Skip to main content
NCBI home page
Molecular Therapy logoLink to Molecular Therapy
. 2012 Feb 14;20(6):1196–1203. doi: 10.1038/mt.2012.20

PEGylated Polyplex With Optimized PEG Shielding Enhances Gene Introduction in Lungs by Minimizing Inflammatory Responses

Satoshi Uchida 1, Keiji Itaka 1,*, Qixian Chen 2, Kensuke Osada 2, Takehiko Ishii 3, Masa-Aki Shibata 4, Mariko Harada-Shiba 5, Kazunori Kataoka 1,2,*
PMCID: PMC3369293  PMID: 22334020

Abstract

Safety is a critical issue in clinical applications of nonviral gene delivery systems. Safe and effective gene introduction into the lungs was previously achieved using polyplexes from poly(ethyleneglycol) (PEG)-block-polycation [PEG-block-PAsp(DET)] and plasmid DNA (pDNA). Although PEGylated polyplexes appeared to be safe, an excess ratio of polycation to pDNA was needed to obtain sufficient transgene expression, which may cause toxicities shortly after gene introduction. In the present study, we investigated the combined use of two polymers, PEG-block-PAsp(DET) (B) and homo PAsp(DET) (H) across a range of mixing ratios to construct polyplexes. Although transgene expressions following in vitro transfections increased in parallel with increased proportions of H, polyplexes with B/H = 50/50 formulation produced the highest expression level following in vivo intratracheal administration. Higher proportions of H elicited high levels of cytokine induction with significant inflammation as assessed by histopathological examinations. Based on the aggregation behavior of polyplexes in bronchoalveolar lavage fluids (BALFs), we suggested that rapid aggregation of polyplexes in the lung induced acute inflammatory responses, resulting in reduced transgene expression. B/H formulation of polyplex can help to improve gene therapy for the respiratory system because it achieves both effective PEG shielding of polyplexes and functioning of PAsp(DET) polycations to enhance endosomal escape.

Introduction

Nonviral techniques for gene introduction using plasmid DNA (pDNA) have attracted attention for many clinical uses. Although the definition of gene therapy includes genetic modification of deficient cells, gene introduction using pDNA chiefly involves providing functional proteins and peptides through transgene expressions. The sustained synthesis of proteins and peptides, which enables the synchronization of the kinetics of signaling receptor expression and bioactive factor availability,1 is a key advantage of its application in many chronic diseases.

Among various gene introduction routes, pDNA-containing nanoparticle inhalation, a direct, noninvasive technique, is a promising practical system that makes target cells more accessible. Gene introduction into the respiratory system has numerous applications for treating severe lung diseases, such as cystic fibrosis, pulmonary hypertension, and lung cancer,2 and it can systemically deliver proteins and peptides. However, because immune responses of the respiratory system are particularly sensitive to foreign materials, the safety of the delivery systems is extremely important for successful gene introduction. To realize the promise of gene therapy, it is essential to achieve adequate safety to avoid undesirable responses.

pDNA is generally incorporated into nanoscale formulations by complexing it with cationic lipids or polymers, which provides greater stability and functionality.3,4,5 The safety of nanoscale particles (nanotoxicology) has been vigorously investigated in various fields.6 Many studies revealed that the toxicity of these particles in target tissues, typically the lungs, are primarily mediated by inflammatory responses that occur after nanoparticle-induced oxidative stress.7,8 These responses are sensitive to the physicochemical properties of nanoparticles, including their size, chemical composition, surface structure, solubility, shape, and aggregation.9,10,11 For delivery into the lungs, a biodegradable formulation of nanoparticles composed of poly(lactic-co-glycolic acid) significantly lowered the inflammatory responses compared with nonbiodegradable forms, although both had comparable hydrodynamic diameters.12

These safety issues motivated us to optimize pDNA-containing particle structure for gene introduction into the lungs. Polyplexes from our original cationic polymer, poly{N'-[N-(2-aminoethyl)-2-aminoethyl]aspartamide} [PAsp(DET)] and pDNA, is promising because they are safe and biocompatible.13,14 We have already achieved therapeutic outcomes in monocrotaline-induced pulmonary hypertension animal models using a system based on PAsp(DET).15 PAsp(DET) possesses high-transfection efficiency because of its pH-selective membrane destabilization and concomitantly enhanced endosomal escape.16 Furthermore, it is biodegradabile under physiological conditions. Because of rapid degradation of PAsp(DET) to nontoxic forms after gene introduction, it does not induce persistent tissue damage and cumulative toxicity, which may perturb cellular homeostasis in a time-dependent manner.17

However, pDNA polyplexes from cationic polymers inevitably have a high surface positive charge, which causes undesirable responses in the body, such as polyplex aggregation and tissue damage. Poly(ethyleneglycol) (PEG) has often been used to shield polyplexes. Because of its hydrophilic and flexible nature, PEG increases steric stability, prevents nonspecific interactions with surrounding molecules, and eventually reduces toxicity.18,19,20,21,22,23 In our previous studies on in vivo administrations including the lungs, we used pDNA polyplexes of a micellar structure surrounded by PEG palisade, that were formed by complexing pDNA with a block copolymer composed of PEG and PAsp(DET) [PEG-block-PAsp(DET)].15,24,25 These PEGylated polyplexes achieved safe gene introduction without inducing severe inflammation, leading to the effective treatment of rat pulmonary hypertension model using adrenomedullin-expressing pDNA.15 However, PEG also tends to reduce transgene expressions by preventing cellular uptake of polyplexes and hampering their intracellular processing.26,27 Indeed, to obtain sufficient transgene expressions using the PEGylated polyplexes, we needed higher mixing ratios of cationic polymers to pDNA (N/P ratios) to enhance the expressions. The higher N/P ratios, however, caused some toxicities, especially shortly after gene introduction.

In the present study, we investigated the optimal conditions to break out of the dilemma of PEG, by focusing on the intravital behavior of polyplexes in lung. We used a PEGylation strategy by mixing PEGylated and non-PEGylated forms of polycations in the construction of polyplexes-containing pDNA.22 We found that the optimal combination of two forms, PEG-block-PAsp(DET) (B) and homo PAsp(DET) (H), was effective in achieving high transgene expression in lungs with minimal toxicity, by balancing effective PEG shielding and functions of the polycation. Furthermore, we acquired new insights into the mechanisms that mediate the inflammatory responses induced by polyplexes in the lungs.

Results

In vitro and in vivo transfection using polyplexes with B/H formulations

For preparation of polyplexes with B/H formulations, the polymer solutions of PEG-block-PAsp(DET) (B) and homo PAsp(DET) (H) were first mixed at different ratios, and then added to pDNA solutions. We conducted in vitro transfections toward mouse embryonic fibroblasts and HuH-7 cells using CpG-depleted pDNA-expressing luciferase (pCpG-ΔLuc); the transgene expression was increased in parallel with increased proportions of H (Figure 1) at an N/P ratio of 8. In contrast, cell viability, evaluated by an MTT assay, was reduced slightly with increased proportions of H.

Figure 1.

Figure 1

Open in a new tab

In vitro transfection to (a) mouse embryonic fibroblast (MEF) or (b) HuH-7 cells. Luciferase expression (closed circle) and viability (open circle) was measured 48 hours after transfection. The data were expressed as the means ± the standard errors of the mean (SEM) (N = 5).

For in vivo administration, the polyplexes-containing luciferase-expressing pDNA were injected intratracheally using a microspray, and the luciferase expression was evaluated after extracting the lung tissue, followed by homogenization to obtain the proteins. Polyplexes with B/H = 50/50 formulation exhibited a significantly higher expression in the lungs compared with polyplexes with B/H = 100/0 and 0/100 formulations (Figure 2). These data were in contrast with the results of in vitro transfections (Figure 1). To evaluate the toxic effect of polyplexes, we measured the induction of proinflammatory cytokines (interleukin (IL)-6, tumor necrosis factor-α, and IL-10) and cyclooxygenase-2. Polyplexes with B/H = 0/100 formulation induced significantly higher mRNA levels of these inflammation-related molecules compared with other formulations 4 hours after administration (Figure 3). The other PEGylated polyplexes (B/H = 100/0 and 50/50) induced much lower expressions of these molecules than polyplexes with B/H = 0/100 formulation, although the levels of these molecules in the PEGylated groups were slightly higher compared with the control groups that received naked pDNA or buffer.

Figure 2.

Figure 2

Open in a new tab

Luciferase expression in lung tissue 48 hours after polyplex administration. The data were expressed as the means ± SEM (N = 5). RLU, relative luminescence units.

Figure 3.

Figure 3

Open in a new tab

Messenger RNA expression of cytokines (a) interleukin (IL)-6, (b) tumor necrosis factor-α (TNF-α), (c) IL-10, and (d) cyclooxygenase-2 (Cox-2) in lung tissue 4 hours after administration of polyplexes, identical amount of free polymers, plasmid DNAs (pDNAs), or buffer. The data were expressed as the means ± SEM (N = 5). §Nonsignificance versus polyplexes with B/H = 100/0 formulation, **P < 0.01 versus polyplexes with B/H = 0/100 formulation.

Furthermore, we evaluated the inflammatory responses to administration of identical amounts of free polymers (B or H) that were used to form the polyplexes of B/H = 100/0 or 0/100 formulations, respectively. The free polymers induced inflammatory responses that were similarly low to those by PEGylated polyplexes (B/H = 100/0 and 50/50) (Figure 3). Thus, it is suggested that the complexation of H polymer with pDNA augmented the inflammatory responses in the lungs compared with the state of free H polymer. In contrast, PEG effectively shielded the polyplexes and reduced the inflammatory responses in the lungs.

After 24 hours of administration, cytokine inductions were similar to the levels observed in the controls (Supplementary Figure S1), suggesting that the inflammation was transient and the PAsp(DET) polycation induced no persistent tissue damage, presumably because of the biodegradability of PAsp(DET).17 In blood tests conducted 24 hours after administration, there were no significant changes in the cell counts of white and red blood cells, and the items for evaluations of liver and kidney functions, and C-reactive protein, a sensitive marker for inflammatory responses, remained in an undetectable level (Supplementary Figure S2).

Regulation of inflammatory responses in the lungs by PEG shielding

Histopathological analyses were performed to investigate the mechanisms between transfection capacity and toxicity. An increase in the infiltration of inflammatory cells was observed 4 hours after administration of polyplexes with B/H = 0/100 formulations (Figure 4c). In contrast, following administration of the PEGylated polyplexes (B/H = 100/0 and 50/50), the alveolar structures remained intact without infiltration of inflammatory cells (Figure 4a,b), showing good correlations with the results of proinflammatory cytokine inductions (Figure 3).

Figure 4.

Figure 4

Open in a new tab

Histological analyses of lung in hematoxylin and eosin stained sections. The images were taken 4 hours after administration of polyplexes with (a) B/H = 100/0, (b) B/H = 50/50, or (c) B/H = 0/100 formulation. (d) Control was not administered polyplexes. Bars = 100 µm. In (c), representative infiltration of inflammatory cells is marked by red circles.

To determine the mechanisms underlying the inflammatory responses, we observed the uptake of polyplexes by macrophages. Cy5-labeled pDNAs were introduced into the lungs, followed by immunostaining using an F4/80 antibody for macrophages and Hoechst 33342 for cell nuclei. On obtaining fluorescent microscopic images, we quantified the fluorescence intensities of pDNAs that were colocalized in the macrophages, using an image-analysis software (In Cell Analyzer 1000 Workstation ver.3.5; GE Healthcare UK, Buckinghamshire, UK). Representative microscopic images are shown in Figure 5a–d. As observed in the histograms of the pDNA intensity in each macrophage (Figure 5e), polyplexes with B/H = 0/100 formulation were taken up by the macrophages to a significantly higher extent compared with the PEGylated polyplexes (B/H = 100/0 and 50/50).

Figure 5.

Figure 5

Open in a new tab

Uptake of polyplexes by macrophages in lung. Fluorescent microscopic images were taken at 4 hours after polyplex administration. The polyplexes were prepared using Cy-5 labeled plasmid DNA (pDNA) (red). The macrophages were immunostained using anti-F4/80 antibodies (green). The cell nuclei were stained with Hoechst 33342 (blue). Representative images of polyplexes with (a) B/H = 100/0, (b) B/H = 50/50, (c) B/H = 0/100 formulations, or (d) control tissue without gene administration. Bars = 50 µm. (e) Quantification of the amount of pDNA colocalizing in each macrophage. The fluorescence intensities of Cy-5 labeled pDNA in each macrophage were quantified using an image-analyzing software, and displayed as a histogram representing the pDNA intensity in each macrophage.

Macrophages are known to effectively ingest large particles (≥500 µm) by phagocytosis.28 Thus, it is assumed that aggregation of polyplexes in lung tissue may significantly affect the activity of macrophages. Analysis of aggregation of polyplexes under conditions mimicking that observed in the lungs was performed. We observed polyplexes-containing Cy5-labeled pDNAs in the presence of bronchoalveolar lavage fluid (BALF) obtained from mice. Fluorescence microscopy showed a clear contrast between the polyplexes depending on the proportion of H; PEGylated polyplexes (B/H = 100/0 and 50/50) showed uniformly distributed Cy-5 signals during BALF incubation for up to 90 minutes (Figure 6). In contrast, polyplexes with 0/100 formulation showed large spots of Cy-5 signals after 30 minutes of BALF incubation. Thus, it is likely that particle aggregation of B/H = 0/100 formulation was promptly induced under the physiological circumstances in the lungs. Based on the obvious relationship between these findings and the cytokine induction data (Figure 3), we suggest that the aggregation of polyplexes with B/H = 0/100 formulation activated macrophages to rapidly ingest these polyplexes.

Figure 6.

Figure 6

Open in a new tab

Aggregation of polyplexes during the incubation in bronchoalveolar lavage fluid (BALF). The polypexes were prepared from Cy5-labeled plasmid DNAs (pDNAs), and after adding BALF, the polyplex solutions were observed by a fluorescent microscope. Bar = 50 µm.

Enhancement of transgene expressions in the presence of H polycations

Increased proportions of H enhanced in vitro transgene expression (Figure 1). We have already revealed that PAsp(DET) has an excellent capacity of endosomal escape because of acidity-induced membrane destabilization.16 For the analylsis, an enzymatic assay to detect leakage of cytoplasmic enzyme (lactate dehydrogenase) was done after addition of free polycations to culture cells. However, this experiment has difficulty in detecting the initial changes within several ten minutes after transfection.

In the present study, we used a novel method that allows the evaluation of cell membrane integrity in a highly sensitive manner using a nuclear-binding fluorescence molecule such as YO-PRO1 or ethidium bromide.29,30 After transfection using polyplexes from B/H formulations, the cells were treated with YO-PRO1 because YO-PRO1, which was impermeable to the normal cell membrane, can penetrate membranes of cells with perturbed integrity and emit a strong fluorescent signal due to DNA intercalation.31 As shown in Figure 7, after 30 minutes of transfection under acidic conditions, polyplexes with B/H = 50/50 formulation destabilized cell membranes to a similar level as polyplexes with B/H = 0/100 formulation, whereas polyplexes with B/H = 100/0 formulation, similar to untreated control, did not destabilize membranes even at pH 5.5. Thus, it can be said that presence of H polycations caused efficient endosomal escape of polyplexes shortly after transfection.

Figure 7.

Figure 7

Open in a new tab

Evaluation of cell membrane destabilization at pH 5.5 or 7.4 in the culture medium. After 30 minutes of transfection toward HuH-7, cells were treated with YO-PRO1. The fluorescence intensity in each cell nucleus, indicating the amount of YO-PRO1 penetration through the plasma membrane, was determined using IN Cell Analyzer 1000. The averages from about 3,000 cells were analyzed in each well. The data were expressed as the means ± SEM (N = 5).

Following in vivo administration to the lungs, we evaluated the amount of pDNA that was taken up into the lung tissues by collecting total DNA, followed by quantitative PCR analyses using specific primers for the pDNA. Prior to the extracting lung tissue, extensive bronchoalveolar lavage (BAL) was done to remove pDNAs existing in the extracellular space. Interestingly, 24 hours after introduction of pDNA into the lungs, the amount of pDNA did not show any significant difference among polyplexes formed by different B/H formulations (Supplementary Figure S3). Therefore, it is reasonably assumed that the differences in transgene expressions in the lungs (Figure 2) are not attributable to the uptake of polyplexes into cells, but to the capacities of H polycations to facilitate intracellular processes of endosomal escape, although the direct observation of intracellular behavior of polyplexes was difficult in vivo.

Discussion

Inflammation is a key factor in nanoparticle toxicity.6,11,32 This is a rapid process that is initially triggered by antioxidant responses within a few hours of exposure of biological tissue to nanoparticles. Thus, it is important to evaluate these responses shortly after the administration of nanoparticles.

In the present study, we determined that PEG shielding of pDNA-containing nanoparticles reduces inflammatory responses in the lungs. PEGylated polyplexes (B/H = 100/0 and 50/50) effectively alleviated inflammatory responses compared with polyplexes with B/H = 0/100 formulation. Since the administration of free cationic polymers into the lungs did not induce such inflammatory responses, we assume that the cationic nature of polyplexes was not the only cause of these responses. Otherwise, the aggregation behavior was different among polyplexes. Polyplexes with B/H = 0/100 formulation showed rapid aggregation in BALF, whereas PEGylated polyplexes (B/H = 100/0 and 50/50) did not aggregate even after incubation for > 90 minutes (Figure 6). These observations are clearly concordant with the tendency to induce cytokine expression and polyplex uptake by macrophages in the lungs (Figure 3). Thus, it is reasonable to assume that aggregation of polyplex with B/H = 0/100 formulation in lung tissue caused a high uptake of the polyplexes by macrophages, which led to strong inflammatory responses and the decreased transgene expressions in the lung.

Conversely, the presence of PEG on the surface of polyplexes effectively prevents inflammatory responses. Although PEG effectively prevented aggregation, in vitro and in vivo transgene expressions were compromised by the increase in B polycation. Since pDNA amounts in lung tissues after introduction of polyplexes were not different among the B/H formulations (Supplementary Figure S3), the decrease in the transgene expressions in parallel with the increased ratios of PEG, appeared to be chiefly due to the effects of PEG to hamper the intracellular processes of polyplexes. Membrane destabilization at pH 5.5 was enhanced by the increased amounts of H polycations (Figure 7), suggesting a critical role for H polycations without PEG in facilitating the endosomal escape of polyplexes.33 As a consequence, polyplexes with B/H = 50/50 formulation showed the highest transgene expression levels with minimal inflammatory responses in the lungs. This formulation successfully took advantage of both effective PEG shielding and the functioning of PAsp(DET) polycations to enhance intracellular processes.

These observations highlight the importance of analyzing intravital behavior of polyplexes from the standpoint of nanotoxicology. Typically presented as transgene expressions in this study, therapeutic outcomes with nanoscale polyplexes can be easily influenced by slight structural modifications, even when no appreciable changes are detected in their in vitro physicochemical evaluations. Careful consideration of all processes from polyplex formation to the intravital behavior is required for effective and safe gene and drug delivery systems, especially for administration to the respiratory system.

Based on our originally developed polycation PAsp(DET), which possesses high endosomal escaping capability with minimal toxicity due to its biodegradable nature, we determined the optimal composition of polyplexes for intratracheal administration of pDNA by tuning the mixing ratio of PEG-block-PAsp(DET) (B) and homo PAsp(DET) (H). In vitro transgene expressions increased in parallel with increased proportions of H. In contrast, following in vivo intratracheal administration into the lungs, polyplexes with B/H = 0/100 formulation significantly induced proinflammatory cytokines and cyclooxygenase-2 expressions, and resulted in histological findings characteristic of inflammation. Using fluorescence microscopy, we found that BALF containing the polyplexes with B/H = 0/100 formulations exhibited rapid aggregate formation. It is thus reasonable to assume that the rapid aggregation of polyplexes with B/H = 0/100 formulation in the lung may elicit acute inflammatory responses, resulting in reduced transgene expressions. Notably, appropriate PEG shielding of the polyplex prevented aggregate formation effectively, and polyplexes with B/H = 50/50 formulation achieved appreciable gene expression in the lungs without inflammatory responses. Therefore, this polyplex formulation is a highly practical system for gene therapy for the respiratory system that takes advantage of both effective PEG shielding and functioning of PAsp(DET) polycations to enhance endosomal escape.

Materials and Methods

Materials. PEG-block-PAsp(DET) block copolymer (B) and PAsp(DET) homo polymer (H) were synthesized as previously reported.13 The PEG used in this study had a molecular weight of 12,000 Da. The degree of polymerization of PAsp(DET) portion for B and H was determined by 1H-NMR analyses to be 60 and 55, respectively. CpG-depleted pDNA encoding luciferase (pCpG-ΔLuc) was kindly provided by Makiya Nishikawa from Kyoto University (Kyoto, Japan), which had been constructed as previously reported.34 The pDNA was amplified in GT115 Escherichia coli (InvivoGen, San Diego, CA) and purified using NucleoBond Xtra EF (Nippon Genetics, Tokyo, Japan). The pDNA concentration was determined spectroscopically at 260 nm. Dulbecco's modified Eagle's medium and fetal bovine serum were purchased from Sigma–Aldrich (St Louis, MO) and Life Technologies Japan (Tokyo, Japan), respectively. Linear polyethylenimine (Exgen 500, molecular weight = 22 kDa) was purchased from MBI FerMentas (Burlington, Ontario, Canada).

Preparation of polyplex solutions. Each polyplex sample was prepared by mixing pDNA and polycations B and/or H at the indicated ratio. The N/P ratio [(total amines in polycations)]/(DNA phosphates)] was fixed at eight throughout the study.

In vitro transfection. Mouse embryonic fibroblast and hepatocellular carcinoma (HuH-7) cells were seeded at a density of 5,000 cells/well in 96-well culture plates and incubated overnight in 100 ml Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and penicillin/streptomycin. For each transfection, the culture medium was replaced with fresh medium containing 10% fetal bovine serum, and the polyplex solution containing 0.25 µg of pDNA was administered to each well. Luciferase expression was measured with the Luciferase assay system (Promega, Madison, WI) and the GloMaxTM 96 microplate luminometer (Promega) according to the manufacturer's protocol.

Intratracheal gene introduction into mouse lungs. BALB/c mice (female, 7 weeks old) were purchased from Charles River Laboratories (Yokohama, Japan). Mice were anesthetized intraperitoneally with pentobarbital (60 mg/kg) (Kyoritsu Seiyaku, Tokyo, Japan). Fifty microliter of polyplex solution containing 10 µg pDNA was administered using a microsprayer model IA-1C-R (Penn Century, Philadelphia, PA) after tracheostomies. All animal protocols were conducted with the approval of the Animal Care and Use Committee, University of Tokyo, Tokyo, Japan.

Evaluation of luciferase expressions in lung. Mice were sacrificed after 24 hours, and lung was excised and thoroughly homogenized using a Multibeads shocker (Yasui Kikai, Osaka, Japan). Luciferase expression was measured by a luciferase assay system using the Lumat LB9507 luminometer (Berthold, Bad Wildbad, Germany). The expression was normalized to protein concentrations in the cell lysates.

Histological evaluations. Lung specimens were fixed in 10% formalin for 24 hours and embedded in paraffin. These sections (5-µm thick) were stained with hematoxylin and eosin. For evaluations of polyplex behavior and macrophages, pDNA was labeled with Cy-5 using Label IT Tracker Intracellular Nucleic Acid Localization Kits (Mirus, Madison, WI) following manufacturer's protocol. Mice were sacrificed after 4 hours and the excised lung tissue was fixed in 10% formalin for 5 hours, followed by overnight incubation in 20% sucrose/phosphate-buffered saline (PBS) solution at room temperature. The specimens were frozen and sectioned at a 10-µm thickness in a cryostat. Macrophages were immunostained with an anti-F4/80 monoclonal antibody (AbD Serotec, Oxford, UK) at a dilution of 1:300 and an Alexa488-conjugated secondary antibody (Invitrogen, Carlsbad, CA). After staining the nuclei with Hoechst 33342 (Dojindo, Kumamoto, Japan), the sections were observed with a fluorescence microscope equipped with image-analysis software (IN Cell Analyzer 1000; GE Healthcare UK), followed by the measurement of fluorescence intensity of Cy-5 labeled DNA in each macrophage. About 300 macrophages were analyzed for each group.

Measurement of proinflammatory cytokines. To measure mRNA levels of proinflammatory cytokines (IL-6, tumor necrosis factor-α, and IL-10) and cyclooxygenase-2, lung tissue was extracted and total RNA was isolated using an RNeasy Mini Preparation Kit (Qiagen, Hilden, Germany) following manufacturer's protocol. Gene expressions were analyzed by real-time quantitative PCR using TaqMan Gene Expression Assays (Mm00446190_m1 for IL-6, Mm00443258 for tumor necrosis factor-α, Mm 01288386_m1 for IL-10, Mm01307334_g1 for cyclooxygenase-2, and Mm00607939 for β-actin) and an ABI Prism 7500 Sequence Detector (Applied Biosystems, Foster City, CA).

Observation of aggregation in BALF. BAL was performed with 500 µl PBS (instilled and recovered four times), and the BAL fluid (BALF) obtained was centrifuged at 300g. To observe the aggregation of polyplexes, Cy5-labeled DNA was used to prepare polyplex solutions at DNA concentration of 33.3 µg/ml. BALF was added to equal volumes of polyplex solutions and observed with an Axiovert 200 fluorescence microscope (Carl Zeiss, Jena, Germany) using a 20× EC Plan Neofuar objective (Carl Zeiss).

Measurement of cellular uptake in lung cells. BAL was conducted eight times, using 500 µl PBS in each time, to remove extracellular pDNA. Next, pDNA was collected from the excised lung tissue and purified using a Wizard Genomic DNA Purification Kit (Promega). Purified DNA was then subjected to a real-time PCR to quantify pDNA copies using an ABI Prism 7500 Sequence Detector (Applied Biosystems). The forward primer (TCTGTGGCTTCAGAGTGGTG) and reverse primer (CTGATTCCTGGGAGATGGAA) were used because they are specific for pCpG-ΔLuc. The copy number of β-actin was also determined by TaqMan Gene Expression Assays to normalize the cell number.

Evaluation of endosomal escape inside cells. HuH-7 cells were seeded at a density of 10,000 cells/well in a 48-multiwell plate and cultured for 24 hours. The culture medium was then replaced with PBS buffer (pH 7.4) or MES buffer (pH 5.5) containing 20 mmol/l MES and 150 mmol/l NaCl; a polyplex solution containing 0.5 µg pDNA was added to each well. The cells were treated with 1 µmol/l YO-PRO1 (Invitrogen) and 2.5 µg/ml Hoechst 33342 in PBS 30 minutes later. The fluorescence intensity of each nucleus was quantified after a 10-minute incubation using an IN Cell Analyzer 1000.

SUPPLEMENTARY MATERIAL Figure S1. Messenger RNA expression of proinflammatory cytokines and Cox-2 in lung at 4 hours and 24 hours after transfection. Figure S2. Blood tests at 24 hours after administration. Figure S3. Uptake of polyplexes by lung cells at 24 hours after transfection.

Acknowledgments

We deeply appreciate Makiya Nishikawa (Kyoto University) for providing pDNA (pCpG-ΔLuc), and E.S. (National Cerebral and Cardiovascular Center Research Institute) for technical advices on lung administration of polyplexes. This work was financially supported in part by the Core Research Program for Evolutional Science and Technology (CREST) from Japan Science and Technology Corporation (JST) (K.K.), Grants-in-Aid for Scientific Research form the Japanese Ministry of Education, Culture, Sports, Science and Technology, Japan (MEXT) (K.I.), Global COE Program “Medical System Innovation on through Multidisciplinary Integration” from MEXT, Japan, and Funding Program for World-Leading Innovative R&D on Science and Technology (FIRST Program) from the Japan Society for the Promotion of Science (JSPS). We also thank Satomi Ogura, Yoko Hasegawa, and Katsue Morii (The University of Tokyo) for technical assistance.

Supplementary Material

Figure S1.

Messenger RNA expression of proinflammatory cytokines and Cox-2 in lung at 4 hours and 24 hours after transfection.

Click here for additional data file. (37.4KB, pdf)
Figure S2.

Blood tests at 24 hours after administration.

Click here for additional data file. (125.1KB, pdf)
Figure S3.

Uptake of polyplexes by lung cells at 24 hours after transfection.

Click here for additional data file. (35.9KB, pdf)

REFERENCES

  1. Howell TH, Fiorellini J, Jones A, Alder M, Nummikoski P, Lazaro M.et al. (1997A feasibility study evaluating rhBMP-2/absorbable collagen sponge device for local alveolar ridge preservation or augmentation Int J Periodontics Restorative Dent 17124–139. [PubMed] [Google Scholar]
  2. Sanders N, Rudolph C, Braeckmans K, De Smedt SC., and, Demeester J. Extracellular barriers in respiratory gene therapy. Adv Drug Deliv Rev. 2009;61:115–127. doi: 10.1016/j.addr.2008.09.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Oupický D, Konák C, Ulbrich K, Wolfert MA., and, Seymour LW. DNA delivery systems based on complexes of DNA with synthetic polycations and their copolymers. J Control Release. 2000;65:149–171. doi: 10.1016/s0168-3659(99)00249-7. [DOI] [PubMed] [Google Scholar]
  4. Kakizawa Y., and, Kataoka K. Block copolymer micelles for delivery of gene and related compounds. Adv Drug Deliv Rev. 2002;54:203–222. doi: 10.1016/s0169-409x(02)00017-0. [DOI] [PubMed] [Google Scholar]
  5. De Smedt SC, Demeester J., and, Hennink WE. Cationic polymer based gene delivery systems. Pharm Res. 2000;17:113–126. doi: 10.1023/a:1007548826495. [DOI] [PubMed] [Google Scholar]
  6. Nel A, Xia T, Mädler L., and, Li N. Toxic potential of materials at the nanolevel. Science. 2006;311:622–627. doi: 10.1126/science.1114397. [DOI] [PubMed] [Google Scholar]
  7. Card JW, Zeldin DC, Bonner JC., and, Nestmann ER. Pulmonary applications and toxicity of engineered nanoparticles. Am J Physiol Lung Cell Mol Physiol. 2008;295:L400–L411. doi: 10.1152/ajplung.00041.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Bonner JC. Nanoparticles as a potential cause of pleural and interstitial lung disease. Proc Am Thorac Soc. 2010;7:138–141. doi: 10.1513/pats.200907-061RM. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Poland CA, Duffin R, Kinloch I, Maynard A, Wallace WA, Seaton A.et al. (2008Carbon nanotubes introduced into the abdominal cavity of mice show asbestos-like pathogenicity in a pilot study Nat Nanotechnol 3423–428. [DOI] [PubMed] [Google Scholar]
  10. Ryman-Rasmussen JP, Cesta MF, Brody AR, Shipley-Phillips JK, Everitt JI, Tewksbury EW.et al. (2009Inhaled carbon nanotubes reach the subpleural tissue in mice Nat Nanotechnol 4747–751. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Beyerle A, Irmler M, Beckers J, Kissel T., and, Stoeger T. Toxicity pathway focused gene expression profiling of PEI-based polymers for pulmonary applications. Mol Pharm. 2010;7:727–737. doi: 10.1021/mp900278x. [DOI] [PubMed] [Google Scholar]
  12. Dailey LA, Jekel N, Fink L, Gessler T, Schmehl T, Wittmar M.et al. (2006Investigation of the proinflammatory potential of biodegradable nanoparticle drug delivery systems in the lung Toxicol Appl Pharmacol 215100–108. [DOI] [PubMed] [Google Scholar]
  13. Kanayama N, Fukushima S, Nishiyama N, Itaka K, Jang WD, Miyata K.et al. (2006A PEG-based biocompatible block catiomer with high buffering capacity for the construction of polyplex micelles showing efficient gene transfer toward primary cells ChemMedChem 1439–444. [DOI] [PubMed] [Google Scholar]
  14. Masago K, Itaka K, Nishiyama N, Chung UI., and, Kataoka K. Gene delivery with biocompatible cationic polymer: pharmacogenomic analysis on cell bioactivity. Biomaterials. 2007;28:5169–5175. doi: 10.1016/j.biomaterials.2007.07.019. [DOI] [PubMed] [Google Scholar]
  15. Harada-Shiba M, Takamisawa I, Miyata K, Ishii T, Nishiyama N, Itaka K.et al. (2009Intratracheal gene transfer of adrenomedullin using polyplex nanomicelles attenuates monocrotaline-induced pulmonary hypertension in rats Mol Ther 171180–1186. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Miyata K, Oba M, Nakanishi M, Fukushima S, Yamasaki Y, Koyama H.et al. (2008Polyplexes from poly(aspartamide) bearing 1,2-diaminoethane side chains induce pH-selective, endosomal membrane destabilization with amplified transfection and negligible cytotoxicity J Am Chem Soc 13016287–16294. [DOI] [PubMed] [Google Scholar]
  17. Itaka K, Ishii T, Hasegawa Y., and, Kataoka K. Biodegradable polyamino acid-based polycations as safe and effective gene carrier minimizing cumulative toxicity. Biomaterials. 2010;31:3707–3714. doi: 10.1016/j.biomaterials.2009.11.072. [DOI] [PubMed] [Google Scholar]
  18. Maruyama K, Yuda T, Okamoto A, Kojima S, Suginaka A., and, Iwatsuru M. Prolonged circulation time in vivo of large unilamellar liposomes composed of distearoyl phosphatidylcholine and cholesterol containing amphipathic poly(ethylene glycol) Biochim Biophys Acta. 1992;1128:44–49. doi: 10.1016/0005-2760(92)90255-t. [DOI] [PubMed] [Google Scholar]
  19. Ogris M, Brunner S, Schüller S, Kircheis R., and, Wagner E. PEGylated DNA/transferrin-PEI complexes: reduced interaction with blood components, extended circulation in blood and potential for systemic gene delivery. Gene Ther. 1999;6:595–605. doi: 10.1038/sj.gt.3300900. [DOI] [PubMed] [Google Scholar]
  20. Verbaan FJ, Oussoren C, Snel CJ, Crommelin DJ, Hennink WE., and, Storm G. Steric stabilization of poly(2-(dimethylamino)ethyl methacrylate)-based polyplexes mediates prolonged circulation and tumor targeting in mice. J Gene Med. 2004;6:64–75. doi: 10.1002/jgm.475. [DOI] [PubMed] [Google Scholar]
  21. Itaka K., and, Kataoka K. Recent development of nonviral gene delivery systems with virus-like structures and mechanisms. Eur J Pharm Biopharm. 2009;71:475–483. doi: 10.1016/j.ejpb.2008.09.019. [DOI] [PubMed] [Google Scholar]
  22. Kursa M, Walker GF, Roessler V, Ogris M, Roedl W, Kircheis R.et al. (2003Novel shielded transferrin-polyethylene glycol-polyethylenimine/DNA complexes for systemic tumor-targeted gene transfer Bioconjug Chem 14222–231. [DOI] [PubMed] [Google Scholar]
  23. Allen TM, Mehra T, Hansen C., and, Chin YC. Stealth liposomes: an improved sustained release system for 1-beta-D-arabinofuranosylcytosine. Cancer Res. 1992;52:2431–2439. [PubMed] [Google Scholar]
  24. Itaka K, Ohba S, Miyata K, Kawaguchi H, Nakamura K, Takato T.et al. (2007Bone regeneration by regulated in vivo gene transfer using biocompatible polyplex nanomicelles Mol Ther 151655–1662. [DOI] [PubMed] [Google Scholar]
  25. Akagi D, Oba M, Koyama H, Nishiyama N, Fukushima S, Miyata T.et al. (2007Biocompatible micellar nanovectors achieve efficient gene transfer to vascular lesions without cytotoxicity and thrombus formation Gene Ther 141029–1038. [DOI] [PubMed] [Google Scholar]
  26. Sagara K., and, Kim SW. A new synthesis of galactose-poly(ethylene glycol)-polyethylenimine for gene delivery to hepatocytes. J Control Release. 2002;79:271–281. doi: 10.1016/s0168-3659(01)00555-7. [DOI] [PubMed] [Google Scholar]
  27. Brissault B, Kichler A, Leborgne C, Danos O, Cheradame H, Gau J.et al. (2006Synthesis, characterization, and gene transfer application of poly(ethylene glycol-b-ethylenimine) with high molar mass polyamine block Biomacromolecules 72863–2870. [DOI] [PubMed] [Google Scholar]
  28. Tabata Y., and, Ikada Y. Effect of the size and surface charge of polymer microspheres on their phagocytosis by macrophage. Biomaterials. 1988;9:356–362. doi: 10.1016/0142-9612(88)90033-6. [DOI] [PubMed] [Google Scholar]
  29. Midoux P, Mayer R., and, Monsigny M. Membrane permeabilization by alpha-helical peptides: a flow cytometry study. Biochim Biophys Acta. 1995;1239:249–256. doi: 10.1016/0005-2736(95)00163-w. [DOI] [PubMed] [Google Scholar]
  30. Uchida S, Itaka K, Chen Q, Osada K, Miyata K, Ishii T.et al. (2011Combination of chondroitin sulfate and polyplex micelles from Poly(ethylene glycol)-poly{N'-[N-(2-aminoethyl)-2-aminoethyl]aspartamide} block copolymer for prolonged in vivo gene transfection with reduced toxicity J Control Release 155296–302. [DOI] [PubMed] [Google Scholar]
  31. Vernier PT, Sun Y., and, Gundersen MA. Nanoelectropulse-driven membrane perturbation and small molecule permeabilization. BMC Cell Biol. 2006;7:37. doi: 10.1186/1471-2121-7-37. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Beyerle A, Merkel O, Stoeger T., and, Kissel T. PEGylation affects cytotoxicity and cell-compatibility of poly(ethylene imine) for lung application: structure-function relationships. Toxicol Appl Pharmacol. 2010;242:146–154. doi: 10.1016/j.taap.2009.10.001. [DOI] [PubMed] [Google Scholar]
  33. Takae S, Miyata K, Oba M, Ishii T, Nishiyama N, Itaka K.et al. (2008PEG-detachable polyplex micelles based on disulfide-linked block catiomers as bioresponsive nonviral gene vectors J Am Chem Soc 1306001–6009. [DOI] [PubMed] [Google Scholar]
  34. Mitsui M, Nishikawa M, Zang L, Ando M, Hattori K, Takahashi Y.et al. (2009Effect of the content of unmethylated CpG dinucleotides in plasmid DNA on the sustainability of transgene expression J Gene Med 11435–443. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1.

Messenger RNA expression of proinflammatory cytokines and Cox-2 in lung at 4 hours and 24 hours after transfection.

Click here for additional data file. (37.4KB, pdf)
Figure S2.

Blood tests at 24 hours after administration.

Click here for additional data file. (125.1KB, pdf)
Figure S3.

Uptake of polyplexes by lung cells at 24 hours after transfection.

Click here for additional data file. (35.9KB, pdf)

Articles from Molecular Therapy are provided here courtesy of The American Society of Gene & Cell Therapy

RESOURCES