mean (SEM). *, # , + indicates p ≤ 0.05 compared with 145 d, 24 h and 7 w groups respectively.

DISCUSSION

We describe the ontogeny of key components of the proteolytic (calpain, caspase 3 and ubiquitin proteasome) and oxidant defence pathways from mid-fetal through to early postnatal ovine diaphragm muscle.

We observed a gradual fall in the basal level of expression of calpain and caspase 3 from mid-gestation (75–100 d) until term, coupled with a similar fall in calpain and caspase 3 protein content in late gestation. The calpain and caspase 3 proteases operate in concert by degrading both cytoskeletal proteins and actomyosin complexes in muscle tissue (Powers et al., 2005; Powers et al., 2007). A simultaneous or sequential increase in skeletal muscle calpain and caspase 3 content and activity is observed in catabolic disease (Warren et al., 2005; Powers, 2009; Powers et al., 2009). The coupling of calpain and caspase 3 gene expression patterns in the ovine fetal diaphragm is consistent with the recent observation (Nelson et al., 2010) that calpain inhibition prevented the activation of caspase 3 and vice versa in mechanical ventilation induced diaphragmatic atrophy, suggestive of regulatory crosstalk between calpain and caspase 3. Whereas the mRNA levels fell from mid-gestation onwards, there was an increase in protein content for calpain II and caspase 3 from 75 d until 128 d gestation pattern. Together with a similar disconnect between gene expression and protein content for Calpain II and Caspase 3 in the postnatal period, these findings are suggestive of post-transcriptional regulation and/or differences in mRNA and protein turnover rates.

The role of UPP as a major proteolytic pathway is well known. It primarily signals protein degradation through a two-step process that involves substrate recognition through coordinative function of three enzyme systems and protein degradation by the 26S proteasome (Reid, 2005). Since the enzyme (E) 1 protein and 26S proteasome are abundant in most mammalian cells and are constitutively active, E2/E3 proteins and their interaction are regarded as the primary regulatory step (Reid, 2005). To better reflect the activity of the proteasome pathway, E2 and E3 gene expression patterns y analysed in combination with the chymotrypsin-like activity of the proteasome in diaphragm muscle. In contrast to calpain and caspase 3, E2 (E2, C8 and Ubiquitin) and E3 (MuRF1 and MAFbx) gene expression did not change during in utero development. Nevertheless, there was a rapid up-regulation in UPP genes after birth, similar to the patterns observed for calpain II and caspase 3 mRNA and Calpain II protein content. The alteration of UPP is likely to be regulated in the post-transcriptional level as the proteasome activity remained unchanged.

Together, these findings suggest that proteolytic signaling gradually decreases with increasing fetal maturity. Protein turnover is the balance between protein synthesis and protein degradation. The insulin-like growth factor 1 (IGF-1)/protein kinase (Akt) pathway is a vital upstream trigger responsible for regulating protein synthesis pathways (Glass, 2005). Although IGF-1 protein content in fetal sheep muscle (Fahey et al., 2005) and both insulin receptor and total Akt protein content in fetal baboons (Blanco et al., 2010) decreases in late gestation, the phosphorylated to total Akt levels do not change over the same period (Blanco et al., 2010) indicating maintenance of a steady rate of protein synthesis throughout in utero life. Given our observation of a reduction in the proteolytic (calpain and Caspase 3) proteins in late gestation, a steady rate of protein synthesis would be consistent with a net gain in muscle protein and hence muscle growth during in utero diaphragm development.

We observed a reactivation of the calpain and caspase 3 proteolytic pathways and upregulation of the UPP pathway after birth. The increased level of postpartum proteolysis is most likely an adaptive response to stimuli such as passive stretch of the muscle, reactive oxygen species (ROS) and nutritional influences, but may also represent a beneficial strategy to remove an over-production of muscle fibres, with such a “wastage” of new fibres that fail to reach maturity (Waterlow and Jackson, 1981). The postnatal period is also characterised by rapid muscle growth and increase in protein synthesis with the mechanisms associated with activation of the IGF-1/Akt/mTOR pathways (Davis et al., 2008; Suryawan and Davis, 2010). For continued postnatal muscle growth, upregulation of the IGF-1/Akt/mTOR pathways would need to at least equal the level of upregulation of associated proteolytic pathways during early postnatal life.

ROS are also important regulators of multiple cellular signaling pathways that modulate muscle protein breakdown and muscle proteins are inherently susceptible to oxidant stress which increases their proteolytic susceptibility (Sitte et al., 2000). Premature infants have increased susceptibility to oxidative stress compared to mature infants and due to under-developed antioxidant system (Asikainen et al., 1998) and a consequent imbalance of ROS production and antioxidant capacity. (Matsubasa et al., 2002). In mammalian cells, the defence against oxidative stress depends on an orchestrated synergism amongst the antioxidant enzymes. For example, hydrogen peroxide formed by the catalytic reaction of SOD is further detoxified by GPX and/or catalase. Our observation of a steady increase in both SOD and GPX1 gene expression in the lamb diaphragm from mid-gestation with a plateau in antioxidant activity from 128 d gestation is consistent with an increased susceptibility of the extremely preterm lamb to diaphragmatic oxidative stress. Maturation of the anti-oxidant system by near term indicates readiness for normal function in the relatively oxygen-rich ex utero tissue environment. Although there was a trend for anti-oxidant gene expression to increase 24 h after birth followed by a significant decline from 24 h to 7 w after birth, this was not reflected by a change in antioxidant activity and hence is of uncertain significance. As ROS can induce gene expression of MuRF1 and MAFbx via FOXO and NF-κB pathways (Pantano et al., 2006; Powers et al., 2007; Mallinson et al., 2009; Dodd et al., 2010) and increase caspase and calpain activation (Powers et al., 2005), the role of ROS as a trigger for re-activation of the proteolytic signaling pathways after birth needs to be investigated further.

Conclusions

In summary, we described the ontogenic profile of major components of proteolytic signaling and anti-oxidant capacity in fetal and early postnatal lamb diaphragm. Proteolytic signaling decreased whilst anti-oxidant capacity increased reflecting an adaptive process to metabolic change and muscle maturation with advancing gestation. Reactivation of proteolytic signaling pathways after birth is consistent with increased muscle activity but may also be influenced by ROS. These data provide an important baseline for future studies of the immature diaphragm that aim to improve understanding of the susceptibility of preterm infants to respiratory failure in response to injurious ventilation and/or clinical stressors such as inflammation and hypoxia.

ACKNOWLEDGEMENTS

Grant sponsors:

Women and Infants Research Foundation, Western Australia; Grant number: 2010 Starter Grant; The National Institutes of Health; Grant number: R21 AI0697; National Health and Medical Research Council, Grant number: APP1010665; Sylvia and Charles Viertel Senior Medical Research Fellowship (JJP).

The authors acknowledge the support and technical assistance of Tina Lavin, Clare Berry, Graeme Polglase, Ilias Nitsos, Carryn McLean, Alan Jobe, Jenni Henderson and Andre Lee in animal care and tissue collection.

LITERATURE CITED

  1. Asikainen TM, Raivio KO, Saksela M, Kinnula VL. Expression and developmental profile of antioxidant enzymes in human lung and liver. Am J Respir Cell Mol Biol. 1998;19:942–949. doi: 10.1165/ajrcmb.19.6.3248. [DOI] [PubMed] [Google Scholar]
  2. Blanco CL, Liang H, Joya-Galeana J, DeFronzo RA, McCurnin D, Musi N. The ontogeny of insulin signaling in the preterm baboon model. Endocrinology. 2010;151:1990–1997. doi: 10.1210/en.2009-0777. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248–254. doi: 10.1016/0003-2697(76)90527-3. [DOI] [PubMed] [Google Scholar]
  4. Davis TA, Suryawan A, Orellana RA, Nguyen HV, Fiorotto ML. Postnatal ontogeny of skeletal muscle protein synthesis in pigs. J Anim Sci. 2008;86:E13–E18. doi: 10.2527/jas.2007-0419. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Dodd SL, Gagnon BJ, Senf SM, Hain BA, Judge AR. Ros-mediated activation of NF-kappaB and Foxo during muscle disuse. Muscle Nerve. 2010;41:110–113. doi: 10.1002/mus.21526. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Dureuil B, Matuszczak Y. Alteration in nutritional status and diaphragm muscle function. Reprod Nutr Dev. 1998;38:175–180. doi: 10.1051/rnd:19980204. [DOI] [PubMed] [Google Scholar]
  7. Fahey AJ, Brameld JM, Parr T, Buttery PJ. Ontogeny of factors associated with proliferation and differentiation of muscle in the ovine fetus. J Anim Sci. 2005;83:2330–2338. doi: 10.2527/2005.83102330x. [DOI] [PubMed] [Google Scholar]
  8. Glass DJ. Skeletal muscle hypertrophy and atrophy signaling pathways. Int J Biochem Cell Biol. 2005;37:1974–1984. doi: 10.1016/j.biocel.2005.04.018. [DOI] [PubMed] [Google Scholar]
  9. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) Method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  10. Mallinson JE, Constantin-Teodosiu D, Sidaway J, Westwood FR, Greenhaff PL. Blunted Akt/FOXO signalling and activation of genes controlling atrophy and fuel use in statin myopathy. J Physiol. 2009;587:219–230. doi: 10.1113/jphysiol.2008.164699. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Matsubasa T, Uchino T, Karashima S, Kondo Y, Maruyama K, Tanimura M, Endo F. Oxidative stress in very low birth weight infants as measured by urinary 8-OHdG. Free Radic Res. 2002;36:189–193. doi: 10.1080/10715760290006510. [DOI] [PubMed] [Google Scholar]
  12. McClung JM, Kavazis AN, Whidden MA, DeRuisseau KC, Falk DJ, Criswell DS, Powers SK. Antioxidant administration attenuates mechanical ventilation-induced rat diaphragm muscle atrophy independent of protein kinase B (PKB Akt) signalling. J Physiol. 2007;585:203–215. doi: 10.1113/jphysiol.2007.141119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. McClung JM, Whidden MA, Kavazis AN, Falk DJ, Deruisseau KC, Powers SK. Redox regulation of diaphragm proteolysis during mechanical ventilation. Am J Physiol Regul Integr Comp Physiol. 2008;294:R1608–R1617. doi: 10.1152/ajpregu.00044.2008. [DOI] [PubMed] [Google Scholar]
  14. Nelson WB, Smuder AJ, Hudson MB, Talbert EE, Powers SKF. Calpain And Caspase-3 Participate In Regulatory Crosstalk During Disuse Muscle Atrophy. Medicine & Science in Sports & Exercise. 2010;42:18. [Google Scholar]
  15. Ottenheijm CA, Heunks LM, Dekhuijzen PN. Diaphragm muscle fiber dysfunction in chronic obstructive pulmonary disease: toward a pathophysiological concept. Am J Respir Crit Care Med. 2007;175:1233–1240. doi: 10.1164/rccm.200701-020PP. [DOI] [PubMed] [Google Scholar]
  16. Pantano C, Reynaert NL, van der Vliet A, Janssen-Heininger YM. Redox-sensitive kinases of the nuclear factor-kappaB signaling pathway. Antioxid Redox Signal. 2006;8:1791–1806. doi: 10.1089/ars.2006.8.1791. [DOI] [PubMed] [Google Scholar]
  17. Powers SK. Calpain and caspase-3 are required for sepsis-induced diaphragmatic weakness. J Appl Physiol. 2009;107:1369. doi: 10.1152/japplphysiol.00920.2009. [DOI] [PubMed] [Google Scholar]
  18. Powers SK, Kavazis AN, DeRuisseau KC. Mechanisms of disuse muscle atrophy: role of oxidative stress. Am J Physiol Regul Integr Comp Physiol. 2005;288:R337–R344. doi: 10.1152/ajpregu.00469.2004. [DOI] [PubMed] [Google Scholar]
  19. Powers SK, Kavazis AN, Levine S. Prolonged mechanical ventilation alters diaphragmatic structure and function. Crit Care Med. 2009;37:S347–S353. doi: 10.1097/CCM.0b013e3181b6e760. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Powers SK, Kavazis AN, McClung JM. Oxidative stress and disuse muscle atrophy. J Appl Physiol. 2007;102:2389–2397. doi: 10.1152/japplphysiol.01202.2006. [DOI] [PubMed] [Google Scholar]
  21. Reid MB. Response of the ubiquitin-proteasome pathway to changes in muscle activity. Am J Physiol Regul Integr Comp Physiol. 2005;288:R1423–R1431. doi: 10.1152/ajpregu.00545.2004. [DOI] [PubMed] [Google Scholar]
  22. Sassoon CS, Zhu E, Pham HT, Nelson RS, Fang L, Baker MJ, Caiozzo VJ. Acute effects of high-dose methylprednisolone on diaphragm muscle function. Muscle Nerve. 2008;38:1161–1172. doi: 10.1002/mus.21048. [DOI] [PubMed] [Google Scholar]
  23. Sitte N, Merker K, Von Zglinicki T, Davies KJ, Grune T. Protein oxidation and degradation during cellular senescence of human BJ fibroblasts: part II--aging of nondividing cells. FASEB J. 2000;14:2503–2510. doi: 10.1096/fj.00-0210com. [DOI] [PubMed] [Google Scholar]
  24. Supinski GS, Callahan LA. Free radical-mediated skeletal muscle dysfunction in inflammatory conditions. J Appl Physiol. 2007;102:2056–2063. doi: 10.1152/japplphysiol.01138.2006. [DOI] [PubMed] [Google Scholar]
  25. Suryawan A, Davis TA. The abundance and activation of mTORC1 regulators in skeletal muscle of neonatal pigs are modulated by insulin, amino acids, and age. J Appl Physiol. 2010;109:1448–1454. doi: 10.1152/japplphysiol.00428.2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Van Harmelen V, Ariapart P, Hoffstedt J, Lundkvist I, Bringman S, Arner P. Increased adipose angiotensinogen gene expression in human obesity. Obes Res. 2000;8:337–341. doi: 10.1038/oby.2000.40. [DOI] [PubMed] [Google Scholar]
  27. Warren MW, Kobeissy FH, Liu MC, Hayes RL, Gold MS, Wang KK. Concurrent calpain and caspase-3 mediated proteolysis of alpha II-spectrin and tau in rat brain after methamphetamine exposure: a similar profile to traumatic brain injury. Life Sci. 2005;78:301–309. doi: 10.1016/j.lfs.2005.04.058. [DOI] [PubMed] [Google Scholar]
  28. Waterlow JC, Jackson AA. Nutrition and protein turnover in man. Br Med Bull. 1981;37:5–10. doi: 10.1093/oxfordjournals.bmb.a071676. [DOI] [PubMed] [Google Scholar]
  29. Whidden MA, Smuder AJ, Wu M, Hudson MB, Nelson WB, Powers SK. Oxidative stress is required for mechanical ventilation-induced protease activation in the diaphragm. J Appl Physiol. 2010;108:1376–1382. doi: 10.1152/japplphysiol.00098.2010. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES