Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2012 Jul;78(13):4606–4612. doi: 10.1128/AEM.07961-11

Infections and Coinfections of Questing Ixodes ricinus Ticks by Emerging Zoonotic Pathogens in Western Switzerland

Elena Lommano 1, Luce Bertaiola 1, Christèle Dupasquier 1, Lise Gern 1,✉
PMCID: PMC3370488  PMID: 22522688

Abstract

In Europe, Ixodes ricinus is the vector of many pathogens of medical and veterinary relevance, among them Borrelia burgdorferi sensu lato and tick-borne encephalitis virus, which have been the subject of numerous investigations. Less is known about the occurrence of emerging tick-borne pathogens like Rickettsia spp., Babesia spp., “Candidatus Neoehrlichia mikurensis,” and Anaplasma phagocytophilum in questing ticks. In this study, questing nymph and adult I. ricinus ticks were collected at 11 sites located in Western Switzerland. A total of 1,476 ticks were analyzed individually for the simultaneous presence of B. burgdorferi sensu lato, Rickettsia spp., Babesia spp., “Candidatus Neoehrlichia mikurensis,” and A. phagocytophilum. B. burgdorferi sensu lato, Rickettsia spp., and “Candidatus Neoehrlichia mikurensis” were detected in ticks at all sites with global prevalences of 22.5%, 10.2%, and 6.4%, respectively. Babesia- and A. phagocytophilum-infected ticks showed a more restricted geographic distribution, and their prevalences were lower (1.9% and 1.5%, respectively). Species rarely reported in Switzerland, like Borrelia spielmanii, Borrelia lusitaniae, and Rickettsia monacensis, were identified. Infections with more than one pathogenic species, involving mostly Borrelia spp. and Rickettsia helvetica, were detected in 19.6% of infected ticks. Globally, 34.2% of ticks were infected with at least one pathogen. The diversity of tick-borne pathogens detected in I. ricinus in this study and the frequency of coinfections underline the need to take them seriously into consideration when evaluating the risks of infection following a tick bite.

INTRODUCTION

Ixodes ricinus is the most abundant and widespread tick species throughout Europe. It is the vector of many emerging pathogens of veterinary and human medical importance, including viruses like tick-borne encephalitis virus (TBEV); bacteria like Borrelia burgdorferi sensu lato, spotted fever group (SFG) rickettsiae, and Ehrlichia-Anaplasma; and protozoa such as Babesia spp.

B. burgdorferi sensu lato is the agent of Lyme borreliosis, the most prevalent tick-borne disease in Europe. Ten Borrelia species of the B. burgdorferi sensu lato complex (B. burgdorferi sensu stricto, B. afzelii, B. garinii, B. valaisiana, B. spielmanii, B. bavariensis, B. bissettii, B. finlandensis, B. carolinensis, and B. lusitaniae) and Borrelia miyamotoi, related to the relapsing fever spirochetes, have been detected in I. ricinus (11, 13, 22, 37), and most of them are known as pathogens of humans (22). In Switzerland, all these Borrelia genospecies, except B. bissettii, B. finlandensis, and B. carolinensis, were detected in I. ricinus ticks (22).

Ehrlichia and Anaplasma species are intracellular bacteria. Anaplasma phagocytophilum was first established as a veterinary pathogen until the discovery of the first case of human granulocytic anaplasmosis in the United States (12, 63). In Europe, fewer than 100 clinical cases have been reported (22). In Switzerland, A. phagocytophilum has been detected in fewer than 2% of I. ricinus ticks, but no human case has been documented (36, 45). Recently, a newly described pathogen, “Candidatus Neoehrlichia mikurensis,” in blood samples of a patient with signs of septicemia was reported in Switzerland (18). The bacterium, a member of the family Anaplasmataceae, has been detected primarily in I. ricinus ticks in the Netherlands and was designated an Ehrlichia-like “Schotti variant” (50). Afterwards, a similar organism, “Candidatus Neoehrlichia mikurensis,” was isolated from wild rats in Japan, representing a novel genetic cluster together with the Ehrlichia-like Schotti variant (34). Ticks infected by members of this cluster were reported in Japan (34) and in Europe (1, 50, 59, 62) but never in Switzerland.

Tick-borne rickettsioses are caused by bacteria of the genus Rickettsia, belonging to the SFG. Rickettsiae are currently considered emerging pathogens, like, for example, Rickettsia helvetica and R. monacensis in Europe and Eurasia. The pathogenicity of R. helvetica remains unclear, although it was reported to be involved in some cardiac and neurological symptoms (19, 39, 40). R. monacensis was isolated from the blood of patients (31) and was found in I. ricinus ticks from different countries in Europe. In Switzerland, R. helvetica appears frequently in ticks (7), whereas R. monacensis is rare (9).

Babesiosis, caused by a protozoon of the genus Babesia, is a disease of veterinary importance but is getting increasing consideration as an emerging disease of humans. In Europe, Babesia divergens, B. microti, and B. venatorum (also known as Babesia sp. EU1) are of medical importance (27). In Switzerland, a recent study reported these three Babesia species in fewer than 2% of ticks (23).

Information on the occurrence of the above-mentioned pathogens, except B. burgdorferi sensu lato, is scarce, especially in Western Switzerland. Moreover, little is known about their coexistence in I. ricinus ticks. In Europe, the prevalence of ticks carrying multiple pathogens has been reported to vary between 3.2% (47) and 28.8% (57). Because mixed infections (involving species of same genus) and coinfections (involving species of different genera) are of medical relevance, by increasing the severity of symptoms in humans and animals (6), it is crucial to determine the prevalence of ticks infected by more than one pathogen. Hence, our aim was to gain an insight into the prevalence and geographic distribution of Borrelia spp., A. phagocytophilum, “Candidatus Neoehrlichia mikurensis,” Rickettsia spp., and Babesia spp. as well as their coinfections in free-living I. ricinus ticks at various sites in the Western Swiss Plateau. (These results are part of the Ph.D. thesis of E. Lommano.)

MATERIALS AND METHODS

Study area and tick sampling.

This study was carried out at 11 sites located between 400 and 900 m above sea level: Romanel (46°34.37′N, 6°35.59′E), Chalet-à-Gobet (46°34.04′N, 6°40.62′E), Agiez (46°43.23′N, 6°29.90′E), Montcherand (46°44.04′N, 6°29.26′E), Delémont (47°22.41′N, 7°19.40′E), Mormont (47°26.20′N, 7°02.61′E), Rosé (46°47.66′N, 7°04.68′E), Belfaux (46°50.07′N, 7°05.43′E), Matran (46°46.73′N, 7°05.24′E), Seedorf (46°48.10′N, 7°02.30′E), and Neuchâtel (47°01.00′N, 6°56.00′E). All sites were mixed deciduous forests. Questing ticks were collected by flagging vegetation in 2009 and 2010.

Amplification and detection of tick-borne pathogen DNA.

Total DNA was extracted from nymphs and adults by using ammonium hydroxide (NH4OH) (38). Each tick was tested individually for the presence of A. phagocytophilum, “Candidatus Neoehrlichia mikurensis,” Rickettsia sp., Babesia sp., and B. burgdorferi sensu lato DNAs using specific primers and probes (Table 1). All PCR amplifications were performed with final volumes of 25 μl with 5 μl of template DNA, except for A. phagocytophilum (2 μl) and Babesia spp. (10 μl). Negative (sterile water) and positive controls were included for each PCR amplification.

Table 1.

Primers and probes used in this study for PCR, RLB, and real-time PCRa

Primer or probe Sequence (5′–3′) Concn (pmol) for RLB Type of sequence Target gene Target organism Reference
RCK/23-5-F Biotin-GATAGGTCRGRTGTGGAAGCAC Primer 23S-5S rRNA gene Rickettsia genus 30
RCK/23-5-R TCGGGAYGGGATCGTGTGTTTC Primer 23S-5S rRNA gene Rickettsia genus 30
GP-RICK TAGCTCGATTGRTTTACTTTG 100 Probe 23S-5S rRNA gene Rickettsia genus 30
RCK-SFG ACTCACAARGTTATCAGGT 500 Probe 23S-5S rRNA gene SFG Rickettsia 30
P-HELV CATGGCTTGATCCACGGTA 100 Probe 23S-5S rRNA gene R. helvetica 30
RLB-F2 GACACAGGGAGGTAGTGACAAG Primer 18S rRNA gene Babesia-Theileria genus 20
RLB-R2 Biotin-CTAAGAATTTCACCTCTGACAGT Primer 18S rRNA gene Babesia-Theileria genus 20
Catch-all B/T TAATGGTTAATAGGARCRGTTG 50 Probe 18S rRNA gene Babesia-Theileria genus 20
B. venatorum GAGTTATTGACTCTTGTCTTTAA 500 Probe 18S rRNA gene B. venatorum 23
B. divergens GTTAATATTGACTAATGTCGAG 500 Probe 18S rRNA gene B. divergens 23a
B. microti GCTTCCGAGCGTTTTTTTAT 500 Probe 18S rRNA gene B. microti 23
ApM SP2f ATGGAAGGTAGTGTTGGTTATGGTATT Primer msp2 gene A. phagocytophilum 14
ApM SP2r TTGGTCTTGAAGCGCTCGTA Primer msp2 gene A. phagocytophilum 14
ApM SP2p FAM-TGGTGCCAGGGTTGAGCTTGAGATTG-TAMRA Probe msp2 gene A. phagocytophilum 14
16S8FE GGAATTCAGAGTTGGATCMTGGYTCAG Primer 16S rRNA gene Anaplasma-Ehrlichia genus 50
B-GA1B biotin-CGGGATCCCGAGTTTGCCGGGACTTYTTCT Primer 16S rRNA gene Anaplasma-Ehrlichia genus 5
Catch-all A/E GGGGGAAAGATTTATCGCTA 100 Probe 16S rRNA gene Anaplasma-Ehrlichia genus 5
A-Eschot GCTGTAGTTTACTATGGGTA 100 Probe 16S rRNA gene “Candidatus Neoehrlichia mikurensis” 50
FlaF1A AGCAAATTTAGGTGCTTTCCAA Primer Flagellin gene Borrelia burgdorferi sensu lato 51
FlaR1 GCAATCATTGCCATTGCAGA Primer Flagellin gene Borrelia burgdorferi sensu lato 51
Flaprobe1 FAM-TGCTACAACCTCATCTGTCATTGTAGCATCTTTTA Probe Flagellin gene Borrelia burgdorferi sensu lato 51
B-5SBor Biotin-GAGTTCGCGGGAGAGTAGGTTATT Primer 5S-23S spacer Borrelia burgdorferi sensu lato 1
23SBor TCAGGGTACTTAGATGGTTCACTT Primer 5S-23S spacer Borrelia burgdorferi sensu lato 1
SL1 CTTTGACCATATTTTTATCTTCCA 75 Probe 5S-23S spacer Borrelia burgdorferi sensu lato 48a
SS AACACCAATATTTAAAAAACATAA 75 Probe 5S-23S spacer Borrelia burgdorferi sensu stricto 48a
GA AACATGAACATCTAAAAACATAAA 75 Probe 5S-23S spacer B. garinii 48a
GANE CAAAAACATAAATATCTAAAAACATAA 75 Probe 5S-23S spacer B. garinii 43
AF AACATTTAAAAAATAAATTCAAGG 75 Probe 5S-23S spacer B. afzelii 48a
VSNE TATATCTTTTGTTCAATCCATGT 75 Probe 5S-23S spacer B. valaisiana 43
LusiNE TCAAGATTTGAAGTATAAAATAAAA 75 Probe 5S-23S spacer B. lusitaniae 43
LusiNE1 CATTCAAAAAAATAAACATTTAAAAACAT 100 Probe 5S-23S spacer B. lusitaniae 21
LusiNE2 AAATCAAACATTCAAAAAAATAAAC 100 Probe 5S-23S spacer B. lusitaniae 21
RFLNE CTATCCATTGATCAATGC 100 Probe 5S-23S spacer B. miyamotoi 21
SpiNE2 GAATGGTTTATTCAAATAACATA 100 Probe 5S-23S spacer B. spielmanii 21
SpiNE3 GAATAAGCCATTTAAATAACATA 100 Probe 5S-23S spacer B. spielmanii 21
GANE1 AAAATCAATGTTTAAAGTATAAAAT 100 Probe 5S-23S spacer B. garinii 21
BisNE1 AAACACTAACATTTAAAAAACAT 100 Probe 5S-23S spacer B. bissettii 21
BisNE2 AACTAACAAACATTTAAAAAACAT 100 Probe 5S-23S spacer B. bissettii 21
a

All probes for RLB were 5′-amino labeled. FAM, 6-carboxyfluorescein; TAMRA, 6-carboxytetramethylrhodamine.

“Candidatus Neoehrlichia mikurensis.”

A ∼500-bp fragment of the 16S rRNA gene spanning the V1 region of Anaplasma spp. and Ehrlichia spp. was amplified as described previously (50), using modifications described previously by Bekker et al. (5). The positive control consisted of 3 μl of A. phagocytophilum DNA (Webster strain). A touchdown PCR program, modified from a method described previously by Bekker et al. (5), was performed (58). The reverse line blot (RLB) technique was used to identify “Candidatus Neoehrlichia mikurensis” (50).

A. phagocytophilum.

A 77-bp fragment of the msp2 gene of A. phagocytophilum was amplified and detected by using a real-time PCR method reported previously (9), with modifications (14). The positive control consisted of 2 μl of A. phagocytophilum (Webster strain). For sequencing, the 16S rRNA gene was amplified with primers 16S8FE and B-GA1B (5) (Table 1).

Rickettsia spp.

A PCR targeting the 23S-5S internal spacer of Rickettsia spp. (30) and amplifying a 345-bp fragment was coupled with an RLB hybridization procedure (9), modified as described previously by Jado et al. (30). DNA of Rickettsia conorii was used as the positive control.

Babesia spp.

For the detection of Babesia spp., a 450-bp fragment of the 18S rRNA gene was amplified (20). The positive control consisted of 1 μl of B. microti or B. divergens DNA. A touchdown PCR program was performed as described previously (58), followed by RLB for the identification of Babesia species (23).

Borrelia spp.

A real-time PCR was used to amplify a 132-bp fragment of the flagellin gene of Borrelia spp. (26, 51). Isolates of B. burgdorferi sensu stricto (B31), B. garinii (NE11), B. afzelii (NE632), and B. valaisiana (VS116) were used as positive controls. Each sample that was positive by real-time PCR was further analyzed by PCR and RLB to identify B. burgdorferi sensu lato genospecies (26). The amplification of the intergenic spacer region between the 5S and 23S rRNA genes was performed as described previously (1), using a touchdown program (8) followed by RLB for the identification of Borrelia species (Table 1) (21).

DNA sequencing.

Positive PCR products were purified with a purification kit (Promega, Madison, WI) and sent to Microsynth AG (Balgach, Switzerland) for sequencing. Each obtained sequence was compared with sequences from an international database (NCBI BLAST) by the use of ClustalW2.0.12 (56).

Statistical analysis.

The influence of I. ricinus life stages on Borrelia infection and coinfection was assessed by a χ2 test on a contingency table.

Nucleotide sequence accession numbers.

Three “Candidatus Neoehrlichia mikurensis” sequences were submitted to the NCBI GenBank database under accession numbers JQ014620, JQ014621, and JQ014622. GenBank accession numbers for one R. monacensis sequence and one A. phagocytophilum sequence were JQ670878 and JQ277467, respectively.

RESULTS

A total of 1,476 I. ricinus ticks, including 1,194 nymphs and 282 adults (144 females and 138 males), were collected and individually screened for the presence of A. phagocytophilum, Rickettsia sp., Borrelia sp., and Babesia sp. DNAs (Table 2). The occurrence of “Candidatus Neoehrlichia mikurensis” was screened for in 818/1,476 ticks collected at 5/11 sites (648 nymphs, 91 females, and 79 males).

Table 2.

Prevalence of tick-borne pathogens detected in ticks according to sampling sitea

Sampling site No. of ticks analyzed No. of ticks positive for pathogen/total no. of ticks tested (%)
No. of ticks infected with at least 1 pathogen/total no. of ticks tested
A. phagocytophilum “Candidatus Neoehrlichia mikurensis” Rickettsia spp. Babesia spp. Borrelia spp.
Romanel 86 0/86 (0) 6/86 (7) 12/86 (13.9) 1/86 (1.2) 8/86 (9.3) 26/86 (30.2)
Chalet-à-Gobet 129 3/129 (2.3) 3/129 (2.3) 15/129 (11.6) 3/129 (2.3) 22/129 (17) 39/129 (29.4)
Agiez 125 0/125 (0) NA 11/125 (8.8) 3/125 (2.4) 26/122 (21.3) 39/125 (31.2)
Montcherand 156 5/156 (3.2) NA 10/156 (6.4) 7/156 (4.5) 40/156 (25.6) 58/156 (37.2)
Delémont 145 0/145 (0) 6/145 (4.1) 16/145 (11) 2/145 (1.4) 38/145 (26.2) 51/145 (35.2)
Mormont 71 0/71 (0) 3/71 (4.2) 10/71 (14.1) 0/71 (0) 13/71 (18.3) 21/71 (29.6)
Rosé 131 0/131 (0) NA 20/131 (15.3) 4/131 (3.1) 30/125 (24) 49/131 (37.4)
Belfaux 140 3/140 (2.1) NA 22/140 (15.7) 4/140 (2.8) 34/140 (24.3) 52/140 (37.1)
Matran 24 0/24 (0) NA 1/24 (4.2) 0/24 (0) 8/24 (33.3) 9/24 (37.5)
Seedorf 82 0/82 (0) NA 9/82 (11) 2/82 (2.4) 21/82 (25.6) 29/82 (35.4)
Neuchâtel 387 11/387 (2.8) 34/387 (8.8) 24/387 (6.2) 2/387 (0.5) 88/378 (23.3) 132/387 (34.1)
Total 1,476 22/1,476 (1.5) 52/818 (6.4) 150/1,476 (10.2) 28/1,476 (1.9) 328/1,458 (22.5) 505/1476 (34.2)
a

NA, not available. Minimum and maximum prevalences are underlined.

Borrelia spp. were the most frequently isolated pathogens in ticks, with a global prevalence of 22.5% (328/1,458) (Table 2). Some ticks (n = 18/1,476) could not be screened for Borrelia due to a lack of material. Borrelia-infected ticks were detected at all sites. Adults (30.8%; 87/282) were significantly more infected than nymphs (20.5%; 241/1,176) (P < 0.001 by χ2 test). Due to a lack of material, the Borrelia species in 6 samples that were positive by real-time PCR could not be identified by RLB. Among the 328 Borrelia-infected ticks, 357 events of infection (including single and mixed infections) were detected by RLB, and 6 different genospecies were identified. B. afzelii was predominant (141/357; 39.5%), followed by B. garinii (92/357; 25.8%), B. valaisiana (59/357; 16.5%), B. burgdorferi sensu stricto (20/357; 5.6%), B. bavariensis (17/357; 4.8%), and B. miyamotoi (15/357; 4.2%). For 10 out of 357 (2.8%) infections, Borrelia isolates could not be identified to the species level. Additionally, B. lusitaniae was detected in two nymphs collected at Agiez and Delémont, and B. spielmanii was detected in one male (in a mixed infection with B. afzelii) at Montcherand.

Rickettsia-infected ticks were observed at all sites, with a global prevalence of 10.2% (150/1,476 ticks; 123/1,194 nymphs and 27/282 adults) (Table 2). R. helvetica was predominantly detected (136/150; 90.7%), followed by unidentified Rickettsia spp. (12/150; 8%). R. monacensis was identified in two nymphs (2/150; 1.3%) collected at two different sites (Agiez and Delémont) after sequencing the 23S-5S rRNA gene. Both sequences showed 100% homology with Rickettsia sp. strain 362 (accession number DQ139797).

A. phagocytophilum-infected ticks were recorded at 4/11 sites (Table 2). The global prevalence reached 1.5% (22/1,476; 18/1,194 nymphs and 4/282 adults), and the mean local prevalence (only sites where A. phagocytophilum was present are taken into consideration) was 2.7% (22/812). Sequencing (16S rRNA gene) was successful for one sample, which showed 100% homology with an A. phagocytophilum strain from a cat (accession number HM138366) and 99% homology (divergence of 1 base only) with strains isolated from human blood in Italy (accession number DQ029028), I. ricinus (accession number AF084907), and one horse (accession number AF057707) in Switzerland.

“Candidatus Neoehrlichia mikurensis” DNA was found at all sites, with a global prevalence of 6.4% (52/818; 41/648 nymphs and 11/170 adults) (Table 2). Sequencing of 20/52 samples (16S rRNA gene) revealed 100% homology to each other and to other strains isolated from human blood in Switzerland (GenBank accession number GQ501090) and Germany (accession number EU810404) and from I. ricinus in Germany (accession number EU810405).

Babesia-infected ticks were detected at 9/11 sites, with a global prevalence of 1.9% (28/1,476; 25/1,194 nymphs and 3/282 adults). Local prevalence varied between 0.5% (2/387 ticks for Neuchâtel) and 4.5% (7/156 for Montcherand) (Table 2). B. venatorum was the most prevalent species (18/28; 64.3%), followed by B. divergens (5/28; 17.9%). Five out 28 (17.9%) Babesia sp. isolates could not be identified to the species level with RLB, and sequencing (18S rRNA gene) of these samples was not successful.

Mixed infections, involving two or three Borrelia genospecies, occurred in 2.1% (30/1,458) of ticks and in 9.1% (30/328) of Borrelia-infected ticks (Table 3). The B. garinii-B. valaisiana association was the most frequently found association (Table 3). Coinfections involving pathogens of different genera were detected in 4.7% (69/1,476) of ticks and in 13.7% (69/505) of infected ticks (Table 3). These coinfections involved mostly B. afzelii and R. helvetica. B. afzelii was found mostly in association with R. helvetica (13/36; 36.1%) and “Candidatus Neoehrlichia mikurensis” (12/36; 33.3%) (Table 3). Inversely, 60% of “Candidatus Neoehrlichia mikurensis” isolates were in coinfections with B. afzelii (12/20) (Table 3).

Table 3.

Coinfections (involving two pathogens) observed in ticksb

Pathogen genus Pathogen species No. of ticks with coinfection with:
B. afzelii B. garinii B. burgdorferi sensu stricto B. valaisiana B. bavariensis B. miyamotoi B. spielmanii SL SP EU1 B. divergens A. phagocytophilum “Candidatus Neoehrlichia mikurensis” Rickettsia helvetica Rickettsia sp.c
Borrelia B. afzelii 5 3 2 1 12 13
B. garinii 5 11 2 1 2 1 6 1
B. burgdorferi sensu stricto 3 2
B. valaisiana 2 11 3 1 1 8 1
B. bavariensis 3 1
B. miyamotoi 2 3
B. spielmanii 1
SL 2
SP 1
Babesia EU1 1 1 4
B. divergens 1
Anaplasma-Ehrlichia A. phagocytophilum 2 1 2 1 2 1
“Candidatus Neoehrlichia mikurensis” 12 1 1 3 2 1
Rickettsia Rickettsia helvetica 13 6 2 8 1 4 1 1
Rickettsia spp.c 1 1 1 1
Total coinfections (n = 93) 36 29 5 27 4 5 1 2 1 6 1 9 20 36 4
Total infections (n = 505)a 141 92 20 59 17 15 1 10 6 18 5 22 52 136 12
a

“Total infections” refers to the total number of infections involving the concerned pathogen.

b

SL, Borrelia spp. matching only with the SL1 probe (RLB); SP, Borrelia spp. that could not be identified by RLB due to a lack of DNA; EU1, Babesia venatorum.

c

Matching only with the generic probe.

If we considered ticks to be infected by more than one pathogen species, we observed a global prevalence of 6.7% (99/1,476). Among infected ticks, 19.6% (99/505 ticks) were carrying more than one pathogen species. Globally, adult ticks (31/282; 11%) were more frequently infected with multiple pathogens than nymphs (68/1,194; 4.6%) (P < 0.005 by χ2 test). Infections with three pathogen species were observed for 6 ticks (6/1,476). The B. afzelii-B. garinii-B. valaisiana association was found in two nymphs, and the B. garinii-B. valaisiana-B. miyamotoi association was observed in one male. The other three triple infections consisted of B. afzelii-B. garinii-R. helvetica (in one male), B. garinii-B. valaisiana-R. helvetica (in one nymph), and B. valaisiana-R. helvetica-“Candidatus Neoehrlichia mikurensis” (in one nymph).

B. valaisiana occurred frequently in multiple infections (27/59; 45%), mostly with B. garinii (11/59; 18.6%) and R. helvetica (8/59; 13.6%) (Table 3). Additionally, B. valaisiana was implicated in 5/6 triple infections (see above). Similarly, A. phagocytophilum was frequently involved in coinfections, since 9/22 (41%) A. phagocytophilum infections were coinfections (Table 3).

Globally, the prevalence of ticks infected with at least one pathogen reached 34.2% (505/1,476) (Table 2).

DISCUSSION

Here, we assessed the prevalences and geographic distribution of five human-pathogenic microorganisms (Borrelia spp., Rickettsia spp., Babesia spp., A. phagocytophilum, and “Candidatus Neoehrlichia mikurensis”), as well as their coinfections, in questing ticks at 11 sites situated in Western Switzerland.

Borrelia spp., Rickettsia spp., and “Candidatus Neoehrlichia mikurensis” were present at all sites, while Babesia spp. and A. phagocytophilum showed a more restricted geographic distribution. Ticks infected with Borrelia genospecies were largely predominant, and the mean prevalence reached 22.5%, followed by Rickettsia spp., which were identified in 10.2% of ticks. This is in line with prevalences previously reported for Switzerland (7, 33). In contrast, the prevalence of Babesia spp. and A. phagocytophilum in ticks was lower than 2%, and they were not present at all sites. The absence of Babesia spp. at two sites can be explained by the relatively few ticks examined at these sites (n = 24 and n = 71) in relation with the low mean prevalence observed (1.9%). However, A. phagocytophilum was absent from sites where it could be reasonably expected to occur considering its mean local prevalence (2.7%) and the number of collected ticks, indicating a patchy distribution. A similar patchy distribution was reported previously for Spain and Sweden (3, 52). On the other hand, despite the low prevalence of infected ticks and their patchy distribution within a region, the “pockets of infection” were quite stable over years. In fact, when A. phagocytophilum was present at a location, it was detected again the following year (data not shown). The low prevalence of Babesia spp. and A. phagocytophilum is in the range (0 to 1.7% and 0.8 to 2%, respectively) of what has been observed in Switzerland (9, 10, 23, 45). The A. phagocytophilum sequence obtained here was identical or closely related (99 to 100% identity) to those of other pathogenic strains isolated from domestic animals in Switzerland and the Czech Republic (44; D. Hulinska, unpublished data), from I. ricinus ticks in Switzerland (45), and from humans in Italy (15). Therefore, the presence of this pathogenic strain in ticks from Switzerland points out a real risk of infection for animals and humans.

This study reports for the first time the presence of “Candidatus Neoehrlichia mikurensis” in questing I. ricinus ticks from Switzerland. More than 6% of ticks were infected by this microorganism, which occurred at all sites. In Europe, the prevalence of “Candidatus Neoehrlichia mikurensis” is known to range from 3.5% to 7% (1, 50, 62). “Candidatus Neoehrlichia mikurensis” can currently be considered an emerging pathogen of veterinary and medical importance. In 2007, the bacterium was identified in a dog with hematological troubles in Germany (17). In 2010, four human cases were reported in Switzerland, Germany, and Sweden (18, 60, 61), one of which was fatal. All the sequences here were identical to sequences of strains detected in the blood samples of patients suffering from febrile bacteremia in Switzerland and Germany (18, 60) and of a strain from I. ricinus in Germany (59). Our findings indicate that “Candidatus Neoehrlichia mikurensis” is present in questing ticks in Western Switzerland, representing a risk of contracting “Candidatus Neoehrlichia mikurensis” for humans and pets.

Among the five pathogens identified here, Borrelia spp. and Rickettsia spp. demonstrated a high variability in their occurrences in ticks according to site. Their local prevalences ranged from 9.3% to 33.3% for Borrelia spp. and from 4.2% to 15.7% for Rickettsia spp. Similar variations were observed previously in Europe, where local prevalences of Borrelia spp. (33, 47) and Rickettsia spp. (24) differed greatly among areas. Ecological conditions present at each site, including reservoir host availability or a high density of reservoir-incompetent hosts, most certainly play a role in these local variations.

The prevalences of the different Borrelia genospecies in ticks were in agreement with previously reported findings in Switzerland (26), except that two uncommon genospecies (B. lusitaniae and B. spielmanii) were detected in this study. B. lusitaniae-infected ticks are very common around the southern limit of the distribution of I. ricinus ticks (16, 64) but are quite uncommon in other regions. In Switzerland, B. lusitaniae has been detected in free-living ticks in some localities of Canton Ticino (32), in ticks feeding on birds (43), and in Western Switzerland (33); our findings report its occurrence in two additional localities. In contrast, B. spielmanii has been reported only once in Switzerland (21). B. spielmanii, which is pathogenic to humans (4), has already been identified in ticks in France and Germany (46, 48).

Two different Rickettsia species were identified here. R. helvetica was the most common and the most abundant species. The other species, R. monacensis, was found in only two nymphs. Sequencing revealed 100% identity with Rickettsia sp. strain 362, isolated from the blood samples of patients with Mediterranean spotted fever in Spain (30) and recognized afterwards as R. monacensis, a novel Rickettsia species (54). The arrangement of Rickettsia species observed here (>90% R. helvetica and <2% R. monacensis) was similar to that reported previously for Switzerland, where few R. monacensis-infected ticks have been identified (7, 9), whereas R. helvetica is commonly identified in ticks (7, 41). R. monacensis is only sporadically present in Central Europe, while it tends to be more common in Southern Europe (49).

B. venatorum was by far the most prevalent Babesia sp. identified here, followed by unidentified Babesia spp. and B. divergens. The predominance of B. venatorum has also been recognized in other European countries (47, 49), including Switzerland (9, 23). Although most of the human clinical cases in Europe are due to B. divergens, B. venatorum was recently involved in clinical cases in Italy, Germany, and Austria (25, 27).

Mixed infections with two or three Borrelia genospecies occurred in 2.1% of ticks and in 9.1% of Borrelia-infected ticks. Moreover, coinfections with pathogens of different genera were detected in 4.7% of ticks and in 13.7% of infected ticks. Globally, 6.7% of ticks and 19.6% of infected ticks were carrying more than one pathogen (mixed infections and coinfections); among them, coinfections with B. afzelii and R. helvetica were the most frequent. This was not surprising, as they represented the most prevalent species. B. afzelii was strongly associated with R. helvetica and “Candidatus Neoehrlichia mikurensis,” probably due to their common reservoir hosts. In fact, B. afzelii is associated with rodents (22), and some previous studies designated rodents as potential reservoirs for “Candidatus Neoehrlichia mikurensis” (2, 34). I. ricinus acts as both a vector and a reservoir host of R. helvetica, and no vertebrate host is really required for its maintenance. Nevertheless, it was demonstrated previously that mice and roe deer might also be reservoirs for R. helvetica (55).

B. valaisiana was frequently implicated in mixed infections with B. garinii and in coinfections with two or three pathogens, mostly with R. helvetica. B. valaisiana and B. garinii share a common reservoir host, songbirds (28). To our knowledge, only one previous study described coinfections involving B. valaisiana and R. helvetica (47). Interestingly, the level of involvement of A. phagocytophilum in coinfections was relatively high (0.6%), compared to its low prevalence (1.5%). Part of explanation for this finding is the immunosuppressive action of A. phagocytophilum, making infected animals and humans more susceptible to other infections (63). Triple infections were detected in two males and four nymphs, underlining the important role of hosts as sources of multiple infections for ticks by carrying various microorganisms. As expected, I. ricinus adults were more frequently infected with multiple pathogens than nymphs, probably due to consecutive feedings.

In our study area, five different pathogens were found to circulate, and surprisingly, a high frequency of ticks was infected with at least one pathogen (34.2%). Moreover, 19.6% of infected ticks were carrying more than one pathogen, and this prevalence could easily be expected to be higher if all collected ticks had been screened for “Candidatus Neoehrlichia mikurensis.” Compared to a previous study of the same pathogens (except “Candidatus Neoehrlichia mikurensis”) in Luxembourg (47), Borrelia spp. and Rickettsia spp. were found more frequently in ticks in this study (22.5% and 10.2%, respectively, compared to frequencies of 11.3% and 5.1%, respectively, reported previously [47]), while the prevalences of Babesia spp. and A. phagocytophilum were slightly lower (1.9% and 1.5%, respectively, compared to prevalences of 2.7% and 1.9%, respectively, reported previously [47]). Moreover, the global prevalence of ticks infected by at least one pathogen in this study (34.2%) and the prevalence of multiple infections in ticks (6.7%) were higher than those reported previously for Luxemburg (19.5% and 3.2%, respectively [47]). In conclusion, this study contributes to a better understanding of the occurrence and co-occurrence of human-pathogenic agents in questing I. ricinus ticks.

ACKNOWLEDGMENTS

This work was financially supported by the Swiss National Foundation (grant no 310030-127064/1).

We are grateful to Mégane Pluess for her technical assistance and to Olivier Rais and Paul Monnerat and his students for having collected ticks in Neuchâtel and Jura, respectively. We thank Ana Sofia Santos (CEVDI, Portugal), Simona Casati (Instituto di Microbiologia, Ticino, Switzerland), and Olivier Péter (Institut Central des Hôpitaux du Valais, Sion, Switzerland) for providing positive controls.

Footnotes

Published ahead of print 20 April 2012

REFERENCES

  • 1. Alekseev AN, Dubinina HV, Van De Pol I, Schouls LM. 2001. Identification of Ehrlichia spp. and Borrelia burgdorferi in Ixodes ticks in the Baltic regions of Russia. J. Clin. Microbiol. 39:2237–2242 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Andersson M, Raberg L. 2011. Wild rodents and novel human pathogen Candidatus Neoehrlichia mikurensis, Southern Sweden. Emerg. Infect. Dis. 17:1716–1718 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Barandika JF, et al. 2008. Prevalence of tick-borne zoonotic bacteria in questing adult ticks from northern Spain. Vector Borne Zoonotic Dis. 8:829–835 [DOI] [PubMed] [Google Scholar]
  • 4. Baranton G, De Martino SJ. 2009. Borrelia burgdorferi sensu lato diversity and its influence on pathogenicity in humans. Curr. Probl. Dermatol. 37:1–17 [DOI] [PubMed] [Google Scholar]
  • 5. Bekker CP, de Vos S, Taoufik A, Sparagano OA, Jongejan F. 2002. Simultaneous detection of Anaplasma and Ehrlichia species in ruminants and detection of Ehrlichia ruminantium in Amblyomma variegatum ticks by reverse line blot hybridization. Vet. Microbiol. 89:223–238 [DOI] [PubMed] [Google Scholar]
  • 6. Belongia EA. 2002. Epidemiology and impact of coinfections acquired from Ixodes ticks. Vector Borne Zoonotic Dis. 2:265–273 [DOI] [PubMed] [Google Scholar]
  • 7. Boretti FS, et al. 2009. Molecular investigations of Rickettsia helvetica infection in dogs, foxes, humans, and Ixodes ticks. Appl. Environ. Microbiol. 75:3230–3237 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Burri C, Morán Cadenas F, Douet V, Moret J, Gern L. 2007. Ixodes ricinus density and infection prevalence of Borrelia burgdorferi sensu lato along a north-facing altitudinal gradient in the Rhone Valley (Switzerland). Vector Borne Zoonotic Dis. 7:50–58 [DOI] [PubMed] [Google Scholar]
  • 9. Burri C, Dupasquier C, Bastic V, Gern L. 2011. Pathogens of emerging tick borne diseases, Anaplasma phagocytophilum, Rickettsia spp., and Babesia spp., in Ixodes ticks collected from rodents at four sites in Switzerland (Canton of Bern). Vector Borne Zoonotic Dis. 11:939–944 [DOI] [PubMed] [Google Scholar]
  • 10. Casati S, Sager H, Gern L, Piffaretti JC. 2006. Presence of potentially pathogenic Babesia sp. for human in Ixodes ricinus in Switzerland. Ann. Agric. Environ. Med. 13:65–70 [PubMed] [Google Scholar]
  • 11. Casjens SR, et al. 2011. Whole genome sequence of an unusual Borrelia burgdorferi sensu lato isolate. J. Bacteriol. 193:1489–1490 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Chen SM, Dumler JS, Bakken JS, Walker DH. 1994. Identification of a granulocytotropic Ehrlichia species as the etiologic agent of human disease. J. Clin. Microbiol. 32:589–595 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Cotté V, Bonnet S, Cote M, Vayssier-Taussat M. 2010. Prevalence of five pathogenic agents in questing Ixodes ricinus ticks from western France. Vector Borne Zoonotic Dis. 10:1–8 [DOI] [PubMed] [Google Scholar]
  • 14. Courtney JW, Kostelnik LM, Zeidner NS, Massung RF. 2004. Multiplex real-time PCR for detection of Anaplasma phagocytophilum and Borrelia burgdorferi. J. Clin. Microbiol. 42:3164–3168 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. de la Fuente J, et al. 2005. Infection with Anaplasma phagocytophilum in a seronegative patient in Sicily, Italy: case report. Ann. Clin. Microbiol. Antimicrob. 4:15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. de Michelis S, et al. 2000. Genetic diversity of Borrelia burgdorferi sensu lato in ticks from Mainland Portugal. J. Clin. Microbiol. 38:2128–2133 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Diniz PP, Schulz BS, Hartmann K, Breitschwerdt EB. 2011. “Candidatus Neoehrlichia mikurensis” infection in a dog from Germany. J. Clin. Microbiol. 49:2059–2062 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Fehr JS, et al. 2010. Septicemia caused by tick-borne bacterial pathogen Candidatus Neoehrlichia mikurensis. Emerg. Infect. Dis. 16:1127–1129 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Fournier PE, Grunnenberger F, Jaulhac B, Gastinger G, Raoult D. 2000. Evidence of Rickettsia helvetica infection in humans, eastern France. Emerg. Infect. Dis. 6:389–392 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Georges K, et al. 2001. Detection of haemoparasites in cattle by reverse line blot hybridisation with a note on the distribution of ticks in Sicily. Vet. Parasitol. 99:273–286 [DOI] [PubMed] [Google Scholar]
  • 21. Gern L, Douet V, López Z, Rais O, Morán Cadenas F. 2010. Diversity of Borrelia genospecies in Ixodes ricinus ticks in a Lyme borreliosis endemic area in Switzerland identified by using new probes for reverse line blotting. Ticks Tick Borne Dis. 1:23–29 [DOI] [PubMed] [Google Scholar]
  • 22. Gern L, Lienhard R, Péter O. 2010. Diseases and pathogenic agents transmitted by ticks in Switzerland. Rev. Med. Suisse 6:1906–1909 (In French.) [PubMed] [Google Scholar]
  • 23. Gigandet L, et al. 2011. Prevalence of three zoonotic Babesia species in Ixodes ricinus (Linné, 1758) nymphs in a suburban forest in Switzerland. Vector Borne Zoonotic Dis. 11:363–366 [DOI] [PubMed] [Google Scholar]
  • 23a. Gubbels JM, et al. 1999. Simultaneous detection of bovine Theileria and Babesia species by reverse line blot hybridization. J. Clin. Microbiol. 37:1782–1789 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Hartelt K, et al. 2004. Pathogens and symbionts in ticks: prevalence of Anaplasma phagocytophilum (Ehrlichia sp.), Wolbachia sp., Rickettsia sp., and Babesia sp. in Southern Germany. Int. J. Med. Microbiol. 293(Suppl 37):86–92 [DOI] [PubMed] [Google Scholar]
  • 25. Häselbarth K, Tenter AM, Brade V, Krieger G, Hunfeld KP. 2007. First case of human babesiosis in Germany—clinical presentation and molecular characterisation of the pathogen. Int. J. Med. Microbiol. 297:197–204 [DOI] [PubMed] [Google Scholar]
  • 26. Herrmann C, Gern L. 2010. Survival of Ixodes ricinus (Acari: Ixodidae) under challenging conditions of temperature and humidity is influenced by Borrelia burgdorferi sensu lato infection. J. Med. Entomol. 47:1196–1204 [DOI] [PubMed] [Google Scholar]
  • 27. Herwaldt BL, et al. 2003. Molecular characterization of a non Babesia divergens organism causing zoonotic babesiosis in Europe. Emerg. Infect. Dis. 9:942–948 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Humair PF, Postic D, Wallich R, Gern L. 1998. An avian reservoir (Turdus merula) of the Lyme borreliosis spirochetes. Zentralbl. Bakteriol. 287:521–538 [PubMed] [Google Scholar]
  • 29. Reference deleted.
  • 30. Jado I, et al. 2006. Molecular method for identification of Rickettsia species in clinical and environmental samples. J. Clin. Microbiol. 44:4572–4576 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Jado I, et al. 2007. Rickettsia monacensis and human disease, Spain. Emerg. Infect. Dis. 13:1405–1407 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Jouda F, Crippa M, Perret JL, Gern L. 2003. Distribution and prevalence of Borrelia burgdorferi sensu lato in Ixodes ricinus ticks of canton Ticino (Switzerland). Eur. J. Epidemiol. 18:907–912 [DOI] [PubMed] [Google Scholar]
  • 33. Jouda F, Perret JL, Gern L. 2004. Density of questing Ixodes ricinus nymphs and adults infected by Borrelia burgdorferi sensu lato in Switzerland: spatio-temporal pattern at a regional scale. Vector Borne Zoonotic Dis. 4:23–32 [DOI] [PubMed] [Google Scholar]
  • 34. Kawahara M, et al. 2004. Ultrastructure and phylogenetic analysis of ‘Candidatus Neoehrlichia mikurensis’ in the family Anaplasmataceae, isolated from wild rats and found in Ixodes ovatus ticks. Int. J. Syst. Evol. Microbiol. 54:1837–1843 [DOI] [PubMed] [Google Scholar]
  • 35. Reference deleted.
  • 36. Liz JS, et al. 2000. PCR detection of granulocytic ehrlichiae in Ixodes ricinus ticks and wild small mammals in western Switzerland. J. Clin. Microbiol. 38:1002–1007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Margos G, et al. 2009. A new Borrelia species defined by multilocus sequence analysis of housekeeping genes. Appl. Environ. Microbiol. 75:5410–5416 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Morán-Cadenas F, et al. 2007. A comparison of two DNA extraction approaches in the detection of Borrelia burgdorferi sensu lato from live Ixodes ricinus ticks by PCR and reverse line blotting. Vector Borne Zoonotic Dis. 7:555–561 [DOI] [PubMed] [Google Scholar]
  • 39. Nilsson K, Lindquist O, Pahlson C. 1999. Association of Rickettsia helvetica with chronic perimyocarditis in sudden cardiac death. Lancet 354:1169–1173 [DOI] [PubMed] [Google Scholar]
  • 40. Nilsson K, Elfving K, Pahlson C. 2010. Rickettsia helvetica in patient with meningitis, Sweden, 2006. Emerg. Infect. Dis. 16:490–492 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Péter O. 1985. Presence of antibodies against the Swiss Rickettsia in wild and domestic mammals of the Canton of Neuchatel. Schweiz. Arch. Tierheilkd. 127:461–468 (In French.) [PubMed] [Google Scholar]
  • 42. Reference deleted.
  • 43. Poupon MA, et al. 2006. Prevalence of Borrelia burgdorferi sensu lato in ticks collected from migratory birds in Switzerland. Appl. Environ. Microbiol. 72:976–979 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Pusterla N, Huder JB, Feige K, Lutz H. 1998. Identification of a granulocytic Ehrlichia strain isolated from a horse in Switzerland and comparison with other rickettsiae of the Ehrlichia phagocytophila genogroup. J. Clin. Microbiol. 36:2035–2037 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Pusterla N, et al. 1999. Evidence of the human granulocytic ehrlichiosis agent in Ixodes ricinus ticks in Switzerland. J. Clin. Microbiol. 37:1332–1334 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Rauter C, Oehme R, Diterich I, Engele M, Hartung T. 2002. Distribution of clinically relevant Borrelia genospecies in ticks assessed by a novel, single-run, real-time PCR. J. Clin. Microbiol. 40:36–43 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Reye AL, Hubschen JM, Sausy A, Muller CP. 2010. Prevalence and seasonality of tick-borne pathogens in questing Ixodes ricinus ticks from Luxembourg. Appl. Environ. Microbiol. 76:2923–2931 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Richter D, Schlee DB, Allgower R, Matuschka FR. 2004. Relationships of a novel Lyme disease spirochete, Borrelia spielmani sp. nov., with its hosts in Central Europe. Appl. Environ. Microbiol. 70:6414–6419 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48a. Rijpkema SG, Molkenboer MJ, Schouls LM, Jongejan F, Schellekens JF. 1995. Simultaneous detection and genotyping of three genomic groups of Borrelia burgdorferi sensu lato in Dutch Ixodes ricinus ticks by characterization of the amplified intergenic spacer region between 5S and 23S rRNA genes. J. Clin. Microbiol. 33:3091–3095 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Schorn S, Pfister K, Reulen H, Mahling M, Silaghi C. 2011. Occurrence of Babesia spp., Rickettsia spp. and Bartonella spp. in Ixodes ricinus in Bavarian public parks, Germany. Parasit. Vectors 4:135 doi:10.1186/1756-3305-4-135 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Schouls LM, Van De Pol I, Rijpkema SG, Schot CS. 1999. Detection and identification of Ehrlichia, Borrelia burgdorferi sensu lato, and Bartonella species in Dutch Ixodes ricinus ticks. J. Clin. Microbiol. 37:2215–2222 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Schwaiger M, Peter O, Cassinotti P. 2001. Routine diagnosis of Borrelia burgdorferi (sensu lato) infections using a real-time PCR assay. Clin. Microbiol. Infect. 7:461–469 [DOI] [PubMed] [Google Scholar]
  • 52. Severinsson K, Jaenson TG, Pettersson J, Falk K, Nilsson K. 2010. Detection and prevalence of Anaplasma phagocytophilum and Rickettsia helvetica in Ixodes ricinus ticks in seven study areas in Sweden. Parasit. Vectors 3:66 doi:10.1186/1756-3305-3-66 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Reference deleted.
  • 54. Simser JA, et al. 2002. Rickettsia monacensis sp. nov., a spotted fever group rickettsia, from ticks (Ixodes ricinus) collected in a European city park. Appl. Environ. Microbiol. 68:4559–4566 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55. Sprong H, et al. 2009. Ixodes ricinus ticks are reservoir hosts for Rickettsia helvetica and potentially carry flea-borne Rickettsia species. Parasit. Vectors 2:41 doi:10.1186/1756-3305-2-41 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56. Thompson JD, Higgins DG, Gibson TJ. 1994. Clustal W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673–4680 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57. Tomanovic S, Radulovic Z, Masuzawa T, Milutinovic M. 2010. Coexistence of emerging bacterial pathogens in Ixodes ricinus ticks in Serbia. Parasite 17:211–217 [DOI] [PubMed] [Google Scholar]
  • 58. Tonetti N, Berggoetz M, Ruhle C, Pretorius AM, Gern L. 2009. Ticks and tick-borne pathogens from wildlife in the Free State Province, South Africa. J. Wildl. Dis. 45:437–446 [DOI] [PubMed] [Google Scholar]
  • 59. von Loewenich FD, et al. 2003. High diversity of ankA sequences of Anaplasma phagocytophilum among Ixodes ricinus ticks in Germany. J. Clin. Microbiol. 41:5033–5040 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60. von Loewenich FD, et al. 2010. Detection of “Candidatus Neoehrlichia mikurensis” in two patients with severe febrile illnesses: evidence for a European sequence variant. J. Clin. Microbiol. 48:2630–2635 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61. Welinder-Olsson C, Kjellin E, Vaht K, Jacobsson S, Wenneras C. 2010. First case of human “Candidatus Neoehrlichia mikurensis” infection in a febrile patient with chronic lymphocytic leukemia. J. Clin. Microbiol. 48:1956–1959 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62. Wielinga PR, et al. 2006. Longitudinal analysis of tick densities and Borrelia, Anaplasma, and Ehrlichia infections of Ixodes ricinus ticks in different habitat areas in The Netherlands. Appl. Environ. Microbiol. 72:7594–7601 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63. Woldehiwet Z. 2010. The natural history of Anaplasma phagocytophilum. Vet. Parasitol. 167:108–122 [DOI] [PubMed] [Google Scholar]
  • 64. Younsi H, et al. 2005. Characterization of Borrelia lusitaniae isolates collected in Tunisia and Morocco. J. Clin. Microbiol. 43:1587–1593 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES