Skip to main content
NCBI home page
Clinical and Translational Gastroenterology logoLink to Clinical and Translational Gastroenterology
. 2012 May 10;3(5):e15. doi: 10.1038/ctg.2012.9

Bifidobacterium Infantis 35624 Protects Against Salmonella-Induced Reductions in Digestive Enzyme Activity in Mice by Attenuation of the Host Inflammatory Response

Erin L Symonds 1,4,*, Caitlin O'Mahony 1, Susan Lapthorne 1,2, David O'Mahony 3, John Mac Sharry 3, Liam O'Mahony 1,3,5, Fergus Shanahan 1,2,3
PMCID: PMC3367613  PMID: 23238232

Abstract

OBJECTIVES:

Salmonella-induced damage to the small intestine may decrease the villi-associated enzyme activity, causing malabsorption of nutrients and diarrhea, and thus contribute to the symptoms of infection. The objective of this study was to determine the mechanism by which different doses and durations of Salmonella infection and lipopolysaccharide (LPS) affect brush border enzyme activity in the mouse, and to determine if the probiotic Bifidobacterium longum subspecies infantis 35624 could attenuate the intestinal damage.

METHODS:

BALB/c mice were challenged with Salmonella enterica serovar Typhimurium UK1 at various doses (102–108 colony-forming unit (CFU)) and durations (106 CFU for 1–6 days). Mice were also treated with B. longum subsp. infantis 35624 for 2 weeks before and during a 6-day S. Typhimurium challenge (106 CFU), or before injection of LPS. The small intestine was assessed for morphological changes, mRNA expression of cytokines, and activity of the brush border enzymes sucrase–isomaltase, maltase, and alkaline phosphatase.

RESULTS:

S. Typhimurium infection significantly reduced the activity of all brush border enzymes in a dose- and time-dependent manner (P<0.05). This also occurred following injection of LPS. Pre-treatment with B. longum subsp. infantis 35624 prevented weight loss, protected brush border enzyme activity, reduced the small intestinal damage, and inhibited the increase in interleukin (IL)-10 and IL-8 expression due to Salmonella challenge.

CONCLUSIONS:

Salmonella infection reduces the small intestinal brush border enzyme activity in mice, with the level of reduction and associated weight loss increasing with dose and duration of infection. B. longum subsp. infantis 35624 treatment attenuated the effect of Salmonella infection on brush border enzyme activity and weight loss, which may be due to modulation of the host immune response.

INTRODUCTION

The gastrointestinal tract can be affected by a number of pathogens that disturb the normal function and cause diarrhea, with salmonellosis being one of the most common foodborne diseases. Diarrheal diseases are a leading cause of childhood morbidity and mortality in developing countries; however, the use of antibiotic therapy for salmonellosis is being questioned because of the emergence of multidrug-resistant strains of Salmonella.1 Alternative therapies and preventative strategies are therefore required.

The presence of pathogens within the gastrointestinal tract can cause a number of host immune responses and pathological effects, including the modification of epithelial function to enhance penetration across the epithelial barrier (reviewed in Lu and Walker2). Salmonella is one such pathogen that attaches to the epithelial cells in the gastrointestinal tract, resulting in degeneration of the microvilli and membrane ruffling (reviewed in Lu and Walker2). This affects small intestinal function, resulting in decreased brush border enzyme activity.3, 4, 5 Brush border enzymes, such as sucrase–isomaltase and maltase, play an important role in the digestion of carbohydrates and therefore reduced activity results in undigested food in the intestine, causing maldigestive diarrhea,6 which contributes to the gastrointestinal symptoms of Salmonella infection. The underlying mechanisms for decreased enzyme activity have not been completely determined. Many studies have only assessed enzyme activity of the ileum as Salmonella is known to appear in the terminal ileum, cecum, and colon;7 however, since the jejunum is a main area for nutrient digestion and uptake, it is important to assess if infection also affects jejunal brush border enzymes. In addition, studies have mainly assessed the effect of infection on the disaccharidase enzymes involved in carbohydrate digestion, including sucrase–isomaltase and maltase. Intestinal alkaline phosphatase (ALP) is a brush border enzyme unrelated to carbohydrate digestion that catalyses the hydrolysis of phosphomonoesters in an alkaline environment, and is thought to participate in regulating fat absorption.8 This enzyme is therefore also important to assess in disease states, as an alteration to its activity may affect fat digestion.

There is increasing interest in the use of probiotics for disease prevention and health benefits. In vitro studies suggest that certain probiotic strains can inhibit Salmonella growth,9, 10, 11 adhesion12 and cell invasion,13 and alter immune responses, e.g., by reducing interleukin (IL)-8 secretion14 and decreasing tumor necrosis factor (TNF)-α production in the small intestine.15 Few in vivo studies have been performed, but report increased survival, reduced intestinal damage,16, 17 and decreased translocation of Salmonella to the liver and spleen.18, 19 In addition, the probiotic Bifidobacterium infantis 35624 reduces the inflammatory activity associated with Salmonella infection by the induction of T regulatory cells.20, 21 No study has assessed the effect of probiotics on brush border enzyme activity following Salmonella infection. It was hypothesized that Salmonella would significantly reduce the digestive enzyme activity of the gastrointestinal tract, and that treatment with the probiotic B. longum subspecies infantis 35624 would attenuate the activation of the inflammatory immune response and reduce the gastrointestinal damage. The aims of the following studies were therefore to establish the effect of different doses and duration of Salmonella infection on small intestinal function in mice and to determine the effect of B. longum subsp. infantis 35624 treatment on disease pathology.

Methods

Studies were conducted in specific pathogen-free BALB/c mice (>10 weeks; Harlan UK, Bicester, UK). Mice were housed in a 12 h light:12 h dark cycle at 21 °C. They were fed a standard pellet diet and water ad libitum. All studies were approved by the animal ethics committee of University College Cork (Cork, Ireland).

Bacterial culture

Challenge doses of Salmonella for the following studies were prepared by inoculating trypsin soy broth (Oxoid, Basingstoke, UK) with Salmonella enterica serovar Typhimurium UK1 and growing it aerobically overnight (37 °C). The broth was centrifuged (1,600 × g, 5 min) and the pellet was resuspended in phosphate-buffered saline (PBS). The colony count was determined by serial dilution in PBS and spread plating on trypsin soy agar (Oxoid, Basingstoke, UK). Agar plates were aerobically incubated (37 °C) for 24 h, following which the bacteria was enumerated and the appropriate inoculation concentrations could be prepared by dilution of the culture in PBS.

The probiotic used in the following studies was freeze-dried B. longum subsp. infantis 35624 (Alimentary Health Ltd, Cork, Ireland), which was administered to mice via drinking water that was refreshed daily. The quantity of B. longum subsp. infantis 35624 added to the drinking water allowed mice to consume approximately 108 colony-forming units (CFU) per day. For the study assessing quantification of the bifidobacteria within the mouse gastrointestinal tract, a freeze-dried rifampicin-resistant B. longum subsp. infantis 35624 (spontaneous rifampicin-resistant variant) was used.

Effect of Salmonella dose and disease duration on small intestinal function

To determine the effect of infection dose on intestinal function, mice were orally inoculated by placing a pipette tip in the mouth and administering 20 μl of 102, 104 or 106 CFU S. Typhimurium UK1 (n=10 per group). A further two groups (n=8 per group) received 107 or 108 CFU. All mice were killed at day 6 post-challenge. The effect of duration of infection was determined by challenging mice with 106 CFU S. Typhimurium UK1 and being killed at days 1 (n=10), 3 (n=10) and 6 (n=10) post-challenge. Results were compared with non-infected mice (n=10). All S. Typhimurium UK1 challenge concentrations were confirmed by spread plating on to trypsin soy agar as described above.

Mice were monitored and weighed throughout the study. At the study end point, mice were killed via cervical dislocation, and the small intestine was removed and divided into jejunum (proximal half) and ileum (distal half). The distal 1 cm sections of the jejunum and ileum were stored in cassettes in 10% neutral-buffered formalin (Sigma-Aldrich, St Louis, MO, USA) for histology. The neighboring 2 cm sections were stored at −80 °C until analyzed for enzyme activity. The remaining small intestine, spleen, and liver were used for Salmonella quantification. To investigate the effect of duration of Salmonella infection on intestinal gene expression of cytokines and chemokines, a subgroup of mice from the duration of infection study (n=5 per group) had an additional 1 cm tissue section removed from the jejunum and stored in RNAlater (Ambion, Warrington, UK) at −80 °C until it was processed for RNA extraction.

Colonization site of B. longum subsp. infantis 35624 and effect on small intestinal function

To determine the colonization site for B. longum subsp. infantis 35624, healthy mice (n=6) were fed approximately 108 CFU per day rifampicin-resistant B. longum subsp. infantis 35624 in drinking water for 3 weeks (refreshed daily). After 3 weeks, mice were euthanized. The liver, spleen, small intestine (proximal, mid and distal), cecum, and large intestine (proximal and distal), as well as the removed luminal contents, were collected. Samples were mechanically disrupted in PBS in stomacher bags (Seward, Thetford, UK), and serial dilutions were plated on reinforced clostridial agar (Merck, Darmstadt, Germany) containing 0.05% L-cysteine hydrochloride (Sigma-Aldrich) and 50 mg/ml rifampicin (Sigma-Aldrich). Plates were incubated for 48 h (37 °C) in an anaerobic chamber. The use of rifampicin eliminated the growth of the other intestinal bacteria on the plate, and allowed enumeration of the B. longum subsp. infantis 35624, which was expressed as CFU/g sample.

To determine the effect of B. longum subsp. infantis 35624 on brush border enzyme activity, mice were given 108 CFU B. longum subsp. infantis 35624 or regular water (n=10 per group). Following 3 weeks of administration, mice were euthanized and sections of jejunum were analyzed for enzyme activity.

Effect of B. longum subsp. infantis 35624 pre-treatment on Salmonella pathology

Mice (n=6) were administered 108 CFU per day B. longum subsp. infantis 35624 (Alimentary Health Ltd) in drinking water for 2 weeks before and for 6 days following challenge with Salmonella. S. Typhimurium (106 CFU) was orally administered and mice were euthanized 6 days post-challenge. The jejunum was removed and stored for histology, RNA extraction and analysis of enzyme activity. The remaining small intestine, spleen, and liver were collected for quantification of S. Typhimurium. Results were compared with age-matched healthy control mice (n=6) and S. Typhimurium UK1-infected mice (106 CFU, n=6) that received no probiotics.

To investigate the mechanisms underpinning the Salmonella-induced decrease in digestive enzyme activity, mice were challenged with lipopolysaccharide (LPS) from Salmonella. LPS was administered via the intraperitoneal route (rather than orally) to exclude any mechanism that may involve morphological alterations to the apical side of the epithelial cells. Mice were injected (intraperitoneally) with 2 mg/kg LPS (Sigma-Aldrich) following 3 weeks of 108 CFU per day B. longum subsp. infantis 35624 (n=9) or water alone (n=9). At 3 h following LPS, mice were euthanized. The jejunum was removed and analyzed for brush border enzyme activity. The results were compared with age-matched non-challenged mice (n=9).

Histology

Following storage in 10% neutral-buffered formalin, intestinal samples were processed and embedded in paraffin. Cross-sections were cut at 3 μm, attached to glass slides, and stained with hematoxylin and eosin. Villus height and crypt depth were determined from more than five sites. Only well-orientated villi and crypts were assessed and measurements were made in a blinded manner by two observers (Olympus BX51 upright microscope with Olympus DP Soft imaging capturing software).

Enzyme analysis

Intestinal tissue samples were homogenized in PBS (T10 basic Ultra-Turrax, IKA, Staufen, Germany), centrifuged (2,000 × g, 10 min, 4 °C), and the supernatant was used in the assays. The samples were assayed for sucrase–isomaltase and maltase,22 and ALP23 activity using published methods but modified for a 96-well plate. Enzyme activity was expressed as specific activity (units per milligram of protein (assessed with the Bradford protein assay)24). For disaccharidases, 1 U was defined as the activity that produces 1 μmol glucose per min per mg protein. For ALP, 1 U was defined as the activity that hydrolyses 1 μmol p-nitrophenol phosphate per min per mg protein.

Salmonella quantification from mouse tissue

Tissues were homogenized in PBS in stomacher bags, and DNA was extracted (DNAeasy tissue kit; Qiagen, Crawley, UK) and quantified (NanoDrop Technologies, Wilmington, DE). Levels of Salmonella were quantified with real-time polymerase chain reaction using the LightCycler TaqMan Master kit (Roche Diagnostics, East Sussex, UK). DNA (20 ng) was used in the reaction with universal probe library and primers for the invasion gene specific to S. Typhimurium UK1 (designed using Roche Probelibrary system; Roche; Table 1). Cycling conditions were 95 °C for 10 min, and 45 cycles of 95 °C for 10 s, followed by 55 °C for 30 s and 72 °C for 30 s. Absolute quantification of Salmonella was performed by relating the polymerase chain reaction signal to a standard curve of S. Typhimurium UK1 DNA.

Table 1. Primer sequences for mouse mRNA targets with probe library number (Roche Diagnostics).

Primer Forward sequence (5′–3′) Reverse sequence (5′–3′) ProbeLibrary#
S. Typhimurium UK1 invasion gene TGTCCTCCGCTCTGTCTACTT ATCAACAATGCGGGGATCT 9
Sucrase-isomaltase CACAATGCTGAAGGCTATGC TGCCTTGATGTGTTTACCAAAA 32
Maltase-glucoamylase ATTCAAGTTCGCCGAAAGAG TGAAGGTGAAGCCGAGGA 95
Alkaline phosphatase TCAGACATCAGCTAAGAACCTCA TCCAACTGCCCCTTTAGGAT 83
IFN-γ ATCCTGGAGGAACTGGCAAAA TTCAAGACTTCAAAGAGTCTGAGGT 21
TNF-α CTGTAGCCCACGTCGTAGC TTGAGATCCATGCCGTTG 25
TGF-β GAGCTGCTTATCCCAGATTCA GGCAGTGGAGACGTCAGATT 20
IL-1β TGTAATGAAAGACGGCACACC TCTTCTTTGGGTATTGCTTGG 78
KC ATAATGGGCTTTTACATTCTTTAACC AGTCCTTTGAACGTCTCTGTCC 2
IL-10 CAGAGCCACATGCTCCTAGA GTCCAGCTGGTCCTTTGTTT 41
Open in a new tab

IFN-γ, interferon-γ IL, interleukin; KC, keratinocyte chemoattractant: murine homolog for human IL-8; TGF-β, transforming growth factor-β TNF-α, tumor necrosis factor-α.

Gene expression

Tissue sections were homogenized in lysis buffer (Stratagene, Milton Keynes UK) using MagNA Lyser Green Beads (Roche), and RNA was extracted (Absolutely RNA Miniprep kit; Stratagene) and quantified (Nanodrop). RNA quality was assessed with the RNA 2100 Pico Labchip Kit (Agilent Technologies, Amstelveen, The Netherlands). To prepare cDNA, RNA (1 μg) was annealed to random primers (150 ng) (Roche) and then reverse transcribed at 42 °C for 50 min in a reaction containing 25 mM MgCl2, 10 mM deoxynucleoside triphosphate mix, 5 × reaction buffer, RNase inhibitor, and reverse transcriptase enzyme (Promega, Southampton, UK). The reaction was terminated by heat inactivation (70 °C, 15 min).

Quantitative real-time reverse transcriptase-polymerase chain reaction was performed using the LightCycler TaqMan Master kit (Roche). cDNA (5 μl) was used in the reaction with 1 μl of each primer and 0.2 μl universal probe library. Cycling conditions were as described for Salmonella quantification. Primers for mouse sucrase–isomaltase, maltase, ALP, interleukin (IL)-1β, IL-10, tumor necrosis factor (TNF)-α, transforming growth factor (TGF)-β, keratinocyte chemoattractant (KC: murine homolog for human IL-8), and interferon (IFN)-γ were designed using Roche ProbeLibrary system (Table 1). Amplification of β-actin was included as an endogenous control. The parameter threshold was defined as the fractional cycle number at which the fluorescence generated by cleavage of the probe passed a fixed threshold above the baseline value. Relative mRNA expression levels were calculated with the formula 2−ΔΔCT, where the threshold cycle (CT) of the target gene is normalized to β-actin expression and relative to the control group.

Data analysis

Data are expressed as mean±s.e. Comparison between control and challenged mice was performed with a one-way analysis of variance, with a P-value <0.05 considered significant. Where significant, the Holm–Sidak post-hoc test was performed to determine the differences compared with the control mice. Correlations were performed with a Spearman rank test. All statistical analyses were performed with SigmaStat (version 3.0.1a; SPSS Inc., Chicago, IL).

RESULTS

Salmonella dose on small intestinal function

Following 6 days of Salmonella infection all mice had diarrhea and weight loss, with the weight loss greater in the mice challenged with 106, 107, and 108 CFU compared with healthy controls (weight change compared with baseline: non-infected mice=1.41±0.87%, 102 CFU=−1.95±2.50%, 104 CFU=−2.84±1.19%, 106 CFU=−7.04±2.62%, 107 CFU=−11.37±2.66%, 108 CFU=−10.50±1.38%, P<0.001). Two mice that had been challenged with 108 CFU had to be euthanized early because of severity of disease and therefore were excluded from the analysis. Quantification of Salmonella showed no differences in the levels recovered from the liver, spleen, or small intestine from the different challenge groups (Table 2). No Salmonella was recovered from the non-challenged mice. There was a negative correlation between infection dose with jejunal villi length (r=−0.764, P<0.001) and crypt depth (r=−0.518, P<0.001), with villi and crypt length reduced to 70% of control levels. These structural alterations were restricted to the jejunum as changes to the ileum did not reach significance (P>0.05).

Table 2. Levels of S. Typhimurium UK1 (log10 CFU/g tissue) in the liver, spleen, and small intestine of mice following challenge with 102, 104, 106, 107, and 108 CFU S. Typhimurium UK1.

  S. Typhimurium UK1 inoculation dose
  102 CFU (n=10) 104 CFU (n=10) 106 CFU (n=10) 107 CFU (n=8) 108 CFU (n=6)
Liver 4.33±0.95 5.19±0.88 6.08±0.44 6.37±0.47 6.69±0.28
Spleen 6.55±0.31 6.87±0.20 6.69±0.43 6.43±0.96 7.39±0.26
Small intestine 6.26±0.24 6.28±0.24 5.27±0.78 4.77±0.68 4.58±0.32
Open in a new tab

CFU, colony-forming unit.

Data are mean±s.e. There were no significant differences between Salmonella recovered between the different challenge doses (P>0.05).

Infection with Salmonella significantly reduced enzyme activity. Sucrase–isomaltase, maltase, and ALP activity was reduced in the jejunum (P<0.001; Figure 1a) when mice were challenged with 104 CFU and higher doses of Salmonella, and there were significant reductions in sucrase–isomaltase and maltase in the ileum for challenge doses of 106 CFU and above (P<0.01; Figure 1b). This occurred in a dose-dependent manner for both the jejunum and ileum (jejunum: sucrase–isomaltase r=−0.679, maltase r=−0.629, ALP r=−0.553, P<0.001; ileum: sucrase–isomaltase r=−0.496, maltase r=−0.480, P<0.001), and was correlated with villi length in the jejunum (sucrase–isomaltase r=0.377, maltase r=0.368, ALP r=0.318, P<0.05). There was also a negative correlation between jejunal enzyme activity and weight loss (sucrase–isomaltase r=−0.412, maltase r=−0.359, ALP r=−0.385, P<0.05).

Figure 1.

Figure 1

Open in a new tab

Brush border enzyme activity of (a) the jejunum and (b) the ileum following 6 days of challenge with different doses of S. Typhimurium UK1: non-infected (white, n=10), 102 (light gray, n=10), 104 (dark gray, n=10), 106 (diagonal stripe, n=10), 107 (thatched, n=8) and 108 (horizontal stripe, n=6) colony-forming unit (CFU). The results are expressed as % of non-infected value. Data are mean±s.e., with *representing P<0.05 compared with non-infected mice. ALP, alkaline phosphatase; CFU, colony-forming unit.

Infection duration on small intestinal function

Duration of Salmonella infection was associated with weight loss (r=−0.521, P<0.001) and became significant at day 6 compared with non-infected mice (weight change compared with baseline: non-infected mice=1.41±0.87%, day 1=−2.16±0.97%, day 3=−1.32±0.71%, day 6=−6.64±2.34%, P<0.005). Following 24 h of infection, Salmonella was detected in the liver, spleen, and small intestine, and these levels did not significantly change over the 6 days of infection (Table 3; P>0.05). There were significant changes in the enzyme activity, with sucrase–isomaltase, maltase, and ALP activity in the jejunum significantly reduced at all days of infection (P<0.0001; Figure 2a), whereas in the ileum the changes were more variable, with a decrease in maltase activity at all days post-infection, but a decrease in sucrase–isomaltase activity after only 3 days (Figure 2b). There was a negative correlation between the activity of all enzymes and duration of infection in the jejunum (sucrase–isomaltase r=−0.679, maltase r=−0.632, ALP r=−0.510, P<0.005), and for sucrase–isomaltase and maltase in the ileum (sucrase–isomaltase r=−0.748, maltase r=−0.470, P<0.005).

Table 3. Levels of S. Typhimurium UK1 (log10 CFU/g tissue) in the liver, spleen, and small intestine of mice following challenge with 106 S. typhimurium UK1 at days 1, 3, and 6.

  Days post-infection
  Day 1 Day 3 Day 6
Liver 4.25±0.95 4.13±0.95 3.76±0.89
Spleen 6.41±0.29 6.24±0.33 5.40±0.71
Small intestine 5.43±0.67 5.96±0.36 4.54±0.66
Open in a new tab

CFU, colony-forming unit.

Data are mean±s.e. N=10 per group. There were no significant differences between Salmonella recovered between the different challenge durations (P>0.05).

Figure 2.

Figure 2

Open in a new tab

Brush border enzyme activity of (a) the jejunum and (b) the ileum over 6 days of infection with 106 S. Typhimurium UK1 (n=10 per group). The results are expressed as % of non-infected value, with diamonds representing sucrase–isomaltase activity, squares representing maltase activity and the broken line representing alkaline phosphatase activity. Data are mean±s.e., with “a” indicative of P<0.05 compared with the sucrase–isomaltase non-infected values, “b” indicative of P<0.05 compared with the maltase non-infected values and “c” indicative of P<0.05 compared with the alkaline phosphatase non-infected values. CFU, colony-forming unit.

Infection with Salmonella increased IL-10, KC, interferon-γ, and transforming growth factor-β mRNA expression, with most peaking by day 1 post-infection and remaining elevated (P<0.05; Figure 3). There were slight increases in TNF-α and IL-1β expression; however, these did not reach statistical significance (P>0.05; Figure 3).

Figure 3.

Figure 3

Open in a new tab

mRNA expression of cytokines and chemokines in the jejunum of non-infected mice (white column), and S. Typhimurium UK1-infected mice at day 1 (light gray), day 3 (striped) and day 6 (dark gray). Data are mean±s.e., with values expressed relative to non-infected values. *P<0.05 compared with control values. N=5 per group.

Colonization site of B. longum subsp. infantis 35624 and the effect on small intestinal function

Viable B. longum subsp. infantis 35624 was not detected either in the small intestinal tissue or contents, or in the spleen or in the liver. It was detected in the cecal tissue and contents (at similar levels), but was at 102- to 103-fold higher levels in the proximal and distal colon luminal contents compared with their corresponding tissue sections (Figure 4). Consumption of B. longum subsp. infantis 35624 (for 3 weeks) did not significantly alter the brush border enzyme activity (P>0.05) or the villi or crypt length of the jejunum (P>0.05, data not shown).

Figure 4.

Figure 4

Open in a new tab

Levels of viable B. longum subsp. infantis 35624 in the cecum, proximal and distal colon (gray), and in the corresponding luminal contents (striped). Data are mean±s.e., with *indicating P<0.05. N=6 per group. CFU, colony-forming unit.

Effect of B. longum subsp. infantis 35624 pre-treatment on Salmonella pathology

The jejunum is an area of high nutrient uptake, and as greater physiological alterations were occurring here following infection, we only assessed this site for the subsequent probiotic treatment studies. Salmonella infection caused weight loss, which was evident from day 3 post-infection (P<0.05; Figure 5). Pre-treatment with B. longum subsp. infantis 35624 prevented the Salmonella-associated weight loss, with no differences between weight of this group and non-infected mice. B. longum subsp. infantis 35624 also attenuated the reduction in enzyme activity, with sucrase–isomaltase activity significantly greater than the non-treated Salmonella-infected mice (P<0.005; Figure 6). B. longum subsp. infantis 35624 reduced the Salmonella-induced decrease in the villi length (villi length as the percentage of control: Salmonella=71.3±5.3% B. longum subsp. infantis 35624=87.7±6.6%), but did not alter the levels of Salmonella in the spleen, liver, or small intestine (Table 4; P>0.05).

Figure 5.

Figure 5

Open in a new tab

Weight change in non-infected mice (diamonds), S. Typhimurium UK1-infected mice with B. longum subsp. infantis 35624 pre-treatment (squares), and S. Typhimurium UK1-infected mice (broken line). The values are mean percentage weight change compared with the baseline weight±s.e. *P<0.05 compared with non-infected mice. N=6 per group.

Figure 6.

Figure 6

Open in a new tab

Brush border enzyme activity in non-infected mice (white), S. Typhimurium UK1-infected mice (light gray) and in B. longum subsp. infantis 35624-pre-treated S. Typhimurium UK1-infected mice (dark gray). The results are expressed as % of non-infected value. Data are mean±s.e., with * representing P<0.05 between indicated groups. N=6 per group. ALP, alkaline phosphatase.

Table 4. Levels of S. Typhimurium UK1 (log10 CFU/g tissue) in the liver, spleen, and small intestine of mice challenged with 106 S. Typhimurium UK1 that had been pre-treated with water or 108 CFU/day B. longum subsp. infantis 35624.

  Treatment
  Water B. infantis 35624
Liver 6.88±0.38 6.46±0.20
Spleen 7.83±0.54 6.73±0.41
Small intestine 5.80±0.69 5.74±0.42
Open in a new tab

CFU, colony-forming unit.

Data are mean±s.e. N=6 per group. There were no significant differences between Salmonella recovered between the different treatments (P>0.05).

Salmonella infection increased mRNA expression of cytokines and chemokines of the jejunal tissue (Figure 7). B. longum subsp. infantis 35624 reduced the increase in IL-10 and KC expression (P<0.05). Salmonella infection also decreased mRNA expression of sucrase–isomaltase and ALP, while B. longum subsp. infantis 35624 prevented some of the decrease in sucrase–isomaltase expression (P>0.05 compared with healthy levels).

Figure 7.

Figure 7

Open in a new tab

mRNA expression of (a) cytokines and chemokines and (b) brush border digestive enzymes in the jejunum for non-infected mice (white column), S. Typhimurium UK1-infected mice (light gray), and B. longum subsp. infantis 35624-pre-treated S. Typhimurium UK1-infected mice (dark gray). Data are mean±s.e., with values expressed relative to non-infected values. *P<0.05 compared with non-infected values. N=6 per group. ALP, alkaline phosphatase; IFN, interferon; IL, interleukin; KC, keratinocyte chemoattractant; TGF, tumor growth factor; TNF, tumor necrosis factor.

At 3 h following LPS injection, mice exhibited diarrhea associated with a decrease in enzyme activity (P<0.005; Figure 8), which was an average of 37% of healthy levels. Treatment with B. longum subsp. infantis 35624 for 3 weeks before the LPS challenge reduced this degree of change so that brush border enzyme levels were between 56 and 66% of healthy levels and not significantly different to unchallenged mice (P>0.05; Figure 8).

Figure 8.

Figure 8

Open in a new tab

Jejunal brush border enzyme activity in non-infected mice (white), in lipopolysaccharide (LPS)-challenged mice (light gray) and in B. longum subsp. infantis 35624-pre-treated LPS-challenged mice (dark gray). The results are expressed as % of non-infected value. Data are mean±s.e., with *representing P<0.05 compared with non-infected values. N=9 per group. ALP, alkaline phosphatase.

DISCUSSION

Salmonella is a leading cause of bacterial gastroenteritis that disturbs the normal function of the gut and results in diarrhea; however, the molecular mechanisms by which Salmonella interacts with the host to cause disease are not well understood. This study has shown that S. Typhimurium UK1 decreases brush border enzyme activity in a dose- and time-dependent manner. These changes are most likely due to a combination of small intestinal morphological alterations and the host immune inflammatory response possibly altering gene expression and protein activity of the enzymes. These physiological alterations and the associated weight loss also occurred with LPS administration, but were attenuated by pre-treatment with the probiotic B. longum subsp. infantis 35624.

The small intestinal brush border enzymes are often affected in diseases involving enteropathy of the gastrointestinal tract. Following entry of Salmonella into the host, the pathogen attaches to the intestinal surface25 and causes local degeneration of the intestinal microvilli26 and stunting of the villi.7 Salmonella can then pass through the epithelium and spread to the lymph nodes, liver, spleen, and blood.27 This study has shown that Salmonella causes significant damage to the small intestine of mice. As also seen with humans, infection caused weight loss and diarrhea. Examination of the small intestine showed functional changes to the entire length, with villi blunting and reductions to all brush border enzymes. The jejunum showed more damage, which is significant for health as this is a main area for nutrient digestion. It has been previously shown that Salmonella infection reduces brush border enzyme activity,3, 4, 5 but this was mainly assessed in the ileum, with measurements limited to lactase. In our study, we found that all enzyme activity was reduced, showing that changes are not limited only to the disaccharidases. However, it is not clear whether this is due to morphological damage or changes in mRNA expression. It has been previously assumed that changes to brush border enzymes are due to villi damage from Salmonella entry, yet a study has shown that these physiological changes can occur in the absence of obvious histology changes.28 A previous study showed S. Typhimurium enterotoxin administration in a rabbit ileal loop model reduced sucrase and lactase activity, but did not affect mRNA expression.5 In this study, Salmonella infection caused a reduction in sucrase–isomaltase and ALP expression but not maltase.

Enzyme activity as well as body weight of the Salmonella-infected mice decreased in a dose- and duration-dependent manner. In the jejunum, the activity of all enzymes assessed had decreased by day 1, whereas in the ileum the functional changes were smaller, with sucrase–isomaltase levels reduced at day 3 post-infection and maltase affected by day 6. In humans, the incubation period of Salmonella is typically 6–48 h and is followed by abdominal pain and diarrhea. Following oral administration in animals, Salmonella has a rapid transit through the intestine. Oral S. Typhimurium challenge of mice causes high numbers of bacteria in the cecum within the first few hours, with less in the small intestine.27 Another study reported that the jejunum and ileum are positive for S. enteritidis by 8 h post-inoculation, which peaks by 24–36 h.29 Following intestinal colonization the infection becomes systemic, with bacteria appearing in the spleen by day 3, with numbers rapidly increasing over the next 4 days.27 By using quantitative polymerase chain reaction, we were able to detect Salmonella in the spleen and in the liver by 24 h post-challenge. These levels and those in the small intestine did not change significantly over the 6 days.

This study challenged mice with different doses of Salmonella and investigated the outcome on bacterial colonization and translocation, weight loss, and small intestinal function. It is generally believed that a large inoculum (105–1010 bacteria) is required to initiate infection, to overcome the stomach acidity and to compete with the normal gut microbiota.30 However, we found decreases in enzyme activity with lower doses (104 bacteria), and that by day 6 post-infection, levels recovered from the spleen and small intestine were the same, regardless of the initial dose. This is in agreement with a study that found that initial penetration at 6 h was dependent on dose, but by day 3 there was no significant difference in S. Typhimurium recovered from the spleen.27

Salmonella infection causes structural and functional changes to epithelial cells, thought to be mediated by bacterial toxins. Epithelial cells sense the microbial environment and prime the host immune response by releasing cytokines in response to bacterial signals. Immune functions may play a role as inflammatory cells and cytokines can infiltrate the intestinal tract during enteric bacterial infections. Studies show increases in pro-inflammatory cytokines and chemokines in response to Salmonella infection, including increased TNF-α31 and IL-8.32, 33 In this study, we found that Salmonella-infected mice had an upregulation of the pro-inflammatory cytokines and chemokines interferon-γ and KC (IL-8), as well as an increase in IL-10 and transforming growth factor-β expression in the jejunum. This is in agreement with previous studies.34, 35, 36 Other studies have also reported an increase in TNF-α following Salmonella infection, 31 but we did not observe this in the mouse jejunum. The reason for this discrepancy is likely to be that the upregulation of TNF-α is an early transient induction. TNF-α plays an important role in host defense against infectious agents, but also mediates some of the pathology, with increases occurring within 6 h post-infection.31 We did not measure cytokine expression until 24 h post-challenge, and therefore may have missed this early immune response.

The role of T lymphocytes and cytokines in the Salmonella-related pathology of brush border microvilli rather than villi is largely unknown;28 however, the upregulation of pro-inflammatory cytokine expression may be an underlying mechanism for the observed decrease in enzyme activity. Some cytokines, including IL-6 and interferon-γ, have been found to downregulate the gene expression of sucrase–isomaltase.37 This study also reported that TNF-α induced a small increase in sucrase–isomaltase expression, while IL-1β had no effect on the enzyme. Expression of the disaccharidase lactase was not affected by any of the cytokines.37 This suggests that the effect of each cytokine on enzyme expression is specific and selective, and this may explain why changes to the gene expression of maltase in this study were not observed with infection.

To further investigate the mechanisms underlying the reduction in brush border enzyme activity, mice were injected with Salmonella LPS. This caused a similar decrease in enzyme activity to that found with oral administration of Salmonella. LPS is a major surface component of the outer membrane and is an important virulence factor of S. Typhimurium.38 Bacterial LPS is the principal component in the pathogenesis of endotoxic shock, and evokes an acute phase response, resulting in excessive production of pro-inflammatory cytokines.39 Studies have also reported LPS to decrease digestive enzyme activity in vitro and in vivo.40, 41 Our results support the concept that decreases in enzyme activity are not due to Salmonella damage of cells alone (as the LPS was not administered on the apical side of the intestine), but rather related to the host immune response. The pro-inflammatory signaling events from Salmonella are also thought to be triggered on the basolateral surface of the epithelial cells through toll-like receptors.42, 43

There are several studies that investigated probiotic treatment on Salmonella infection; however, no study determined whether probiotics can attenuate the damage caused to the small intestinal enzymes. Probiotics improve clinical outcomes in Salmonella infection by increasing survival, decreasing weight loss, reducing intestinal damage,16, 17 and decreasing Salmonella translocation,18, 19 but this is the first study to demonstrate that probiotics reduce the alterations caused to the brush border enzymes. B. longum subsp. infantis 35624 also prevented weight loss and decreased the pathology associated with Salmonella infection. The mechanisms for the beneficial effects of probiotics are largely unknown; however, it could include reducing intestinal infections by decreasing adhesion and invasion,12, 13 competing for nutrients within the intestinal lumen,44 or by modulating host immune response.14, 15, 45 In this study, B. longum subsp. infantis 35624 reduced the small intestinal damage associated with Salmonella infection. It is unlikely that these changes are from decreased adhesion, because B. longum subsp. infantis 35624 did not change the levels of Salmonella recovered from the small intestine. This is in agreement with some studies, which found that despite probiotics causing a decrease in disease severity, they do not alter the intestinal or fecal levels of Salmonella.16, 46 The effects of the probiotic treatment were also not due to decreased Salmonella translocation and dissemination, because there were no significant changes to the Salmonella levels in the liver and spleen; however, it is possible that changes to Salmonella levels could have been found in the mesenteric nodes, but this was not assessed. The beneficial effects of the probiotic were also unlikely to be due to B. longum subsp. infantis 35624 interacting with Salmonella or competing for nutrients within the small intestine because the probiotic was not detected in the small intestine, only within the cecum and large intestine (mainly luminal contents), nor was the probiotic enhancing the levels of brush border enzyme activity. The lack of B. longum subsp. infantis 35624 in the small intestine was unexpected as high levels were found in the cecum, but this could be explained either by the probiotic having a fast transit time through the small intestine or perhaps levels in the small intestine were below the sensitivity of our measuring technique and therefore its presence, even in low quantities could be having a biological effect. However, more likely we propose that the attenuation of the small intestinal damage is from an altered host immune response. This is supported by the finding that B. longum subsp. infantis 35624 reduced the intestinal damage caused not only by Salmonella, but also by LPS, a chemical agent that was not present on the luminal side of the gastrointestinal tract. Previous work also shows that bifidobacteria can stimulate the immune system and decrease intestinal inflammation47 via induction of T regulatory cells.20, 21

Probiotics are considered a potentially important strategy to modulate inflammatory responses in the gastrointestinal tract as they can enhance the host immune response and positively affect indigenous microbiota. In this study, B. longum subsp. infantis 35624 suppressed the expression of KC (IL-8) and reduced IL-10. IL-8 secretion correlates with the invasion of epithelial cells by Salmonella48 and is a mediator of mucosal inflammation,49 whereas IL-10 is an immunosuppressive compound that is triggered by Salmonella infection and depresses resistance to infection by blocking an effective immune response.35 Decreased IL-8 with B. longum subsp. infantis 35624 treatment agrees with previous findings;14 however, decreased IL-10 may be due to a direct effect of the probiotic on the Salmonella, such as decreasing its ability to trigger immunosuppressive activity. The reduced IL-8 and IL-10 expression observed with probiotic treatment may contribute to the attenuation of damage to the brush border enzymes as well as the decrease in weight loss, as there is an association between weight loss and enzyme activity, suggesting that malnutrition is contributing to the weight loss in mice.

Salmonella is one of the most extensively characterized bacterial pathogens and is a leading cause of bacterial gastroenteritis. Despite this, not much is understood at a molecular level as to how Salmonella interacts with the host to cause disease. This study has shown how gastrointestinal and immune functions are altered with different levels and durations of infection, with systemic infection and functional changes to the small intestinal enzymes occurring as early as 24 h post-infection. In addition, this is the first study to show the beneficial effects of a probiotic on enzyme activity following Salmonella challenge. The exact mechanisms are still to be determined, but it is likely due to modulation of the host immune system. Bifidobacteria are an attractive choice as probiotics as they make up one of the predominant populations of the normal human colonic microbiota;16 however, improved knowledge of the molecular mechanisms will allow for the selection of the best probiotic species, strains or substrates to protect against specific pathogens.

Study Highlights

graphic file with name ctg20129i1.jpg

Acknowledgments

We would like to acknowledge Jay Radford and Frances O'Brien for their involvement in the care of the mice, and Graham Sherlock for his technical assistance. This work was funded in part by a CSET science foundation Ireland grant. The funding bodies had no involvement in this study.

Guarantor of the article: Erin L. Symonds, PhD.

Specific author contributions: Involved with the design of the trial, collected and analyzed samples throughout all studies, analyzed the data, and drafted and revised the paper: Erin L. Symonds; involved with the design and conduct of the trial, assisted with data analysis, and revised the draft paper: Caitlin O'Mahony; involved with the design and conduct of the trial and revised the draft paper: Susan Lapthorne; involved with the design and conduct of the trial and revised the draft paper: David O'Mahony; involved with the design and conduct of the trial and revised the draft paper: John Mac Sharry; involved with the design of the trial, assisted with data interpretation, and revised the draft paper: Liam O'Mahony; assisted with data interpretation revised the draft paper: Fergus Shanahan.

Financial support: This work was supported (salary) by a CJ Martin post-doctoral fellowship (E.L.S.) awarded by the National Health and Medical Research Council of Australia (ID 357702).

Potential competing interests: None.

References

  1. Birosova L, Mikulasova M. Development of triclosan and antibiotic resistance in Salmonella enterica serovar Typhimurium. J Med Microbiol. 2009;58:436–441. doi: 10.1099/jmm.0.003657-0. [DOI] [PubMed] [Google Scholar]
  2. Lu L, Walker WA. Pathologic and physiologic interactions of bacteria with the gastrointestinal epithelium. Am J Clin Nutr. 2001;73 (Suppl:1124S–1130S. doi: 10.1093/ajcn/73.6.1124S. [DOI] [PubMed] [Google Scholar]
  3. Correa-Matos NJ, Donovan SM, Isaacson RE, et al. Fermentable fiber reduces recovery time and improves intestinal function in piglets following Salmonella typhimurium infection. J Nutr. 2003;133:1845–1852. doi: 10.1093/jn/133.6.1845. [DOI] [PubMed] [Google Scholar]
  4. Madge DS. Small intestine carbohydrase activities in experimental Salmonella enterocolitis in mice. Life Sci II. 1973;12:535–542. doi: 10.1016/0024-3205(73)90337-8. [DOI] [PubMed] [Google Scholar]
  5. Chitra E, Sun P, Mahmood S. Effect of Salmonella typhimurium toxin on the expression of rabbit intestinal functions. Indian J Med Res. 2002;116:186–191. [PubMed] [Google Scholar]
  6. Jung K, Ahn K, Chae C. Decreased activity of brush border membrane-bound digestive enzymes in small intestines from pigs experimentally infected with porcine epidemic diarrhea virus. Res Vet Sci. 2006;81:310–315. doi: 10.1016/j.rvsc.2006.03.005. [DOI] [PubMed] [Google Scholar]
  7. Frost AJ, Bland AP, Wallis TS. The early dynamic response of the calf ileal epithelium to Salmonella typhimurium. Vet Pathol. 1997;34:369–386. doi: 10.1177/030098589703400501. [DOI] [PubMed] [Google Scholar]
  8. Narisawa S, Huang L, Iwasaki A, et al. Accelerated fat absorption in intestinal alkaline phosphatase knock-out mice. Mol Cell Biol. 2003;23:7525–7530. doi: 10.1128/MCB.23.21.7525-7530.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Drago L, Gismondo MR, Lombardi A, et al. Inhibition of in vitro growth of enteropathogens by new Lactobacillus isolates of human origin. FEMS Microbiol Lett. 1997;153:455–463. doi: 10.1111/j.1574-6968.1997.tb12610.x. [DOI] [PubMed] [Google Scholar]
  10. Forestier C, De Champs C, Vatoux C, et al. Probiotic activities of Lactobacillus casei rhamnosus: in vitro adherence to intestinal cells and antimicrobial properties. Res Microbiol. 2001;152:167–173. doi: 10.1016/s0923-2508(01)01188-3. [DOI] [PubMed] [Google Scholar]
  11. Fernandez MF, Boris S, Barbes C. Probiotic properties of human lactobacilli strains to be used in the gastrointestinal tract. J Appl Microbiol. 2003;94:449–455. doi: 10.1046/j.1365-2672.2003.01850.x. [DOI] [PubMed] [Google Scholar]
  12. Tuomola EM, Ouwehand AC, Salminen SJ. The effect of probiotic bacteria on the adhesion of pathogens to human intestinal mucosa. FEMS Immunol Med Microbiol. 1999;26:137–142. doi: 10.1111/j.1574-695X.1999.tb01381.x. [DOI] [PubMed] [Google Scholar]
  13. Makras L, Triantafyllou V, Fayol-Messaoudi D, et al. Kinetic analysis of the antibacterial activity of probiotic lactobacilli towards Salmonellaenterica serovar Typhimurium reveals a role for lactic acid and other inhibitory compounds. Res Microbiol. 2006;157:241–247. doi: 10.1016/j.resmic.2005.09.002. [DOI] [PubMed] [Google Scholar]
  14. O'Hara AM, O'Regan P, Fanning A, et al. Functional modulation of human intestinal epithelial reponses by Bifidobacterium infantis and Lactobacillus salivarius. Immunology. 2006;118:202–215. doi: 10.1111/j.1365-2567.2006.02358.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Castillo NA, Perdigón G, de Moreno de LeBlanc A. Oral administration of a probiotic Lactobacillus modulates cytokine production and TLR expression improving the immune response against Salmonellaenterica serovar Typhimurium infection in mice. BMC Microbiol. 2011;11:177. doi: 10.1186/1471-2180-11-177. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Silva AM, Barbosa FH, Duarte R, et al. Effect of Bifidobacterium longum ingestion on experimental salmonellosis in mice. J Appl Microbiol. 2004;97:29–37. doi: 10.1111/j.1365-2672.2004.02265.x. [DOI] [PubMed] [Google Scholar]
  17. de LeBlanc Ade M, Castillo NA, Perdigon G. Anti-infective mechanisms induced by a probiotic Lactobacillus strain against Salmonella enterica serovar Typhimurium infection. Int J Food Microbiol. 2010;138:223–231. doi: 10.1016/j.ijfoodmicro.2010.01.020. [DOI] [PubMed] [Google Scholar]
  18. Hudault S, Lievin V, Bernet-Camard MF, et al. Antagonistic activity exerted in vitro and in vivo by Lactobacillus casei (strain GG) against Salmonellatyphimurium C5 infection. Appl Environ Microbiol. 1997;63:513–518. doi: 10.1128/aem.63.2.513-518.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Lin WH, Yu B, Lin CK, et al. Immune effect of heat-killed multistrain of Lactobacillus acidophilus against Salmonellatyphimurium invasion to mice. J Appl Microbiol. 2007;102:22–31. doi: 10.1111/j.1365-2672.2006.03073.x. [DOI] [PubMed] [Google Scholar]
  20. O'Mahony C, Scully P, O'Mahony D, et al. Commensal-induced regulatory T cells mediate protection against pathogen-stimulated NF-êB activation. PLoS Pathogens. 2008;4:e1000112. doi: 10.1371/journal.ppat.1000112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Konieczna P, Groeger D, Ziegler M, et al. Bifidobacterium infantis 35624 administration induces Foxp3T regulatory cells in human peripheral blood: potential role for myeloid and plasmacytoid dendritic cells. Gut. 2012;61:354–366. doi: 10.1136/gutjnl-2011-300936. [DOI] [PubMed] [Google Scholar]
  22. Dahlqvist A. Assay of intestinal disaccharidases. Anal Biochem. 1968;22:99–107. doi: 10.1016/0003-2697(68)90263-7. [DOI] [PubMed] [Google Scholar]
  23. Forstner GG, Sabesin SM, Isselbacher KJ. Rat intestinal microvillous membranes. Purification and biochemical characterization. Biochem J. 1968;106:381–390. doi: 10.1042/bj1060381. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248–252. doi: 10.1016/0003-2697(76)90527-3. [DOI] [PubMed] [Google Scholar]
  25. Turnbull PC, Richmond JE. A model of Salmonella enteritis: the behaviour of Salmonella enteritis in chick intestine studies by light and electron microscopy. Br J Exp Pathol. 1978;59:64–75. [PMC free article] [PubMed] [Google Scholar]
  26. Takeuchi A. Electron microscope studies of experimental Salmonella infection. Am J Pathol. 1967;50:109–119. [PMC free article] [PubMed] [Google Scholar]
  27. Hohmann AW, Schmidt G, Rowley D. Intestinal colonisation and virulence of Salmonella in mice. Infect Immun. 1978;22:763–770. doi: 10.1128/iai.22.3.763-770.1978. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Scott KGE, Logan MR, Klammer GM, et al. Jejunal brush border microvillous alterations in Giardia muris-infected mice: role of T lymphocytes and interleukin-6. Infect Immun. 2000;68:3412–3418. doi: 10.1128/iai.68.6.3412-3418.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Deng SX, Cheng AC, Wang MS, et al. Gastrointestinal tract distribution of Salmonellaenteritidis in orally infected mice with a species-specific fluorescent quantitative polymerase chain reaction. World J Gastroenterol. 2007;13:6568–6574. doi: 10.3748/wjg.v13.i48.6568. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Darwin KH, Miller VL. Molecular basis of the interaction of Salmonella with the intestinal mucosa. Clin Microbiol Rev. 1999;12:405–428. doi: 10.1128/cmr.12.3.405. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Arnold JW, Niesel DW, Annable CR, et al. Tumor necrosis factor-α mediates the early pathology in Salmonella infection of the gastrointestinal tract. Microb Pathog. 1993;14:217–227. doi: 10.1006/mpat.1993.1021. [DOI] [PubMed] [Google Scholar]
  32. Jung HC, Eckmann L, Yang SK, et al. A distinct array of pro-inflammatory cytokines is expressed in human colon epithelial cells in response to bacterial invasion. J Clin Invest. 1995;95:55–65. doi: 10.1172/JCI117676. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Santos RL, Zhang S, Tsolis RM, et al. Morphologic and molecular characterization of Salmonella typhimurium infection in neonatal calves. Vet Pathol. 2002;39:200–215. doi: 10.1354/vp.39-2-200. [DOI] [PubMed] [Google Scholar]
  34. Trebichavský I, Dlabaĉ VR, Řeháková Z, et al. Cellular changes and cytokine expression in the ilea of gnotobiotic piglets resulting from peroral Salmonella typhimurium challenge. Infect Immun. 1997;65:5244–5249. doi: 10.1128/iai.65.12.5244-5249.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Pie S, Matsiota-Bernard P, Truffa-Bachi P, et al. Gamma interferon and interleukin-10 gene expression in innately susceptible and resistant mice during the early phase of Salmonella typhimurium infection. Infect Immun. 1996;64:849–854. doi: 10.1128/iai.64.3.849-854.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Ramarathinam L, Shaban RA, Niesel DW, et al. Interferon gamma (IFN-g) production by gut-associated lymphoid tissue and spleen following oral Salmonella typhimurium challenge. Microb Pathog. 1991;11:347–356. doi: 10.1016/0882-4010(91)90020-b. [DOI] [PubMed] [Google Scholar]
  37. Zimbaras T, Rubin DC, Perlmutter DH. Regulation of sucrase–isomaltase gene expression in human intestinal epithelial cells by inflammatory cytokines. J Biol Chem. 1996;271:1237–1242. doi: 10.1074/jbc.271.2.1237. [DOI] [PubMed] [Google Scholar]
  38. Muhlradt PF, Menzel J, Golecki JR, et al. Outer membrane of Salmonella. Sites of export of newly synthesised lipopolysaccharide on the bacterial surface. Eur J Biochem. 1973;35:471–481. doi: 10.1111/j.1432-1033.1973.tb02861.x. [DOI] [PubMed] [Google Scholar]
  39. Beumer C, Wulferink M, Raaben W, et al. Calf intestinal alkaline phosphatase, a novel therapeutic drug for lipopolyaccharide (LPS)-mediated diseases, attenuates LPS toxicity in mice and piglets. J Pharm Exp Ther. 2003;307:737–744. doi: 10.1124/jpet.103.056606. [DOI] [PubMed] [Google Scholar]
  40. Schlegel L, Coudray-Lucas C, Barbut F, et al. Bacterial dissemination and metabolic changes in rats induced by endotoxemia following intestinal E. coli overgrowth are reduced by ornithine α-ketoglutarate administration. J Nutr. 2000;130:2897–2902. doi: 10.1093/jn/130.12.2897. [DOI] [PubMed] [Google Scholar]
  41. Courtois F, Seidman EG, Delvin E, et al. Membrane peroxidation by lipopolysaccharide and iron-ascorbate adversely affects Caco-2 cell function: beneficial role of butyric acid. Am J Clin Nutr. 2003;77:744–750. doi: 10.1093/ajcn/77.3.744. [DOI] [PubMed] [Google Scholar]
  42. Gerwitz AT, Simon PO, Schmitt CK, et al. Salmonella typhimurium translocates flagellin across intestinal epithelia, inducing a proinflammatory response. J Clin Invest. 2001;107:99–109. doi: 10.1172/JCI10501. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Gerwitz AT, Navas TA, Lyons S, et al. Bacterial flagellin activates basolaterally expressed TLR5 to induce epithelial proinflammatory gene expression. J Immunol. 2001;167:1882–1885. doi: 10.4049/jimmunol.167.4.1882. [DOI] [PubMed] [Google Scholar]
  44. Canny GO, McCormick BA. Bacteria in the intestine, helpful residents or enemies from within. Infect Immun. 2008;76:3360–3373. doi: 10.1128/IAI.00187-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Nemeth E, Fajdiga S, Malago J, et al. Inhibition of Salmonella-induced IL-8 synthesis and expression of Hsp70 in enterocyte-like Caco-2 cells after exposure to non-starter Lactobacilli. Int J Food Microbiol. 2006;112:266–274. doi: 10.1016/j.ijfoodmicro.2006.09.002. [DOI] [PubMed] [Google Scholar]
  46. Maia OB, Duarte R, Silva AM, et al. Evaluation of the components of a commercial probiotic in gnotobiotic mice experimentally challenged with Salmonellaenterica subsp. enterica ser. Typhimurium. Vet Microbiol. 2001;79:183–189. doi: 10.1016/s0378-1135(00)00383-7. [DOI] [PubMed] [Google Scholar]
  47. Sheil B, MacSharry J, O'Callaghan L, et al. Role of interleukin (IL-10) in probiotic-mediated immune modulation: an assessment in wild-type and IL-10 knock-out mice. Clin Exp Immunol. 2006;144:273–280. doi: 10.1111/j.1365-2249.2006.03051.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Eckmann L, Kagnoff MF, Fierer J. Epithelial cells secrete the chemokine interleukin-8 in response to bacterial entry. Infect Immun. 1993;61:4569–4574. doi: 10.1128/iai.61.11.4569-4574.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Sansonetti PJ, Arondel J, Huerre M, et al. Interleukin-8 controls bacterial transepithelial translocation at the cost of epithelial destruction in experimental shigellosis. Infect Immun. 1999;67:1471–1480. doi: 10.1128/iai.67.3.1471-1480.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Clinical and Translational Gastroenterology are provided here courtesy of American College of Gastroenterology

RESOURCES