Abstract
Human and animal studies have shown that green tea consumption is associated with a reduced risk of some cancers. This has been attributed to its polyphenol components, in particular (−)-epigallocatechin gallate (EGCG). In addition to be a cancer chemopreventive agent, EGCG inhibits angiogenesis, thus reducing tumor growth and metastasis. We tested EGCG modulation on the gene expression profile of endothelial cells stimulated by VEGF using Affymetrix microarrays. A total of 421 genes were up-regulated and 72 genes were down-regulated at the false discovery rate of 5% by VEGF, EGCG, and EGCG pretreatment followed by VEGF stimulation. The changes in the expression of several pivotal genes were validated by real-time PCR. Furthermore, we have identified two signaling pathways (Wnt and Id) involved in cell proliferation were modulated by EGCG treatment, suggesting the negative regulation of EGCG on cell proliferation. Our results also indicate that the anti-angiogenesis effect of EGCG is partially mediated through its broad inhibition on endothelial cell proliferation. Our data further support earlier observations that the anticancer effect of EGCG is mediated through changes in the expression of genes that are associated with cell proliferation.
Keywords: EGCG, endothelial cell, microarray, MAPP analysis, proliferation
INTRODUCTION
Epidemiological studies have shown that the consumption of green tea is associated with reduced risk of some cancers including gastric, esophagus and pancreas.(1–4) Studies in animal models and in vitro cell culture system also suggest that green tea and green tea extract inhibit the development and progression of skin, lung, mammary gland, and gastrointestinal tumors.(5, 6) Although the protective mechanisms of green tea have not been fully elucidated, it has been proposed that green tea extract inhibits cell proliferation and causes cell apoptosis in vitro by modulating signal transduction.(7) The protective effect of green tea has been attributed to the biological activities of its polyphenol catechins content, in particular (−)-epigallocatechin gallate (EGCG), the major constituent in green tea extract, which has been shown to have significant anti-proliferative and anti-carcinogenic properties.(8)
In addition to anti-proliferative effects, green tea has been shown to inhibit tumor invasion and angiogenesis,(9) which are the crucial steps for the growth and metastasis of all solid tumors. Angiogenesis, the formation of new blood vessels from the existing vessels, is involved in physiological processes such as wound healing as well as in pathological processes such as tumor growth and atherosclerosis.(10, 11) We and others have shown that EGCG inhibits tubular structure formation of endothelial cells in culture via modulation of vascular endothelial growth factor (VEGF) signaling, including phosphorylation of VEGF receptor and vascular endothelial (VE)-cadherin, disruption of VEGF-induced VE-cadherin/β-catenin complex, and inhibition of Akt phosphorylation and IL-8 production.(12, 13) It has been reported that the anticancer activity of EGCG is also associated with the inhibition of invasion by suppressing the activity of urokinase (14, 15) or the matrix metalloproteinases (MMPs).(16) Thus, it appears that green tea EGCG may contribute to cancer prevention by reducing cell proliferation, tumor cell migration, and invasion, and by inhibiting angiogenesis. In order to gain further insights to the understanding of metabolic pathways that are affected by EGCG, we tested the effect of EGCG on genes expression in endothelial cells using Affymetrix microarrays system.
MATERIALS AND METHODS
Cell culture
Human umbilical vein endothelial cells (HUVEC) cells were purchased from Cambrex (Walkersville, MD). Cells from passage 6 were grown in 100 mm petri dishes. The cells were maintained with 2% fetal bovine serum (FBS) using certified EBM-2 medium supplemented with growth factor kit (EGM-™2 SingleQuots, Cambrex), which provides optimal condition for HUVEC proliferation. At 80% confluency, cells were supplemented with or without EGCG (LKT Laboratories Inc., MN), 20 µM in dimethyl sulfoxide (DMSO) for 24h. DMSO final concentration in medium was 0.02%. Since Abe and Sato(17) showed a very active gene expression profile following 30 min stimulation of HUVEC with VEGF, we therefore chose to stimulate HUVEC with 50 ng/mL VEGF for 30 min. Then the cells were washed and harvested for RNA extraction.
Measurement of cell proliferation
HUVEC were grown in 6-well plates up to 60% confluency. EGCG at concentrations of 5, 10, 20 µM and VEGF (final concentration 50ng/mL) were added into the cells culture medium and cells were incubated for 24h. The cells were trypsinized and cell suspension was prepared in 0.5 mL. 9 µL was applied to hemocytometer and cell numbers per well were determined.
In vitro angiogenesis assay
24-well plates were coated with ice-cold growth factor-reduced Matrigel (250 µL/well) (BD, MA). It was allowed to polymerize at 37°C for 30 min. Thereafter, 1 mL of a suspension of HUVEC (2 × 105 cells/mL), which had been treated with DMSO or 20 µM EGCG in DMSO for up to 24 h, was seeded onto the Matrigel as described previously.(18) The cells were maintained in EBM-2 medium for 48h in the presence or absence of VEGF (50ng/mL). Tube formation was assessed after 48h and quantified by determining the mean length and number of branching points in three randomly selected fields.
RNA extraction and preparation of biotin labeled cRNA for GeneChip analysis
RNA was extracted from cells subjected to the different treatments using the RNeasy Mini Kit (QIAGEN, Valencia CA) according to the manufacturer’s protocol. Each experimental treatment was carried out in triplicate. cDNA was synthesized from 5 µg total RNA by SuperScript reverse transcriptase (Invitrogen, Carlsbad CA). Then biotin-labeled cRNA was synthesized from cDNA with in vitro transcription. The cRNA samples were fragmented and hybridized to human U133A Array GeneChip (Affymetrix, Santa Clara CA) in the 45°C oven overnight, at 60 RPM. Microarrays were washed and stained according to the protocol provided by the manufacturer. The arrays were scanned using Agilent confocal laser scanner (Affymetrix) and analyzed using Affymetrix 5.0 software (Affymetrix).
Data analysis of Affymetrix microarrays
Affymetrix Human U133A Array contains 22,283 human probe sets. Each gene on the array is represented by a probe set consisting of 11 perfect match (PM) and 11 mismatch (MM) probe pairs. The quantitative estimate of expression of each probe set is the Signal (Sig) metric. Sig is computed using the One-Step Tukey’s Biweight Estimate, which gives the weighted mean of the log (PM-MM) intensities for each probe set (Affymetrix Microarray Suite, Version 5.0). All microarrays were scaled to the same target signal using the “All Probe Sets” scaling option. A detection call (present, marginal or absent) is also given for each probe set. Only those genes that, 1) had signal over 25 (the mean intensity of all probe sets that had “absent” call), and 2) were called “Present” or “Marginal” in at least two of three replicates were included for statistical analysis. We used a Bayesian framework t-test (CyberT)(19) to identify genes that show differential expression among the control and treatments. The CyberT statistic models the standard deviation as the function of signal intensity for each probe set using Bayesian framework. This approach was regarded as the most robust method to analyze Affymetrix microarray gene expression data (20). Furthermore, we corrected p-values from the Bayesian framework t-test for multiple tests using a false-discovery rate of 5% (Q-values ≤ 0.05) criterion for significance (21).
Gene Ontology and Pathway Analysis
We used the GenMapp 2.0 and MappFinder 2.0 software package (www.GenMapp.org)(22, 23) for gene ontology (GO) and pathway analysis. These resources contain most updated GO terms from GenMapp archives (www.GenMapp.org) and available pathways from KEGG (www.genome.jp/kegg),(24) as well as contribution of GenMapp users for humans. All the 12,271 genes that were detectable in gene expression and their Q-values were imported into the programs, and linked to the GO hierarchy and pathway profiles. Gene ontology in GenMapp program allows all measured genes to be organized into hierarchies in three aspects of their biological functions: biological processes, cellular components, and molecular functions. Each hierarchy is structured in multiple levels of parent-child relationships between its terms. For each GO node, MappFinder calculated the percentage of the genes that met the user-defined criterion (Q ≤ 0.05) among all the measured genes. We determined which GO terms and pathways (MAPP) were significantly over-represented by the set of significant genes by computing Z-scores. Z-scores were computed by subtracting the expected number of genes in a GO term (or MAPP), meeting the criterion from the observed number of genes, divided by the standard deviation of the observed number of genes. A GO term or pathway with a Z-score greater than 1.96 (P ≤ 0.05) was considered to be statistically significant and of potential biological importance. GO terms describing fewer than two genes that met the user-defined criteria were not considered here as they were either too specific or too general(23). The filtered list of high Z-score GO terms was further annotated manually, to avoid redundant GO terms. When both a parent and a child GO term were presented in the list, the parent term was removed if its presence was due entirely to the genes meeting the criteria for the child term.
Validation of GeneChip data by real time PCR
The total RNA was used to validate selected number of responsive genes. The first strand cDNA synthesis was performed with the SuperScript II reverse transcriptase (Invitrogen) by using 1µg total RNA. The target mRNA levels were determined by TaqMan real-time RT-PCR using the ABI prism 7700 Sequence Detection System (Applied Biosystems, Foster city CA) and the Ct method: the fold of suppression=2Ct(control)-Ct(treatment). The TaqMan probe consisted of an oligonucleotide with a 5’ reporter dye (FAM) and a downstream 3’ quencher dye (NFQ). The reactions were performed on plates using adhesive seals as covers. TaqMan RT-PCR master mix Reagent kit (Applied Biosystems) in a total volume of 20 µL consisted of 3 mM MgCl2, 0.2 mM/each dNTP, 200 nM probe, primers, and 1.25 U Amplitaq Gold. The PCR was programmed as follows: initial denature at 95°C for 10 min followed by 95°C for 15 sec, 60°C for 1 min, cycled 40 times. Each target was amplified in triplicates. The standard curve was constructed with serial dilutions of untreated endothelial cell RNA. A housekeeping gene β-actin was used as a reference for all of the samples. The primers were purchased from Applied Biosystems. They are premade primers and the catalog numbers are as follows: Hs00156507_m1(CENPE), Hs00357821_g1(ID1), Hs00183740_m1(DKK1), Hs99999903_m1(beta-actin). Tryptophanyl-tRNA synthetase (TrpRS): forward primer: GCATGTAGGTCACCTCATTCCATTT, reverse primer: GACCAAGGGCACGTTAAATACATC, probe: CTGGAGCCACTTTGTG.
RESULTS AND DISCUSSION
1. Endothelial cell growth response to EGCG treatment
Cell proliferation
Cell proliferation modulated by EGCG pre-incubation was measured with and without VEGF stimulation. EGCG pre-incubation with and without VEGF stimulation dose-dependently inhibited HUVEC proliferation (Figure 1).
Figure 1. The inhibitory effect of doses of EGCG with and without VEGF-stimulation on HUVEC proliferation.
HUVEC were cultured in 6-well plate until 60% confluent. Cells were incubated with or without 5, 10 and 20 µM EGCG in culture medium for 24 h, then stimulated with or without 50 ng/mL VEGF for 24 h. The cell number per well was determined as described in the method. Data are mean ± SEM of duplicates per treatment. *p<0.05 and **p<0.001 compared to control. †p<0.05, ‡p<0.001 compared to VEGF.
In Vitro Angiogenesis
Endothelial cell growing on Matrigel coated plates showed tube formation, which represented the angiogenesis capacity of endothelial cells in vivo. The cells without VEGF stimulation, due to the presence of some growth factor in Matrigel, showed formation of tubes. VEGF stimulation increased tube formation by 15%. Both stimulated and unstimulated tube formations were inhibited by pre-incubation of endothelial cells with EGCG (20 µM) for 24 h (Figure 2).
Figure 2. The inhibitory effect on angiogenesis of HUVEC on Matrigel.
HUVEC were cultured until 70% confluent. Cells were preincubated with or without EGCG 20 µM for 24 h. Then the cells were seeded on growth factor reduced Matrigel coated 24-well plates and stimulated with or without 50 ng/mL VEGF for 48 h (see materials and methods).
(A) Tube formation by endothelial cells on Matrigel. (B) Quantification of total length and numbers of branches of formed tubes by HUVEC. Data mean ± SEM, n=3 per group. Three random fields in each well were selected to quantify the length and numbers of branches formed in vitro after 48 h. *p<0.05 compared with control cells, #p<0.05 compared with VEGF treated cells.
2. Gene expression responses to EGCG treatment in endothelial cells
Human U133A microarray contains 14,500 well-characterized human genes, of which the expressions of 8,400 genes were detected from endothelial cells in our experiment. A total of 421 genes were up-regulated and 72 genes were down-regulated (Q ≤ 0.05) by VEGF, EGCG, and EGCG pretreatment followed by VEGF stimulation (Table 1). We were specifically interested in the genes and functions that were affected by EGCG treatments, in particular, when cells were stimulated with VEGF.
Table 1.
Total numbers of genes that have been regulated by EGCG and VEGF
The effects of VEGF on endothelial cells
In accordance with previous works(17, 25, 26), our study has shown some typical regulatory effects of VEGF. Gene Ontology (GO term) analysis identified the impact of VEGF on several biological processes including activation of NF-κB-inducing kinase, anti-apoptosis, angiogenesis and induction of positive chemotaxis (Table 2). Molecular functions such as chemokine and cytokine activities were also regulated by VEGF enrichment in vitro (Table 2). Similarly, MAPP pathway analysis has identified several pathways that have been regulated by VEGF stimulation, including apoptosis, adipogenesis, cytokine and inflammatory responses, and proliferation (Table 3).
Table 2.
GO Categories Over-Represented in Probe Sets Significant for VEGF vs. Control
| GOID | GO Name* | Number Changed/Number Measured (% Changed) |
Z Score | P value | |
|---|---|---|---|---|---|
|
Biological Process |
|||||
| 7250 | activation of NF-kappaB-inducing kinase | 2/7 (28.6%) | 3.563 | 0.035 | |
| 1525 | angiogenesis | 4/25 (16.0%) | 3.870 | 0.001 | |
| 6916 | anti-apoptosis | 10/52 (19.25) | 5.486 | 0.002 | |
| 19722 | calcium-mediated signaling | 2/7 (28.6%) | 3.563 | 0.026 | |
| 7050 | cell cycle arrest | 7/42 (16.7%) | 4.584 | <0.001 | |
| 1709 | cell fate determination | 2/5 (40%) | 7.637 | <0.001 | |
| 7267 | cell-cell signaling | 17/92 (18.5%) | 5.691 | <0.001 | |
| 6935 | chemotaxis | 9/37 (24.3%) | 7.571 | <0.001 | |
| 30574 | collagen catabolism | 2/7 (28.6%) | 3.563 | 0.022 | |
| 7253 | cytoplasmic sequestering of NF-kappaB | 2/3 (66.7%) | 5.886 | 0.003 | |
| 6959 | humoral immune response | 2/13 (15.4%) | 2.306 | 0.029 | |
| 188 | inactivation of MAPK activity | 3/11 (27.3%) | 4.236 | 0.004 | |
| 50930 | induction of positive chemotaxis | 2/2 (100%) | 7.345 | 0.001 | |
| 6954 | inflammatory response | 6/61 (9.8%) | 3.656 | 0.003 | |
| 7229 | integrin-mediated signaling pathway | 4/26 (15.4%) | 3.249 | 0.013 | |
| 7259 | JAK-STAT cascade | 2/13 (15.4%) | 2.871 | 0.034 | |
| 30216 | keratinocyte differentiation | 2/3 (66.7%) | 5.886 | <0.001 | |
| 7638 | mechanosensory behavior | 2/3 (66.7%) | 5.886 | 0.003 | |
| 7517 | muscle development | 4/49 (8.2%) | 2.692 | 0.019 | |
| 7422 | peripheral nervous system development | 2/3 (66.7%) | 5.886 | 0.001 | |
| 6470 | protein amino acid dephosphorylation | 7/74 (9.5%) | 2.741 | 0.017 | |
| 8277 | regulation of G-protein coupled receptor protein signaling pathway | 3/12 (25.0%) | 4.001 | 0.007 | |
| 9615 | response to virus | 3/21 (14.3%) | 2.647 | 0.040 | |
| 9611 | response to wounding | 2/8 (25.0%) | 4.697 | <0.001 | |
| 1501 | skeletal development | 5/33 (15.2%) | 2.732 | 0.013 | |
| 6366 | transcription from RNA polymerase II promoter | 10/115 (8.7%) | 4.890 | <0.001 | |
| 7179 | transforming growth factor beta receptor signaling pathway | 3/14 (21.4%) | 2.871 | 0.031 | |
| 1570 | vasculogenesis | 2/4 (50.0%) | 5.002 | 0.011 | |
| Molecular Function | |||||
| 8009 | chemokine activity | 6/11 (54.5%) | 9.112 | <0.001 | |
| 5125 | cytokine activity | 6/31 (19.4%) | 8.820 | <0.001 | |
| 3677 | DNA binding | 19/506 (3.8%) | 5.322 | <0.001 | |
| 5355 | glucose transporter activity | 2/4 (50%) | 5.002 | 0.007 | |
| 8083 | growth factor activity | 11/55 (20.0%) | 6.423 | <0.001 | |
| 5179 | hormone activity | 5/17 (29.4%) | 5.346 | <0.001 | |
| 4879 | ligand-dependent nuclear receptor activity | 2/5 (40.0%) | 4.308 | 0.002 | |
| 17017 | MAP kinase phosphatase activity | 3/8 (37.5%) | 5.171 | <0.001 | |
| 8195 | phosphatidate phosphatase activity | 2/3 (66.7%) | 5.886 | 0.002 | |
| 8243 | plasminogen activator activity | 2/5 (40.0%) | 4.388 | 0.008 | |
| 19901 | protein kinase binding | 3/11 (27.3%) | 2.546 | 0.044 | |
| 3707 | steroid hormone receptor activity | 5/24 (20.8%) | 4.431 | 0.001 | |
| 3714 | transcription corepressor activity | 9/58 (15.5%) | 4.920 | <0.001 | |
| Cellular Component | |||||
| 5576 | extracellular region | 9/120 (7.5%) | 5.111 | <0.001 | |
| 5615 | extracellular space | 16/103 (15.5%) | 6.439 | <0.001 | |
GO terms listed met three criteria:
(1) Z score ≥1.96
(2) Number genes with changed expression ≥ 2.
(3) Unique GO term only.
Table 3.
Pathway Analysis*
| MAPP Name | Number Changed/Number Measured (% Changed) |
Z Score | P value |
|---|---|---|---|
| EGCG vs Control | |||
| Hs_Cholesterol_Biosynthesis | 3/15 (20%) | 8.946 | <0.001 |
| Hs_Id_NetPath_5 | 2/43 (4.7%) | 3.117 | 0.039 |
| Hs_Wnt_NetPath_8 | 2/77 (2.6%) | 2.016 | 0.108 |
| VEGF vs Control | |||
| Hs_Hypertrophy_model | 7/19 (36.8%) | 5.230 | <0.001 |
| Hs_Adipogenesis | 15/98 (15.3%) | 3.431 | 0.002 |
| Hs_Cytokines_and_Inflammatory_Response_Biocarta | 4/16 (25%) | 2.906 | 0.022 |
| Hs_Apoptosis | 10/73 (13.7%) | 2.388 | 0.028 |
| Hs_Nuclear_Receptors | 5/27 (18.5) | 2.438 | 0.032 |
| EGCG vs EGCG+VEGF | |||
| Hs_Hypertrophy_model | 5/19 (26.3%) | 6.265 | <0.001 |
| Hs_Cytokines_and_Inflammatory_Response_Biocarta | 4/16 (25.0%) | 5.424 | 0.001 |
| Hs_Id_NetPath_5 | 4/43 (9.3%) | 2.626 | 0.038 |
| Hs_Delta-Notch_NetPath_3 | 5/65 (7.7%) | 2.445 | 0.039 |
| Hs_Blood_Clotting_Cascade | 2/13 (15.4%) | 2.771 | 0.047 |
| Hs_Smooth_muscle_contraction | 6/101 (5.9%) | 1.978 | 0.054 |
| Hs_Adipogenesis | 6/98 (6.1%) | 2.059 | 0.060 |
| Hs_Prostaglandin_synthesis_regulation | 2/20 (10%) | 1.972 | 0.098 |
Pathway listed met two criteria:
(1) Z score ≥1.96
(2) Number genes with changed expression ≥ 2.
The effects of EGCG on endothelial cells
Under EGCG treatments, there were 14 genes up-regulated and 14 genes down-regulated compared to the control group as calculated by both Bayesian t-test and Q-value correction (Table 1 and Supplemental Table 1). (Supporting supplemental Tables 1–3 are available as Online Supporting Material with the online posting of this paper at http//jn.nutrition.org).
To further elaborate the EGCG effect on modulation of cell proliferation, VEGF was added to stimulate cell growth (EGCG+VEGF treatment). Under this treatment, 116 genes were significantly up-regulated and 7 genes were down regulated compared to the group with EGCG alone (Table 1 and Supplemental Table 2). However, there was no differential gene expression when we compared the cells treated with EGCG+VEGF to the cells only treated with VEGF (Table 1).
Furthermore, based on GO analysis we found that EGCG exhibit strong regulatory effects on three biological processes: cholesterol biosynthesis, microtubule activities and inhibition of cell proliferation (Table 4 and Supplemental Table 1). As identified by MAPP finder (Table 3), 3 out of 15 genes (20%) in cholesterol biosynthesis pathway, have shown differential expressions: Isopentenyl-diphosphate delta isomerase, dehydrocholesterol reductase and sterol-C4-methyl oxidase-like genes (please see the pathway cholesterol biosynthesis at this site: (http://www.genmapp.org/HTML_MAPPs/Human/Hs_Contributed_20051123/metabolic_process-GenMAPP/Hs_Cholesterol_Biosynthesis/Hs_Cholesterol_Biosynthesis.htm). The expressions of all these 3 genes were increased by EGCG treatment (Table 4, Supplemental Table 1). The increase of dehydrocholesterol reductase and sterol-C4-methyl oxidase-like genes would likely contribute to the synthesis of cholesterol. The significance of this effect of EGCG in endothelial cells warrants further investigation.
Table 4.
GO Categories Over-Represented in Probe Sets Significant for EGCG vs. Control
| GOID | GO Name* | Number Changed/Number Measured (% Changed) |
Z Score | P value | |
|---|---|---|---|---|---|
| Biological Process | |||||
| 6695 | cholesterol biosynthesis | 3/17 (17.6%) | 11.187 | <0.001 | |
| 7018 | microtubule-based movement | 2/40 (5.0%) | 4.751 | 0.014 | |
| 8285 | negative regulation of cell proliferation | 2/78 (2.6%) | 3.221 | 0.036 | |
| Molecular Function | |||||
| 3777 | microtubule motor activity | 2/64 (3.1%) | 3.276 | 0.038 | |
| 16491 | oxidoreductase activity | 2/33 (6.1%) | 5.360 | 0.007 | |
| 16853 | isomerase activity | 5/251 (2.0%) | 3.566 | 0.004 | |
| Cellular Component | |||||
| 5783 | endoplasmic reticulum | 4/194 (2.1%) | 3.088 | 0.017 | |
| 5624 | membrane fraction | 3/201 (1.5%) | 3.332 | 0.017 | |
| 5875 | microtubule associated complex | 2/27 (7.4%) | 4.448 | 0.010 | |
GO terms listed met three criteria:
(1) Z score ≥1.96
(2) Number genes with changed expression ≥ 2.
(3) Unique GO term only.
Negative regulation of EGCG on endothelial cell proliferation and angiogenesis
The negative regulation of EGCG on endothelial cell proliferation in this study (Table 4) appears to have a profound biological significance. TGFβ inducible early growth responses gene (TIEG) and tryptophanyl-tRNA synthetase (WARS), were two out of 78 genes (2.6%) that are involved in cell proliferation were regulated by EGCG in the current study (Table 4, Supplemental Table 1). TIEG belongs to a family of transcription factors with anti-proliferative and apoptosis-inducing functions.(27, 28) However, we found that this gene was down regulated by EGCG treatment (Supplement 1), whereas with VEGF stimulation, TIEG was upregulated by EGCG compared to the control (Supplement 2). Thus, the downregulation of TIEG represents the anti-VEGF function of EGCG and might be tissue-specific. WARS is an enzyme that catalyzes the first step of protein synthesis, and is reported to have antiangiogenesis function in addition to the catalyzing function.(29, 30) It binds to intercellular junctions of endothelial cells to form a complex with VE-cadherin which then inhibits VEGF-induced ERK activation and endothelial cell migration.(31) The up-regulation of WARS by EGCG and inhibition of angiogenesis may counteract down-regulation of TIEG as noted with EGCG treatment (Supplemental Table 2). In terms of biological outcome, our finding is in accordance with the previous observations showing the suppressive effect of EGCG on the proliferation of different cell types. For examples, studies have shown EGCG inhibited the growth of human epidermoid carcinoma cells(32) hepatic stellate cells,(33) human bronchial epithelial 21BES cells(34) and human cervical cancer cells(35). One study reported that EGCG broadly decreased the expression of genes related with prostate cancer cells proliferation.(36) And another study reported EGCG modulated early-response genes in bronchial epithelial 21BES cells followed by activation of genes with a variety of cellular functions such as growth inhibition and the activation of apoptosis that are downstream targets of early-response genes.(34)
Two pathways related to cell proliferation were modified by EGCG treatment in our study: Wnt signaling pathway and Id pathway. Wnts are a family of signaling proteins secreted from various cells, which have a major impact on embryonic development, tumor progression and stem cell differentiation.(37) (Please see the Wnt signaling pathway at: (http://www.genmapp.org/HTML_MAPPs/Human/Hs_Contributed_20051123/cellular_process-GenMAPP/Hs_Wnt_signaling/Hs_Wnt_signaling.htm). Studies have shown that Wnt pathway is activated in endothelial cells in vitro. The activated endothelial cells express multiple ligands, receptors and secretory modulators, which may play roles in angiogenesis.(38) Wnt signaling also induces proliferation and survival of endothelial cells.(39, 40) This pathway is triggered by wnt binding to its cell membrane receptors, which is composed of 10 transmembrane proteins.(41) The signal is then transduced through several cascades of cytoplasmic proteins to nucleus via the translocation of the complex formed by β-catenin and LEF/TCF. The complex exerts transcriptional activity.(42) In the current study, 2 out of 77 genes in Wnt pathway were regulated by EGCG treatment. Dickkopf homolog 1 (Dkk1) is a soluble antagonist of wnt pathway and has a high affinity ligand to LRP5, which is a key molecule in Wnt pathway functioning as a co-receptor for Wnt binding to the cell membrane.(43) The induction of Dkk1 expression by EGCG in our study (Table 4 and Supplemental Table 1) is an indication of Wnt signaling pathway inhibition. Centromere protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. CENPE is proposed to be one of the motors responsible for mammalian chromosome movement and/or spindle elongation, and involved in Wnt signaling pathway. Its reduction by EGCG (Table 4 and Supplemental Table 1) further indicates the inhibition of cell proliferation by EGCG. In addition, inhibitors of differentiation (Id) or DNA binding proteins are important for cellular proliferation and differentiation in a variety of cell types through regulation of gene expression (please see Id pathway at this site: http://www.genmapp.org/HTML_MAPPs/Human/Hs_Contributed_20060824/cellular_process-GenMAPP/Hs_Id_NetPath_5/Hs_Id_NetPath_5.htm). Id-1 belongs to a group of helix-loop-helix proteins that lack DNA binding domain. Id-1 inhibits DNA binding activity of basic helix-loop-helix (bHLH) by forming non-functional heterodimers with it to inhibit cell differentiation and promote proliferation.(44) Studies have shown that Id-1 induces proliferation in prostate cancer cells, hepatocellular carcinoma cells and nasopharyngeal carcinoma cells.(44) Its down-regulation by EGCG (Table 4 and Supplemental Table 1) is likely to play a role in the inhibition of tumorigenesis and progression. Hairy and enhancer of split 1 (HES1) is another HLH-type of negative regulator of cell proliferation.(45, 46) The down-regulation of this gene by EGCG (Table 4 and Supplemental Table 1) is probably results in the inhibition of proliferation. The inhibition of genes involved in cell proliferation by EGCG was also confirmed by the dose-dependent inhibition of HUVEC treated with EGCG or stimulated with VEGF following EGCG supplement (Figure 1). Our findings on the EGCG suppressive effect on vascular endothelial cells proliferation and those reported on cancer cells suggest that the overall anti-proliferative action of EGCG might be one important mechanism by which this polyphenols of green tea contributes to the prevention of angiogenesis and cancer progression.
We and others have shown that EGCG inhibits angiogenesis.(12, 47) While endothelial cell proliferation is one of the stages of angiogenesis, other molecular mechanisms are also involved in this process. In the present study, we have identified relevant molecules involved in angiogenesis as affected by EGCG. GO term analysis discovered that EGCG has profound influence on intracellular microtubule components and activities (Tables 4 and 5), which may play a role in the inhibition of cell migration and angiogenesis as well. Further studies are needed to determine EGCG modulation at protein levels in conjunction with biological functions presented here: the inhibition of cell proliferation and angiogenesis.
Table 5.
GO Categories Over-Represented in Probe Sets Significant for EGCG+VEGF vs. EGCG
| GOID | GO Name* | Number Changed/Number Measured (% Changed) |
Z Score | P value | |
|---|---|---|---|---|---|
|
Biological Process |
|||||
| 1525 | angiogenesis | 3/25 (12.0%) | 4.275 | 0.007 | |
| 6916 | anti-apoptosis | 5/52 (9.6%) | 4.902 | <0.001 | |
| 6874 | calcium ion homeostasis | 2/5 (40.0%) | 4.349 | 0.016 | |
| 19722 | calcium-mediated signaling | 2/7 (28.6%) | 6.448 | 0.002 | |
| 7050 | cell cycle arrest | 3/42 (7.1%) | 3.405 | 0.018 | |
| 6928 | cell motility | 2/59 (3.4%) | 3.749 | 0.006 | |
| 7267 | cell-cell signaling | 12/92 (13.0%) | 7.085 | <0.001 | |
| 6935 | chemotaxis | 7/37 (18.9%) | 10.911 | <0.001 | |
| 7186 | G-protein coupled receptor protein signaling pathway | 4/88 (4.5%) | 3.840 | 0.003 | |
| 6959 | humoral immune response | 2/13 (15.4%) | 4.092 | 0.003 | |
| 50930 | induction of positive chemotaxis | 2/2 (100%) | 12.459 | <0.001 | |
| 6954 | inflammatory response | 6/61 (9.8%) | 7.760 | <0.001 | |
| 7229 | integrin-mediated signaling pathway | 2/26 (7.6%) | 2.927 | 0.048 | |
| 30216 | keratinocyte differentiation | 2/3 (66.7%) | 10.108 | 0.001 | |
| 7517 | muscle development | 2/49 (4.1%) | 2.588 | 0.039 | |
| 8285 | negative regulation of cell proliferation | 7/78 (9.0%) | 6.054 | <0.001 | |
| 122 | negative regulation of transcription from RNA polymerase II promoter | 3/39 (7.7%) | 3.525 | 0.016 | |
| 7399 | neurogenesis | 8/107 (7.5%) | 5.878 | <0.001 | |
| 9887 | organogenesis | 3/33 (9.1%) | 8.144 | <0.001 | |
| 8284 | positive regulation of cell proliferation | 6/55 (10.9%) | 5.996 | 0.001 | |
| 8217 | regulation of blood pressure | 2/8 (25.0%) | 5.992 | 0.006 | |
| 8277 | regulation of G-protein coupled receptor protein signaling pathway | 2/12 (16.7%) | 4.762 | 0.008 | |
| 9618 | response to pathogenic bacteria | 2/7 (28.6%) | 5.288 | 0.012 | |
| 1501 | skeletal development | 3/33 (9.1%) | 3.240 | 0.034 | |
| 6366 | transcription from RNA polymerase II promoter | 4/115 (3.5%) | 4.025 | <0.001 | |
|
Molecular Function | |||||
| 8009 | chemokine activity | 6/11 (54.5%) | 15.778 | <0.001 | |
| 5125 | cytokine activity | 3/31 (9.7%) | 12.01 | <0.001 | |
| 3677 | DNA binding | 10/506 (2.0%) | 5.311 | <0.001 | |
| 8083 | growth factor activity | 7/55 (12.7%) | 7.904 | <0.001 | |
| 8201 | heparin binding | 3/29 (10.3%) | 4.369 | 0.008 | |
| 5179 | hormone activity | 2/17 (11.8%) | 3.604 | 0.022 | |
| 17017 | MAP kinase phosphatase activity | 3/8 (37.5%) | 9.148 | 0.001 | |
| 8243 | plasminogen activator activity | 2/5 (40.0%) | 7.729 | 0.002 | |
| 3707 | steroid hormone receptor activity | 3/24 (12.5%) | 4.795 | 0.001 | |
| 3714 | transcription corepressor activity | 5/58 (8.6%) | 5.015 | <0.001 | |
|
Cellular Component | |||||
| 5576 | extracellular region | 4/121 (3.3%) | 6.595 | <0.001 | |
| 5615 | extracellular space | 11/103 (10.7%) | 8.432 | <0.001 | |
GO terms listed met three criteria:
(1) Z score ≥1.96
(2) Number genes with changed expression ≥ 2.
(3) Unique GO term only.
The effects of EGCG on endothelial cells stimulated with VEGF
When EGCG-pretreated HUVECs were stimulated with VEGF, a more robust effect of EGCG on biological functions and signal transduction pathways was observed compared to the HUVECs treated with EGCG alone (Tables 5 and Supplemental Table 2). However, despite of EGCG inhibition of cell growth and angiogenesis (Figures 1 and 2), we did not see any change with EGCG pre-treatment in the most well known genes that are involved in the classic angiogenesis-signaling pathway such as PI3 kinase and dual specificity phosphatase (PTEN). These observations were in concurrence with the previous report demonstrating that EGCG had no effect on the expression of PI3 kinase and PTEN.(36) Our previous study also showed that EGCG inhibits angiogenesis by preventing phosphorylation of several enzymes involved in angiogenesis signal transduction pathways.(48) EGCG, through its direct binding to receptors and enzymes,(49, 50) or through its metal chelating activity,(51) may regulate some enzymes and cell surface receptors, which are dependent on divalent cation for their activation.(8, 51) Furthermore, we have shown that EGCG inhibits angiogenesis through the disruption of VEGF-induced VE-cadherin/VEGF receptors/β-catenin/PI3-kinase complex formation(48) in endothelial cells without affecting gene expressions of the enzymes. Therefore, the anti-angiogenesis effect of EGCG is mainly due to the inhibition of the activity of enzymes that are involved in signaling pathways that govern vessel formation and maturation.
When HUVECs were incubated with EGCG for 24hrs, then stimulated with VEGF for 30 min, there was no significant difference on gene expression compared to the cells that were stimulated with VEGF only. However, in comparison to EGCG treatment, 123 genes showed differential expressions. This differential effect can be attributed to the strong mitogenic effect of VEGF. VEGF has been shown to exert a dynamic modulatory effect on endothelial cell gene expressions associated with cell proliferation, migration, and angiogenesis.(17)
VEGF at the concentrations of 50 ng/mL or more has been used to investigate angiogenesis in cell culture systems.(52, 53) In our previous studies we have also used 50 ng/mL of VEGF in vitro to determine its mechanism of action on angiogenesis.(48) To be consistent, we decided to use the same concentration of VEGF in the present study, which altered the expression of more than 350 genes in HUVECs within 30 min (Supplemental Table 3). This effect of VEGF is mediated through specific binding to its receptors; VEGFR-1 (Flt-1) and VEG FR-2 (KDR/Fl k-1) on endothelial cells and downstream activating intracellular signaling pathways.(54)
We have validated our findings by determining mRNA levels of several selected genes using real-time RT-PCR (Figure 3). Our PCR results have shown consistent and significant expression patterns of selected genes from Microarray analysis, which confirm our findings with Microarray analysis.
Figure 3. QPCR validation of selected differentially expressed genes by EGCG treatment.
HUVECs were cultured in 100 mm dishes until 70% confluent. Cells were incubated with or without EGCG 20µM for 24 h. Total RNA was extracted for both microarray and real-time PCR analysis (see materials and methods). n=3 per treated group.
3. Summary
This study demonstrates the modulation of endothelial cell gene expression by EGCG when the cells were challenged with angiogenic growth factor VEGF. We have found that a combination of various cellular regulatory components is required for EGCG to exert its antiangiogenic effect. A selective number of genes modulated by EGCG were validated by real time PCR. It should be noted that in vitro levels of VEGF and EGCG applied in this study are comparable to those used by other investigators.(35, 36, 55) The anti-angiogenic activity of EGCG on endothelial cells might be through inhibition of cell proliferation and cell migration. Future works are needed to elucidate the biological function of those specific genes by employing transgenic and molecular biology approaches. These EGCG-responsive genes may provide key insights for identifying the mechanisms of other polyphenolic compounds that might have cancer prevention properties.
Supplementary Material
ACKNOWLEDGMENT
This manuscript is based on work supported by the U.S. Department of Agriculture, under agreement No. 58-1950-9-001 and NCI grant #R03 CA094290-01. Any opinions, findings, conclusions, or recommendations expressed in this publication are those of the author(s) and do not necessarily reflect the view of the U.S. Department of Agriculture. We would also like to thank Stephanie Marco for her assistance in the preparation of this manuscript.
Footnotes
See also supplemental Tables 1–3 available as Online Supporting Material with the online posting of this paper at http//jn.nutrition.org
URL for signaling pathways:
Cholesterol biosynthesis pathway:
Wnt pathway:
Id pathway:
REFERENCES
- 1.Kono S, Ikeda M, Tokudome S, Kuratsune M. A case-control study of gastric cancer and diet in northern Kyushu, Japan. Jpn J Cancer Res. 1988;79:1067–1074. doi: 10.1111/j.1349-7006.1988.tb01528.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Gao YT, McLaughlin JK, Blot WJ, Ji BT, Dai Q, Fraumeni JF., Jr Reduced risk of esophageal cancer associated with green tea consumption. J Natl Cancer Inst. 1994;86:855–858. doi: 10.1093/jnci/86.11.855. [DOI] [PubMed] [Google Scholar]
- 3.Setiawan VW, Zhang ZF, Yu GP, Lu QY, Li YL, Lu ML, Wang MR, Guo CH, Yu SZ, Kurtz RC, Hsieh CC. Protective effect of green tea on the risks of chronic gastritis and stomach cancer. Int J Cancer. 2001;92:600–604. doi: 10.1002/ijc.1231. [DOI] [PubMed] [Google Scholar]
- 4.Bushman JL. Green tea and cancer in humans: a review of the literature. Nutr Cancer. 1998;31:151–159. doi: 10.1080/01635589809514697. [DOI] [PubMed] [Google Scholar]
- 5.Rogers AE, Hafer LJ, Iskander YS, Yang S. Black tea and mammary gland carcinogenesis by 7,12-dimethylbenz[a]anthracene in rats fed control or high fat diets. Carcinogenesis. 1998;19:1269–1273. doi: 10.1093/carcin/19.7.1269. [DOI] [PubMed] [Google Scholar]
- 6.Lyn-Cook BD, Rogers T, Yan Y, Blann EB, Kadlubar FF, Hammons GJ. Chemopreventive effects of tea extracts and various components on human pancreatic and prostate tumor cells in vitro. Nutr Cancer. 1999;35:80–86. doi: 10.1207/S1532791480-86. [DOI] [PubMed] [Google Scholar]
- 7.Park AM, Dong Z. Signal transduction pathways: targets for green and black tea polyphenols. J Biochem Mol Biol. 2003;36:66–77. [PubMed] [Google Scholar]
- 8.Jung YD, Ellis LM. Inhibition of tumour invasion and angiogenesis by epigallocatechin gallate (EGCG), a major component of green tea. Int J Exp Pathol. 2001;82:309–316. doi: 10.1046/j.1365-2613.2001.00205.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Cao Y, Cao R. Angiogenesis inhibited by drinking tea. Nature. 1999;398:381. doi: 10.1038/18793. [DOI] [PubMed] [Google Scholar]
- 10.Folkman J. Angiogenesis in cancer, vascular, rheumatoid and other disease. Nat Med. 1995;1:27–31. doi: 10.1038/nm0195-27. [DOI] [PubMed] [Google Scholar]
- 11.Carmeliet P, Jain RK. Angiogenesis in cancer and other diseases. Nature. 2000;407:249–257. doi: 10.1038/35025220. [DOI] [PubMed] [Google Scholar]
- 12.Tang FY, Meydani M. Green tea catechins and vitamin E inhibit angiogenesis of human microvascular endothelial cells through suppression of IL-8 production. Nutr Cancer. 2001;41:119–125. doi: 10.1080/01635581.2001.9680622. [DOI] [PubMed] [Google Scholar]
- 13.Tang FY, Nguyen N, Meydani M. Green tea catechins inhibit VEGF-induced angiogenesis in vitro through suppression of VE-cadherin phosphorylation and inactivation of Akt molecule. Int J Cancer. 2003;106:871–878. doi: 10.1002/ijc.11325. [DOI] [PubMed] [Google Scholar]
- 14.Jankun J, Selman SH, Swiercz R, Skrzypczak-Jankun E. Why drinking green tea could prevent cancer. Nature. 1997;387:561. doi: 10.1038/42381. [DOI] [PubMed] [Google Scholar]
- 15.Jankun J, Keck RW, Skrzypczak-Jankun E, Swiercz R. Inhibitors of urokinase reduce size of prostate cancer xenografts in severe combined immunodeficient mice. Cancer Res. 1997;57:559–563. [PubMed] [Google Scholar]
- 16.Garbisa S, Sartor L, Biggin S, Salvato B, Benelli R, Albini A. Tumor gelatinases and invasion inhibited by the green tea flavanol epigallocatechin-3-gallate. Cancer. 2001;91:822–832. doi: 10.1002/1097-0142(20010215)91:4<822::aid-cncr1070>3.0.co;2-g. [DOI] [PubMed] [Google Scholar]
- 17.Abe M, Sato Y. cDNA microarray analysis of the gene expression profile of VEGF-activated human umbilical vein endothelial cells. Angiogenesis. 2001;4:289–298. doi: 10.1023/a:1016018617152. [DOI] [PubMed] [Google Scholar]
- 18.Grant DS, Lelkes PI, Fukuda K, Kleinman HK. Intracellular mechanisms involved in basement membrane induced blood vessel differentiation in vitro. In Vitro Cell Dev Biol. 1991;27A:327–336. doi: 10.1007/BF02630910. [DOI] [PubMed] [Google Scholar]
- 19.Baldi P, Long AD. A Bayesian framework for the analysis of microarray expression data: regularized t -test and statistical inferences of gene changes. Bioinformatics. 2001;17:509–519. doi: 10.1093/bioinformatics/17.6.509. [DOI] [PubMed] [Google Scholar]
- 20.Choe SE, Boutros M, Michelson AM, Church GM, Halfon MS. Preferred analysis methods for Affymetrix GeneChips revealed by a wholly defined control dataset. Genome Biol. 2005;6:R16. doi: 10.1186/gb-2005-6-2-r16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Storey JD, Tibshirani R. Statistical significance for genomewide studies. Proc Natl Acad Sci U S A. 2003;100:9440–9445. doi: 10.1073/pnas.1530509100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Dahlquist KD, Salomonis N, Vranizan K, Lawlor SC, Conklin BR. GenMAPP, a new tool for viewing and analyzing microarray data on biological pathways. Nat Genet. 2002;31:19–20. doi: 10.1038/ng0502-19. [DOI] [PubMed] [Google Scholar]
- 23.Doniger SW, Salomonis N, Dahlquist KD, Vranizan K, Lawlor SC, Conklin BR. MAPPFinder: using Gene Ontology and GenMAPP to create a global gene-expression profile from microarray data. Genome Biol. 2003;4:R7. doi: 10.1186/gb-2003-4-1-r7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Kanehisa M, Goto S, Kawashima S, Okuno Y, Hattori M. The KEGG resource for deciphering the genome. Nucleic Acids Res. 2004;32:D277–D280. doi: 10.1093/nar/gkh063. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Gerritsen ME, Tomlinson JE, Zlot C, Ziman M, Hwang S. Using gene expression profiling to identify the molecular basis of the synergistic actions of hepatocyte growth factor and vascular endothelial growth factor in human endothelial cells. Br J Pharmacol. 2003;140:595–610. doi: 10.1038/sj.bjp.0705494. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Kallmann BA, Wagner S, Hummel V, Buttmann M, Bayas A, Tonn JC, Rieckmann P. Characteristic gene expression profile of primary human cerebral endothelial cells. Faseb J. 2002;16:589–591. doi: 10.1096/fj.01-0594fje. [DOI] [PubMed] [Google Scholar]
- 27.Tachibana I, Imoto M, Adjei PN, Gores GJ, Subramaniam M, Spelsberg TC, Urrutia R. Overexpression of the TGFbeta-regulated zinc finger encoding gene, TIEG, induces apoptosis in pancreatic epithelial cells. J Clin Invest. 1997;99:2365–2374. doi: 10.1172/JCI119418. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Ribeiro A, Bronk SF, Roberts PJ, Urrutia R, Gores GJ. The transforming growth factor beta(1)-inducible transcription factor TIEG1, mediates apoptosis through oxidative stress. Hepatology. 1999;30:1490–1497. doi: 10.1002/hep.510300620. [DOI] [PubMed] [Google Scholar]
- 29.Wakasugi K, Slike BM, Hood J, Otani A, Ewalt KL, Friedlander M, Cheresh DA, Schimmel P. A human aminoacyl-tRNA synthetase as a regulator of angiogenesis. Proc Natl Acad Sci U S A. 2002;99:173–177. doi: 10.1073/pnas.012602099. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Otani A, Slike BM, Dorrell MI, Hood J, Kinder K, Ewalt KL, Cheresh D, Schimmel P, Friedlander M. A fragment of human TrpRS as a potent antagonist of ocular angiogenesis. Proc Natl Acad Sci U S A. 2002;99:178–183. doi: 10.1073/pnas.012601899. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Tzima E, Reader JS, Irani-Tehrani M, Ewalt KL, Schwartz MA, Schimmel P. VE-cadherin links tRNA synthetase cytokine to anti-angiogenic function. J Biol Chem. 2005;280:2405–2408. doi: 10.1074/jbc.C400431200. [DOI] [PubMed] [Google Scholar]
- 32.Liang YC, Lin-shiau SY, Chen CF, Lin JK. Suppression of extracellular signals and cell proliferation through EGF receptor binding by (−)-epigallocatechin gallate in human A431 epidermoid carcinoma cells. J Cell Biochem. 1997;67:55–65. doi: 10.1002/(sici)1097-4644(19971001)67:1<55::aid-jcb6>3.0.co;2-v. [DOI] [PubMed] [Google Scholar]
- 33.Chen A, Zhang L, Xu J, Tang J. The antioxidant (−)-epigallocatechin-3-gallate inhibits activated hepatic stellate cell growth and suppresses acetaldehyde-induced gene expression. Biochem J. 2002;368:695–704. doi: 10.1042/BJ20020894. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Vittal R, Selvanayagam ZE, Sun Y, Hong J, Liu F, Chin KV, Yang CS. Gene expression changes induced by green tea polyphenol (−)-epigallocatechin-3-gallate in human bronchial epithelial 21BES cells analyzed by DNA microarray. Mol Cancer Ther. 2004;3:1091–1099. [PubMed] [Google Scholar]
- 35.Ahn WS, Huh SW, Bae SM, Lee IP, Lee JM, Namkoong SE, Kim CK, Sin JI. A major constituent of green tea EGCG, inhibits the growth of a human cervical cancer cell line, CaSki cells, through apoptosis, G(1) arrest, and regulation of gene expression. DNA Cell Biol. 2003;22:217–224. doi: 10.1089/104454903321655846. [DOI] [PubMed] [Google Scholar]
- 36.Wang SI, Mukhtar H. Gene expression profile in human prostate LNCaP cancer cells by (--) epigallocatechin-3-gallate. Cancer Lett. 2002;182:43–51. doi: 10.1016/s0304-3835(02)00065-4. [DOI] [PubMed] [Google Scholar]
- 37.Eisenberg LM, Eisenberg CA. Wnt signal transduction and the formation of the myocardium. Dev Biol. 2006;293:305–315. doi: 10.1016/j.ydbio.2006.02.014. [DOI] [PubMed] [Google Scholar]
- 38.Goodwin AM, Sullivan KM, D'Amore PA. Cultured endothelial cells display endogenous activation of the canonical Wnt signaling pathway and express multiple ligands, receptors, and secreted modulators of Wnt signaling. Dev Dyn. 2006;235:3110–3120. doi: 10.1002/dvdy.20939. [DOI] [PubMed] [Google Scholar]
- 39.Masckauchan TN, Agalliu D, Vorontchikhina M, Ahn A, Parmalee NL, Li CM, Khoo A, Tycko B, Brown AM, Kitajewski J. Wnt5a signaling induces proliferation and survival of endothelial cells in vitro and expression of MMP-1 and Tie-2. Mol Biol Cell. 2006;17:5163–5172. doi: 10.1091/mbc.E06-04-0320. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Masckauchan TN, Kitajewski J. Wnt/Frizzled signaling in the vasculature: new angiogenic factors in sight. Physiology (Bethesda) 2006;21:181–188. doi: 10.1152/physiol.00058.2005. [DOI] [PubMed] [Google Scholar]
- 41.Huang HC, Klein PS. Frizzled family: receptors for multiple signal transduction pathways. Genome Biol. 2004;5:234. doi: 10.1186/gb-2004-5-7-234. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Logan CY, Nusse R. The Wnt signaling pathway in development and disease. Annu Rev Cell Dev Biol. 2004;20:781–810. doi: 10.1146/annurev.cellbio.20.010403.113126. [DOI] [PubMed] [Google Scholar]
- 43.He X, Semenov M, Tamai K, Zeng X. LDL receptor-related proteins 5 and 6 in Wnt/beta-catenin signaling: arrows point the way. Development. 2004;131:1663–1677. doi: 10.1242/dev.01117. [DOI] [PubMed] [Google Scholar]
- 44.Hui CM, Cheung PY, Ling MT, Tsao SW, Wang X, Wong YC, Cheung AL. Id-1 promotes proliferation of p53-deficient esophageal cancer cells. Int J Cancer. 2006;119:508–514. doi: 10.1002/ijc.21874. [DOI] [PubMed] [Google Scholar]
- 45.Bae S, Bessho Y, Hojo M, Kageyama R. The bHLH gene Hes6, an inhibitor of Hes1, promotes neuronal differentiation. Development. 2000;127:2933–2943. doi: 10.1242/dev.127.13.2933. [DOI] [PubMed] [Google Scholar]
- 46.Ishiko E, Matsumura I, Ezoe S, Gale K, Ishiko J, Satoh Y, Tanaka H, Shibayama H, Mizuki M, Era T, Enver T, Kanakura Y. Notch signals inhibit the development of erythroid/megakaryocytic cells by suppressing GATA-1 activity through the induction of HES1. J Biol Chem. 2005;280:4929–4939. doi: 10.1074/jbc.M406788200. [DOI] [PubMed] [Google Scholar]
- 47.Kondo T, Ohta T, Igura K, Hara Y, Kaji K. Tea catechins inhibit angiogenesis in vitro, measured by human endothelial cell growth, migration and tube formation, through inhibition of VEGF receptor binding. Cancer Lett. 2002;180:139–144. doi: 10.1016/s0304-3835(02)00007-1. [DOI] [PubMed] [Google Scholar]
- 48.Rodriguez SK, Guo W, Liu L, Band MA, Paulson EK, Meydani M. Green tea catechin, epigallocatechin-3-gallate, inhibits vascular endothelial growth factor angiogenic signaling by disrupting the formation of a receptor complex. Int J Cancer. 2006;118:1635–1644. doi: 10.1002/ijc.21545. [DOI] [PubMed] [Google Scholar]
- 49.Tachibana H, Koga K, Fujimura Y, Yamada K. A receptor for green tea polyphenol EGCG. Nat Struct Mol Biol. 2004;11:380–381. doi: 10.1038/nsmb743. [DOI] [PubMed] [Google Scholar]
- 50.Haslam E. Natural polyphenols (vegetable tannins) as drugs: possible modes of action. J Nat Prod. 1996;59:205–215. doi: 10.1021/np960040+. [DOI] [PubMed] [Google Scholar]
- 51.Maeda-Yamamoto M, Kawahara H, Tahara N, Tsuji K, Hara Y, Isemura M. Effects of tea polyphenols on the invasion and matrix metalloproteinases activities of human fibrosarcoma HT1080 cells. J Agric Food Chem. 1999;47:2350–2354. doi: 10.1021/jf9811525. [DOI] [PubMed] [Google Scholar]
- 52.Osada R, Horiuchi A, Kikuchi N, Ohira S, Ota M, Katsuyama Y, Konishi I. Expression of semaphorins, vascular endothelial growth factor, and their common receptor neuropilins and alleic loss of semaphorin locus in epithelial ovarian neoplasms: increased ratio of vascular endothelial growth factor to semaphorin is a poor prognostic factor in ovarian carcinomas. Hum Pathol. 2006;37:1414–1425. doi: 10.1016/j.humpath.2006.04.031. [DOI] [PubMed] [Google Scholar]
- 53.Cai J, Jiang WG, Ahmed A, Boulton M. Vascular endothelial growth factor-induced endothelial cell proliferation is regulated by interaction between VEGFR-2, SH-PTP1 and eNOS. Microvasc Res. 2006;71:20–31. doi: 10.1016/j.mvr.2005.10.004. [DOI] [PubMed] [Google Scholar]
- 54.Millauer B, Wizigmann-Voos S, Schnurch H, Martinez R, Moller NP, Risau W, Ullrich A. High affinity VEGF binding and developmental expression suggest Flk-1 as a major regulator of vasculogenesis and angiogenesis. Cell. 1993;72:835–846. doi: 10.1016/0092-8674(93)90573-9. [DOI] [PubMed] [Google Scholar]
- 55.Okabe S, Fujimoto N, Sueoka N, Suganuma M, Fujiki H. Modulation of gene expression by (−)-epigallocatechin gallate in PC-9 cells using a cDNA expression array. Biol Pharm Bull. 2001;24:883–886. doi: 10.1248/bpb.24.883. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.



