Abstract
The ethylmalonyl coenzyme A (ethylmalonyl-CoA) pathway is one of the central methylotrophy pathways in Methylobacterium extorquens involved in glyoxylate generation and acetyl-CoA assimilation. Previous studies have elucidated the operation of the ethylmalonyl-CoA pathway in C1 and C2 assimilation, but the regulatory mechanisms for the ethylmalonyl-CoA pathway have not been reported. In this study, a TetR-type activator, CcrR, was shown to regulate the expression of crotonyl-CoA reductase/carboxylase, an enzyme of the ethylmalonyl-CoA pathway involved in the assimilation of C1 and C2 compounds in Methylobacterium extorquens AM1. A ccrR null mutant strain was impaired in its ability to grow on C1 and C2 compounds, correlating with the reduced activity of crotonyl-CoA reductase/carboxylase. Promoter fusion assays demonstrated that the activity of the promoter required for ccr expression (the katA-ccr promoter) decreased as much as 50% in the absence of ccrR compared to wild-type M. extorquens AM1. Gel mobility shift assays confirmed that CcrR directly binds to the region upstream of the katA-ccr promoter. A palindromic sequence upstream of katA at positions −334 to −321 with respect to the predicted translational start site was identified, and mutations in this region eliminated the gel retardation of the katA-ccr promoter region by CcrR. CcrR does not appear to regulate the expression of other ethylmalonyl-CoA pathway genes, suggesting the existence of additional regulators.
INTRODUCTION
Methylobacterium extorquens AM1 is a facultative methylotroph capable of using C1 compounds such as methanol, C2 compounds like ethylamine, and multiple carbon compounds such as succinate as sole carbon and energy sources. This alphaproteobacterium has served as a model organism for research on C1 and C2 metabolism for over 50 years (3) and has been considered a promising biotechnological platform due to the relatively inexpensive substrates and high flux through intermediates of biotechnology or commercial interest that are involved in C1 and C2 assimilation (2, 22). The complete assimilatory pathway for both C1 compounds and C2 compounds in this bacterium has been shown to involve the ethylmalonyl coenzyme A (ethylmalonyl-CoA) (EMC) pathway (Fig. 1), which regenerates glyoxylate from acetyl-CoA. Glyoxylate is a key intermediate of the serine cycle during growth on C1 compounds (18), and during growth on C2 compounds, glyoxylate condenses with acetyl-CoA to generate malate (3, 21).
Fig 1.
Methylotrophic metabolism in M. extorquens AM1. H4MPT pathway, tetrahydromethanopterin-linked pathway; phaA, β-ketothiolase; phaB, acetoacetyl-CoA reductase; croR, crotonase; ccr, crotonyl-CoA carboxylase/reductase; ecm, ethylmalonyl-CoA mutase; msd, methylsuccinyl-CoA dehydrogenase; mcd, mesaconyl-CoA hydratase; mclA1-mclA2, malyl-CoA/β-methylmalyl-CoA lyase; pcc, propionyl-CoA carboxylase; mcm, methylmalonyl-CoA mutase; mea, methylmalonyl-CoA mutase; sdh, succinate dehydrogenase; fdh, formate dehydrogenase.
In M. extorquens AM1, genes involved in methylotrophic pathways are often clustered in large operons (7, 25). However, the genes coding for the EMC enzymes either are not colocalized or are loosely clustered in opposite orientations and, thus, not cotranscribed. In addition, previous transcriptomic studies of M. extorquens AM1 cells growing on different substrates showed that the EMC pathway genes are expressed in multiple patterns. Strains with mutations in EMC pathway genes grow normally on compounds with more than 2 carbons, such as succinate (3). In keeping with this finding, most EMC pathway genes are upregulated in cells grown with methanol or ethylamine compared with succinate, with exceptions being the genes coding for enzymes also involved in other parts of metabolism, such as the first enzymes of the EMC pathway, β-ketothiolase (phaA) and acetoacetyl-CoA reductase (phaB), which overlap with the poly-β-hydroxybutyrate (PHB) synthesis pathway; and succinate dehydrogenase (sdhABCD), which overlaps with the tricarboxylic acid (TCA) cycle (Fig. 1) (16, 17). However, multiple expression patterns were observed in a previously reported substrate-switching experiment in which methanol was added to replace succinate as the sole carbon source (23). In that case, some EMC pathway genes increased their expression levels initially and then dropped expression later; others decreased their expression levels initially and then increased their expression levels later; and others either showed little response, showed increased expression levels steadily throughout the transition, or showed dropped expression levels steadily throughout the transition. Those studies indicated that multiple regulatory systems may exist for the tuning of the expression of the EMC pathway genes when cells grow on different substrates. Therefore, an investigation of EMC pathway regulators is needed to enhance our understanding of how this key assimilatory pathway is controlled as well as to generate valuable information for the metabolic engineering of the EMC pathway.
To date, no known regulator of expression for any of the EMC pathway genes has been identified. Because the EMC pathway intermediates are of interest for the engineering of valuable chemicals (2), it is important to obtain a more complete understanding of how this pathway is regulated in order to manipulate flux through the EMC pathway intermediates. In this study, we identify the first known regulator of one of the EMC pathway genes, ccr, and show that this TetR-type regulator (CcrR) directly binds a palindromic sequence upstream of the promoter controlling the expression of ccr.
MATERIALS AND METHODS
Bacterial strains, vectors, and growth conditions.
Cells of Escherichia coli strains Top 10 (Invitrogen), BL21(DE3) (Novagen, Madison, WI), and S17-1 were cultivated at 37°C in Luria-Bertani medium. M. extorquens AM1 cells were routinely cultured in minimal medium, as described previously (16), with one of the following substrates: succinate (20 mM), methanol (125 mM), or ethylamine (20 mM). The growth of mutants with ethylamine was tested in liquid with or without glyoxylate (1 mM). The following antibiotics were supplied: tetracycline (Tet) at 10 μg/ml, kanamycin (Km) at 50 μg/ml, ampicillin (Amp) at 100 μg/ml, and rifamycin (Rf) at 50 μg/ml.
Growth curve assessments were carried out in biological triplicates. Tested strains were grown at 30°C to the late log phase, subcultured (0.5 ml) in 50 ml of minimal medium in 250-ml flasks containing the appropriate carbon source, an then inoculated at 30°C on shakers at 200 rpm.
The following cloning vectors were used: pCR2.1 (Invitrogen, CA) for the cloning of PCR products, pCM62 and pCM80 (14) as expression vectors, pET24a (Invitrogen) for protein expression, pCM130 (14) for promoter fusion construction, pCM 184 (15) as an allelic exchange suicide vector for gene deletion, and pRK2013 (10) as a helper plasmid for matings. All primers used in this study are listed in Table 1.
Table 1.
List of oligonucleotides used in this study
| Purpose | Oligonucleotide | Sequence (5′–3′) |
|---|---|---|
| CcrR mutant construction | CcrRuf | CTCGAATTCCGACTTCGCCTTGCGCTG |
| CcrRur | GTGGGTACCTCGGCCGAAAGCTCGTC | |
| CcrRdf | CGGCCGCGGTATTCAGATCCGACTTC | |
| CcrRdr | GCCGAGCTCGTGGGCGTTGCCCGAG | |
| ArsR mutant construction | ArsRuf | GCCAGATCTTGCGCGGGGCCAGCTCG |
| ArsRur | CAGGTACCTCATGATTTATCCATATG | |
| ArsRdf | CGCGGGCCCCGTAATCGCCCACGGATG | |
| ArsRdr | CACGAGCTCATGCGTGGCACGATAGGC | |
| ArsR overexpression | ArsRf | ATGAGGCCCCTGTTTCACCCCGCGAT |
| ArsRr | TTACGAAGCCCGCGCCGCGTAGGCG | |
| PhaB promoter fusion test | PphaBf | GCTGAATTCCCGCGACGCTAAGAAG |
| PphaBr | TATAAGCTTTAGTTTCCTCCGTGATC | |
| Mcl promoter fusion test | Pmclf | GTAGAATTCGGTCAGCCGCGAGCAG |
| Pmclr | GACAAGCTTCGGAAATCCTCCGTTCT | |
| Mea promoter fusion test | PmeaBf | CTCGAATTCGAGGAAACGCCCCACCG |
| PmeaBr | CTCAAGCTTGCCGTCTGCTCATCACG | |
| KatA fusion test | PkatAf | GCGGAATTCGCTTGACCTCGGCGACGC |
| PkatAr | GCGAAGCTTCGCATGTCTCTCCGTGTC | |
| KatA-Ccr fusion test | PkatA-ccr f | AACTGCAGTCGTGGCACTCCCTGTTG |
| PkatA-ccr r | CGCGAATTCACGAGCCGAACTCCTTC | |
| Ecm fusion test | Pecm f | ATAGAATTCCGCGCGGGTCGCGGGCGGTG |
| Pecm r | ATAAAGCTTTCCCACTCGACTCCCTGTCCG | |
| RT-PCR test for katA-ccr cotranscription | katA uf | TGCATCAGAACCGGCCCACG |
| katA ur | GCTTGACCTCGGCGACGCTCG | |
| katA-ccr f | ATCTCGCCGAGCTCGTAAAGGTCCT | |
| katA-ccr r | ATGATCGCGCACTGGTTCAAGGTG | |
| Promoter fusion test for binding site detection | Pccr400u | GCGGAATTCGCTTGACCTCGGCGACGC |
| Pccr300u | GCGGAATTCGAAGCCGCTGCGTCGCGTC | |
| Pccr200u | GCGGAATTCGCCGGCTCCCGACACAAC | |
| Pccr100u | GCGGAATTCGCTCCAAGCTCGGCCTCAC | |
| Pccrd | GCGAAGCTTCGCATGTCTCTCCGTGTC |
Triparental or biparental matings between E. coli and M. extorquens AM1 were performed overnight on nutrient agar at 30°C. Cells were then washed with sterile minimal medium and plated onto selective medium with succinate. Rifamycin was used for E. coli counterselection.
Mutant generation.
Insertion mutants were generated by using an allelic exchange method described previously (15). For the ccrR and arsR mutants, 0.6-kb fragments upstream and downstream of the genes were PCR amplified and cloned into pCM184.
All mutations were confirmed by diagnostic PCR. The Km marker was deleted by using Cre-mediated recombination as described previously (15). To overexpress the ArsR-type regulator in M. extorquens AM1, the gene was first PCR amplified and further cloned into pCM80, which uses the mxaF promoter to promote expression in M. extorquens AM1.
Construction of promoter fusions.
Putative promoter regions for phaB, mcl, katA-ccr, katA, meaB, and ecm were amplified by PCR. The amplified fragments were then cloned into the promoter probe vector pCM130, and these constructs were transferred into M. extorquens AM1 and the ccrR mutant.
RNA extraction and RT-PCR.
Total mRNA was extracted from 50 ml of methanol-grown cultures of M. extorquens AM1 by using the RNeasy Minikit (Qiagen), followed by DNase I digestion (Ambion). Reverse transcription-PCR (RT-PCR) was carried out by using the iScript one-step RT-PCR kit (Bio-Rad) in a 30-μl mixture containing 10 ng of RNA template.
Enzymatic assays.
M. extorquens AM1 cells grown with methanol were harvested at an optical density at 600 nm (OD600) of 0.8 to 1.0 and then resuspended in 1 ml of 0.1 M potassium phosphate buffer (pH 7.5). Crude cell extracts were obtained by passing cells through a French pressure cell at 1.2 × 108 Pa, with clarification by 15 min of centrifugation at 15,000 × g at 4°C. A standard spectrophotometric assay for Ccr activity was performed at 30°C, as described previously (9), except that 2 mM NADPH was used, and the change in absorbance was monitored at 340 nm. For promoter fusion assays, catechol dioxygenase (XylE) was assayed as described previously (13). Protein concentrations were determined by a bicinchoninic acid (BCA) assay using bovine serum albumin as a standard (Thermo Scientific, MA).
Expression and purification of CcrR.
The ccrR gene was first amplified by PCR and cloned into the NdeI and XhoI sites of pET24a. E. coli cells harboring pET24a::ccrR were grown in 8 liters of LB medium with 100 μg/ml of ampicillin to an OD600 of 0.5 to 0.8 and were then induced with 1 mM isopropyl-β-d-thiogalactopyranoside (IPTG) for 16 h at 37°C. Clarified crude cells were resuspended in 20 ml of buffer A (50 mM Tris [pH 7.8], 5 mM imidazole, 10% glycerol). Crude cell extracts were obtained by two passages through a French pressure cell at 1.2 ×108 Pa, followed by 30 min of centrifugation at 15,000 × g at 4°C. The soluble fraction was then used for His-tagged purification using Ni-nitrilotriacetic acid (NTA) Superflow resin according to the manufacturer's instructions (Qiagen, CA). His-tagged CcrR was separated by fast protein liquid chromatography (FPLC) (ÄKTAprime Plus; GE Healthcare Life Science, Sweden), using the following method. The column was washed using 4 column volumes of buffer B (50 mM Tris [pH 7.8], 200 mM NaCl, 5 mM imidazole, 10% glycerol). His-tagged CcrR was eluted by using an imidazole gradient of 50 to 500 mM. Purified protein was verified by 15% SDS-PAGE and stored at −80°C.
Gel retardation assays.
Putative promoter regions of about 400 bp were amplified by PCR and 32P labeled with a DNA 5′-end-labeling system (Promega, WI) according to the manufacturer's instructions. Various regions upstream of ccr were amplified by PCR. The mutated ccr promoter region in which the putative CcrR binding site was replaced with a nonpalindromic sequence was synthesized by Genscript, Inc., to prepare probes for assays. Labeled DNA fragments were incubated with various concentrations of purified CcrR in binding buffer [5 mM Tris-HCl (pH 7.5), 50 mM NaCl, 1 mM MgCl, 0.5 mM dithiothreitol, 0.5 mM EDTA, 4% glycerol, 0.05 μg/ml poly(dI-dC)] for 30 min at room temperature. The samples were separated by Novex 6% retardation gel electrophoresis (Invitrogen, CA) in 0.5× Tris-borate-EDTA (TBE) at 200 V. The gels were dried by using a gel drier (model 583; Bio-Rad, CA) and exposed to phosphorscreens (Perkin-Elmer, MA) for 2 to 6 h.
RESULTS
Effects of mutations in predicted regulatory genes on the capacity to assimilate C1 and C2 compounds.
Two genes predicted to encode regulatory proteins are located near the EMC pathway genes ccr and ecm. One gene (NCBI GeneID 7990213) is predicted to encode an ArsR-type regulator, and the other (NCBI GeneID 7990204) is predicted to encode a TetR-type regulator. To assess the influence of these genes on C1 and C2 metabolism in M. extorquens AM1, an insertion mutation of each gene was constructed via allelic exchange. The mutant strain deficient in the ArsR-type regulator showed no growth defect when grown with C1 or C2 compounds. To test the possibility that this regulator might have a negative effect on gene expression, an overexpression construct was generated and tested for growth with the same substrates. No effect on growth was observed compared to the wild type (data not shown). However, the mutant deficient in the TetR-type regulator, here designated CcrR, exhibited decreased growth rates on methanol and ethylamine (Fig. 2). In addition, the final OD600 of the ccr mutant strain was similar to that of the wild-type strain after growth on methanol but was only about half of the final OD600 for the wild-type strain when grown with ethylamine (Fig. 2). Further studies were focused on CcrR.
Fig 2.
Growth curves of wild-type M. extorquens AM1 and the ccrR mutant grown on different substrates. (A) Growth with methanol; (B) growth with ethylamine. Graphs depict representative data from three biological replicates. The rate of growth varied by ≤8% between replicates.
Effects of the ccrR mutation on promoter activities of EMC genes.
The activities of promoter regions of five EMC genes (mclA, meaB, ecm, phaB, and ccr) in wild-type M. extorquens AM1 and the ccrR mutant were investigated by using a reporter vector carrying a promoterless xylE gene. The length and location of promoter region fragments tested were based on sequence analysis and included the 300- to 400-bp sequence upstream of mcl, meaB, phaB, and ccr and the 700-bp sequence upstream of ecm. Since 180 bp separates ccr and katA (a catalase-encoding gene for which mutants have no observable phenotype [6]), it was possible that these two genes are cotranscribed. Therefore, the 400-bp sequence upstream of katA was also tested. PCR-amplified promoter regions were ligated into pCM130 and transformed into wild-type M. extorquens AM1 and the ccrR mutant strain and then assayed for XylE activity. The results are summarized in Table 2.
Table 2.
XylE activities of putative promoter-xylE transcriptional fusions in wild-type M. extorquens AM1 and the ccrR mutant grown on methanol
| Fusion | Mean activity of XylE (mU) ± SDa |
|
|---|---|---|
| Wild type | CcrR mutant | |
| Pmcl::xylE | 33.4 ± 8.7 | 35.3 ± 9.2 |
| Pccr::xylE | <3 | <3 |
| PmeaB::xylE | 51.4 ± 10.7 | 44.4 ± 6.9 |
| PkatA::xylE | 54.2 ± 5.6 | 24.1 ± 6.8 |
| Pecm::xylE | 211 ± 5.2 | 221 ± 3.6 |
| PphaB::xylE | 51.2 ± 10.8 | 46.6 ± 11.1 |
Activity determinations were carried out in triplicate.
The data revealed that the region upstream of ccr does not appear to contain a promoter but that the region upstream of katA did show promoter activity, supporting the hypothesis that the two genes are cotranscribed. The activities of the promoter fusions for mclA, meaB, phaB, and ecm were not significantly affected by the loss of ccrR, while the promoter activities of katA-ccr were reduced ∼2-fold but not eliminated in the absence of ccrR.
In order to further assess the possibility that katA and ccr are cotranscribed, RT-PCR assays were performed across the intergenic region of ccr and katA. An RT-PCR band of the correct size was obtained for the intergenic region, while no product was obtained upstream of the katA region, which is the region between katA and ecm (Fig. 3). These data suggest that ccr and katA are cotranscribed from the promoter region upstream of katA.
Fig 3.
RT-PCR results for the intergenic region of katA-ccr and ecm-katA and map displaying the transcriptional patterns of ecm, katA, and ccr. Lane 1, DNA ladder; lane 2, PCR results for the ecm-katA region using cDNA as the template; lane 3, positive control of the ecm-katA region using chromosomal DNA as the template; lane 4, PCR results for the katA-ccr region using cDNA as the template; lane 5, positive control for the katA-ccr region using chromosomal DNA as the template; lane 6, negative control of the ecm-katA region using direct PCR without an RT step; lane 7, negative control of the katA-ccr region using direct PCR without an RT step.
Influence of CcrR on Ccr activity.
Since the CcrR mutant showed decreased expression from the katA-ccr promoter, the activity of Ccr was tested in the ccrR mutant and compared to that of wild-type cells grown with methanol. In the ccrR mutant, Ccr activity was about 40% of the wild-type level (from 220 ± 3.7 mU/mg to 102 ± 10.2 mU/mg; measurements were done in three biological replicates). This result is consistent with the ∼2-fold decrease in the ccr promoter activity seen for the ccrR mutant strain.
CcrR binds to the katA-ccr promoter region.
To characterize the katA-ccr promoter binding activity of CcrR, a recombinant CcrR protein with an N-terminal six-histidine residues was constructed and overexpressed in E. coli. CcrR-His6 was then purified on a nickel-nitrilotriacetic acid resin column, and the purity was confirmed by Coomassie blue staining of SDS-polyacrylamide gels (Fig. 4). CcrR-His6 at >95% purity by SDS-PAGE analysis was used to examine binding to the promoter region upstream of katA-ccr by use of a gel retardation assay. Purified CcrR-His6 specifically bound the katA-ccr promoter region, as demonstrated both by direct binding and by competition with the unlabeled katA-ccr promoter region. In the gel retardation assays, illustrated in Fig. 5, the incubation of CcrR-His6 with the radiolabeled katA-ccr promoter produced two shifted bands with a slower migration through the gel than free katA-ccr promoter probes. The region upstream of phaB was used as a control, since it is not likely to bind to CcrR according to the promoter fusion assay. No shifted bands were observed for this control. Furthermore, the shifted bands were enhanced by the addition of increasing amounts of the His-tagged protein to the assay mixtures but could be eliminated upon the addition of a 10-fold excess of the unlabeled katA-ccr promoter region. These results suggested that CcrR-His6 specifically recognizes the katA-ccr promoter region.
Fig 4.
Purification of CcrR-His6 (23.9 kDa) from E. coli. Lane 1, purified sample; lane 2, soluble fraction of E. coli cells harboring pET24a-ccrR; lane 3, wash effluent during protein purification; lane 4, marker.
Fig 5.
(A) Gel retardation assay for binding with purified CcrR. Lanes 1 and 2, PphaB fragment with 10 μg and 50 μg CcrR; lane 3, PccrR fragment; lanes 4 to 7, decreasing concentrations of CcrR (100, 80, 50, and 20 μg of protein, respectively) with the PkatA-ccr fragment; lane 8, no CcrR added with the PkatA-ccr fragment; lane 9, DNA ladder. (B) Gel retardation assay for labeled Pccr competing with unlabeled Pccr. Lane 1, labeled Pccr with 25 μg CcrR; lanes 2 to 4, increasing concentrations of unlabeled Pccr (1, 10, and 50 times more than labeled Pccr, respectively); lane 5, no CcrR added; lane 6, marker.
CcrR binds to a palindromic sequence upstream of the katA-ccr promoter region.
In order to narrow down the length of the sequence containing the exact location of the CcrR binding site, a nested set of DNA fragments for the postulated katA-ccr promoter region was PCR amplified to obtain a series of DNA fragments of 400 bp, 300 bp, 200 bp, and 100 bp upstream of the translational start site for katA. Gel electrophoresis mobility shift assays with these fragments showed that only the 400-bp fragment was shifted in the presence of CcrR (Fig. 6A). These fragments were also used in the promoter fusion assays, as described above. No XylE activities were detected in either the wild type or the ccrR mutant except when the 400-bp region was tested (Table 3), indicating that the region 300 to 400 bp upstream of the katA translational start site is necessary for the expression of the katA-ccr promoter.
Fig 6.
(A) Gel retardation assay for binding of katA-ccr subfragments with or without 50 μg purified CcrR. Lane 1, DNA ladder; lane 2, 100-bp katA-ccr fragment with no CcrR; lane 3, 100-bp katA-ccr fragment with CcrR; lane 4, 200-bp katA-ccr fragment with no CcrR; lane 5, 200-bp katA-ccr fragment with CcrR; lane 6, 300-bp katA-ccr fragment with no katA-ccr fragment and no CcrR; lane 7, 300-bp katA-ccr fragment with CcrR; lane 8, 400-bp katA-ccr fragment with no katA-ccr fragment and no CcrR; lane 9, 400-bp katA-ccr fragment with CcrR. (B) Gel retardation assay for binding of 50 μg purified CcrR with the mutated katA-ccr promoter region. Lane 1, DNA ladder; lane 2, control without CcrR; lane 3, CcrR plus the mutated katA-ccr promoter fragment; lane 4, CcrR plus the native katA-ccr promoter fragment.
Table 3.
XylE activity of transcriptional xylE fusions of native and mutated katA-ccr promoters in wild-type M. extorquens AM1 and the ccrR mutant grown on methanol
| Fusion | Mean XylE activity (mU) ± SDa |
|
|---|---|---|
| Wild type | CcrR mutant | |
| PkatA-ccr::xylE | 61.2 ± 8.4 | 21.9 ± 6.6 |
| PkatA-ccr300::xylE | <3 | <3 |
| PkatA-ccr200::xylE | <3 | <3 |
| PkatA-ccr100::xylE | <3 | <3 |
| Pmutated katA-ccr::xylE | 58.4 ± 3.4 | 26.2 ± 10.7 |
Activity determinations were carried out in triplicate.
Since CcrR shows homology to the TetR-type regulator family, the pattern of interactions between CcrR and the katA-ccr promoter is likely to share some similarity with the common binding pattern of the TetR-type family. A typical TetR DNA binding system consists of a symmetric TetR dimer and a palindromic operator in which two identical monomers bind the same DNA sequence on the main strand and the complementary strand, respectively (20). Therefore, the katA-ccr promoter region was screened for palindromes by using mEmboss (http://emboss.open-bio.org/pipermail/emboss/2007-July/003051.html). A single palindrome sequence was identified (CGCGCCTTGAGGCGCG) from nucleotides −334 to −321 with respect to the katA translational start site. To test the role of this palindrome sequence as a CcrR binding site, a synthesized katA-ccr promoter region was introduced, in which the palindrome was changed to the nonpalindromic sequence CCATATGTGGTATTGG. No shifted bands were observed with this sequence (Fig. 6B), whereas the natural CcrR binding sequence showed a clear shifted band. These results suggest that this palindrome sequence from positions −334 to −321 is the CcrR binding site. The regions upstream of other EMC pathway genes were screened for the presence of this palindrome sequence, but no similar sequences were identified.
DISCUSSION
During C1 assimilation in M. extorquens AM1, the EMC pathway is an important adjunct to the serine cycle, generating glyoxylate from acetyl-CoA (Fig. 1). As a first step toward an understanding of the genetic control of the genes of this pathway, we have investigated two potential regulators, an ArsR family homolog and a TetR family homolog, that are located near two of the key genes of the EMC pathway, ccr and ecm. Our results show that although the ArsR family regulator does not appear to be involved in the regulation of the EMC pathway, the TetR family homolog, designated CcrR, is involved in the positive regulation of the expression of ccr, which encodes the crotonyl-CoA reductase/carboxylase, a key enzyme of the EMC pathway. Not only is CcrR important for the normal transcriptional expression of ccr and normal activity levels of Ccr, its absence results in poorer growth on compounds for which Ccr is a required enzyme. The latter result suggests that a 2-fold drop in the activity of Ccr results in limiting flux through this step of the EMC pathway.
The ccr gene is cotranscribed with a gene predicted to encode a catalase (katA). Mutations in katA do not affect growth on C1 or C2 compounds, and strains lacking katA retain catalase activity (6). In keeping with this finding, the genome annotation for M. extorquens AM1 lists two other putative catalase genes (25). However, none of the enzymes of the EMC pathway or the other enzymes involved in C1 or C2 metabolism are known to generate hydrogen peroxide. Transcriptomic analyses showed that katA is induced during the transition from succinate to methanol in a pattern similar to that of ccr (23), yet the role of KatA in C1 or C2 metabolism, if any, remains unknown.
The TetR-type regulator is a broadly distributed regulatory family in the prokaryotes (20). TetR family members are often involved in the regulation of genes related to environmental adaptation, including the utilization of diverse carbon sources (20). CcrR contains signatures of a typical TetR regulator, such as the helix-turn-helix motif and a palindromic binding site. However, it also displays some unusual characteristics. Unlike the majority of the members of the TetR family, CcrR functions as an activator rather than as a repressor. However, a few TetR-type activators have been reported, including PsrA of Pseudomonas syringae pv. tomato strain DC3000 (5), LuxR of Vibrio harveyi (19), VceR of Vibrio cholerae 569B (1), and AtrA of Streptomyces griseus (11). Like CcrR, AtrA is not essential for expression and modulates expression about 2-fold. Most TetR family regulators are also autoregulators, controlling their own expression. However, the mutant and gel retardation results showed that like a few other TetR family regulators (4, 8, 12), CcrR is not an autoregulator.
In this work, we have shown that CcrR stimulates the expression of the katA-ccr promoter on the order of 2-fold but is not required for this expression. Since ccr is expressed at very low levels in cells grown on succinate (16), these results suggest the possibility of additional regulatory elements, possibly a repressor mechanism.
Homologs of the palindromic sequence that was indicated to be the CcrR binding site were not found in the postulated promoter regions of other ECM genes, consistent with the other results of this study suggesting that CcrR is a specific regulator for the katA-ccr promoter. Since the expression of the other EMC pathway genes changes depending on the growth conditions (16, 23, 24), more regulators are likely involved. The reasons why EMC pathway genes show different regulatory patterns are not clear. This may indicate that some intermediates of the EMC pathway are drawn off for different purposes and therefore require separate regulatory systems. Alternatively, the in vivo activity of different enzymes of the EMC pathway may be tuned in part through transcriptional regulation, to help regulate flux through each step of the pathway.
The identification of a specific activator protein regulating the expression of one of the genes of the EMC pathway is a first step in an understanding of how the pathway as a whole is regulated. This work sets the stage for the identification of additional regulatory elements, information that will be key to manipulating the EMC pathway for biotechnological applications.
ACKNOWLEDGMENTS
We thank E. Skovran, C. Martinez Gomez, L. Chistoserdova, and M. Kalyuzhnaya for their thoughtful discussion of our work.
This work was supported by a grant from the DOE (DE-SC0006871).
Footnotes
Published ahead of print 23 March 2012
REFERENCES
- 1. Alatoom AA, Aburto R, Hamood AN, Colmer-Hamood JA. 2007. VceR negatively regulates the vceCAB MDR efflux operon and positively regulates its own synthesis in Vibrio cholerae 569B. Can. J. Microbial. 53:888–900 [DOI] [PubMed] [Google Scholar]
- 2. Alber BE. 2011. Biotechnological potential of the ethylmalonyl-CoA pathway. Appl. Microbiol. Biotechnol. 89:17–25 [DOI] [PubMed] [Google Scholar]
- 3. Anthony C. 1982. The biochemistry of methylotrophs. Academic Press, London, United Kingdom [Google Scholar]
- 4. Aramaki H, Sagara Y, Hosoi M, Horiuchi T. 1993. Evidence for autoregulation of camR, which encodes a repressor for the cytochrome P-450cam hydroxylase operon on the Pseudomonas putida CAM plasmid. J. Bacteriol. 175:7828–7833 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Chatterjee A, Cui Y, Hasegawa H, Chatterjee AK. 2007. PsrA, the Pseudomonas sigma regulator, controls regulators of epiphytic fitness, quorum-sensing signals, and plant interactions in Pseudomonas syringae pv. tomato strain DC3000. Appl. Environ. Microbiol. 73:3684–3694 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Chistoserdova L, Lidstrom ME. 1996. Molecular characterization of a chromosomal region involved in the oxidation of acetyl-CoA to glyoxylate in the isocitrate-lyase negative methylotroph Methylobacterium extorquens AM1. Microbiology 142:1459–1468 [DOI] [PubMed] [Google Scholar]
- 7. Chistoserdova L, Vorholt JA, Lidstrom ME. 2005. A genomic view of methane oxidation by aerobic bacteria and anaerobic archaea. Genome Biol. 6:208. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Delany I, Ieva R, Alaimo C, Rappuoli R, Scarlato V. 2003. The iron-responsive regulator Fur is transcriptionally autoregulated and not essential in Neisseria meningitidis. J. Bacteriol. 185:6032–6041 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Erb TJ, et al. 2007. Synthesis of C5-dicarboxylic acids from C2-units involving crotonyl-CoA carboxylase/reductase: the ethylmalonyl-CoA pathway. Proc. Natl. Acad. Sci. U. S. A. 104:10631–10636 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Figurski DH, Helinski DR. 1979. Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proc. Natl. Acad. Sci. U. S. A. 76:1648–1652 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Hirano S, Tanaka K, Ohnishi Y, Horinouchi S. 2008. Conditionally positive effect of the TetR-family transcriptional regulator AtrA on streptomycin production by Streptomyces griseus. Microbiology 154:905–914 [DOI] [PubMed] [Google Scholar]
- 12. Horinouchi S, Beppu T. 1990. Autoregulatory factors of secondary metabolism and morphogenesis in actinomycetes. Crit. Rev. Biotechnol. 10:191–204 [DOI] [PubMed] [Google Scholar]
- 13. Kataeva IA, Golovleva LA. 1990. Catechol 2,3-dioxygenase from Pseudomonas aeruginosa 2×. Methods Enzymol. 188:115–121 [DOI] [PubMed] [Google Scholar]
- 14. Marx CJ, Lidstrom ME. 2001. Development of improved versatile broad-host-range vectors for use in methylotrophs and other Gram-negative bacteria. Microbiology 147:2065–2075 [DOI] [PubMed] [Google Scholar]
- 15. Marx CJ, Lidstrom ME. 2002. Broad-host-range cre-lox system for antibiotic marker recycling in Gram-negative bacteria. Biotechniques 33:1062–1067 [DOI] [PubMed] [Google Scholar]
- 16. Okubo Y, Skovran E, Guo X, Sivam D, Lidstrom ME. 2007. Implementation of microarrays for Methylobacterium extorquens AM1. Omics 11:325–340 [DOI] [PubMed] [Google Scholar]
- 17. Okubo Y, Yang S, Chistoserdova L, Lidstrom ME. 2010. Alternative route for glyoxylate consumption during growth on two-carbon compounds by Methylobacterium extorquens AM1. J. Bacteriol. 192:1813–1823 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Peyraud R, et al. 2009. Demonstration of the ethylmalonyl-CoA pathway by using 13C metabolomics. Proc. Natl. Acad. Sci. U. S. A. 106:4846–4851 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Pompeani AJ, et al. 2008. The Vibrio harveyi master quorum-sensing regulator, LuxR, a TetR-type protein is both an activator and a repressor: DNA recognition and binding specificity at target promoters. Mol. Microbiol. 70:76–88 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Ramos JL, et al. 2005. The TetR family of transcriptional repressors. Microbiol. Mol. Biol. Rev. 69:326–356 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Schneider K, et al. 2012. The ethylmalonyl-CoA pathway is used in place of the glyoxylate cycle by Methylobacterium extorquens AM1 during growth on acetate. J. Biol. Chem. 287:757–766 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Schrader J, et al. 2009. Methanol-based industrial biotechnology: current status and future perspectives of methylotrophic bacteria. Trends Biotechnol. 27:107–115 [DOI] [PubMed] [Google Scholar]
- 23. Skovran E, Crowther GJ, Guo X, Yang S, Lidstrom ME. 2010. A systems biology approach uncovers cellular strategies used by Methylobacterium extorquens AM1 during the switch from multi- to single-carbon growth. PLoS One 5:e14091. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Smejkalova H, Erb TJ, Fuchs G. 2010. Methanol Assimilation in Methylobacterium extorquens AM1: demonstration of all enzymes and their regulation. PLoS One 5:e13001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Vuilleumier S, et al. 2009. Methylobacterium genome sequences: a reference blueprint to investigate microbial metabolism of C1 compounds from natural and industrial sources. PLoS One 4:e5584. [DOI] [PMC free article] [PubMed] [Google Scholar]