Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2012 Jun 8.
Published in final edited form as: Cell Microbiol. 2009 Nov 4;12(4):473–488. doi: 10.1111/j.1462-5822.2009.01408.x

Aspergillus fumigatus MedA governs adherence, host cell interactions and virulence

Fabrice N Gravelat 1, Daniele E Ejzykowicz 2, Lisa Y Chiang 2, Josée C Chabot 1, Mirjam Urb 1, K Denyese Macdonald 1, Nadia al-Bader 1, Scott G Filler 2,3, Donald C Sheppard 1,*
PMCID: PMC3370655  NIHMSID: NIHMS185005  PMID: 19889083

Abstract

In medically important fungi, regulatory elements that control development and asexual reproduction often govern the expression of virulence traits. We therefore cloned the Aspergillus fumigatus developmental modifier MedA and characterized its role in conidiation, host cell interactions and virulence. As in the model organism Aspergillus nidulans, disruption of medA in A. fumigatus dramatically reduced conidiation. However, the conidiophore morphology was markedly different between the two species. Further, gene expression analysis suggested that MedA governs conidiation through different pathways in A. fumigatus compared to A. nidulans. The A. fumigatus ΔmedA strain was impaired in biofilm production and adherence to plastic, as well as adherence to pulmonary epithelial cells, endothelial cells and fibronectin in vitro. The ΔmedA strain also had reduced capacity to damage pulmonary epithelial cells, and stimulate pro-inflammatory cytokine mRNA and protein expression. Consistent with these results, the A. fumigatus ΔmedA strain also exhibited reduced virulence in both an invertebrate and a mammalian model of invasive aspergillosis. Collectively these results suggest that the downstream targets of A. fumigatus MedA mediate virulence, and may provide novel therapeutic targets for invasive aspergillosis.

Keywords: Aspergillus fumigatus, conidiation, adherence, biofilm, virulence

INTRODUCTION

In immunocompromised patients the filamentous fungus Aspergillus fumigatus causes rapidly progressive, invasive pulmonary disease that can disseminate via the bloodstream to the brain and other organs (Denning, 2000, Marr et al., 2002). However, the mechanisms underlying the pathogenesis of invasive aspergillosis (IA) remain poorly understood.

Aspergillus species have a complex life cycle with distinct developmental stages. Initially, airborne conidia are deposited on organic matter where they become metabolically active and germinate, producing filamentous hyphae which grow by apical extension. After a defined period of growth, hyphae become developmentally competent, and are able to initiate asexual sporulation or conidiation (Axelrod et al., 1973). The acquisition of developmental competence is associated with a coordinate change in gene expression of over 400 genes (Sheppard et al., 2005). Recent studies from our laboratory have found that after 24 hours of experimental infection, hyphae within lung tissue display a gene expression profile consistent with that of developmentally competent hyphae in vitro, suggesting that hyphae remain developmentally competent during infection (Gravelat et al., 2008).

In other pathogenic fungi, genes involved in the regulation of morphologic and sexual development often directly regulate the expression of key virulence factors (Lengeler et al., 2000, Sonneborn et al., 2000, Garcia-Sanchez et al., 2004, Fu et al., 2002, Bahn et al., 2001, Felk et al., 2002, Phan et al., 2000, Lo et al., 1997, Sanchez et al., 2004, Park et al., 2005). In A. fumigatus, transcription factors that govern development have also been observed to control expression of synthetic gene clusters responsible for secondary metabolite production (Sheppard et al., 2005), many of which have toxic or immunosuppressive effects on host cells (Cramer et al., 2006, Sugui et al., 2007, Spikes et al., 2008). Collectively, these findings suggest that, as in other fungi, developmental regulators may also govern the expression of virulence traits in A. fumigatus.

MedA is a developmentally regulated protein that was first identified in the related model organism Aspergillus nidulans, where it is expressed in competent hyphae (Clutterbuck, 1969). In A. nidulans, MedA was characterized as a temporal modifier of the expression of the core conidiation genes: brlA, abaA and wetA (Aguirre, 1993, Clutterbuck, 1969, Busby et al., 1996). The mechanism by which MedA modulates expression of these genes remains undefined. A. nidulans ΔmedA mutants manifest a delay in the production of phialides and a reduced number of conidia as well as an overproduction of primary sterigmata (metulae) in a branching pattern that produces medusoid-like conidiophores (Clutterbuck, 1969) The role of MedA in the development and virulence of A. fumigatus has not yet been studied.

To determine the function of A. fumigatus MedA in development and virulence, we disrupted A. fumigatus medA and analyzed the resulting phenotypes. The A. fumigatus ΔmedA mutant was impaired in conidiation and biofilm formation, as well as pulmonary epithelial cell adherence, damage and stimulation in vitro. Disruption of medA also attenuated virulence in an invertebrate and a mammalian model of invasive aspergillosis.

RESULTS

Identification of A. fumigatus medA

Homology comparisons identified the A. fumigatus Afu2g13260 gene product as sharing significant homology with A. nidulans MedA. This open reading frame is predicted to encode a 684 amino acid protein that is 75.7% identical to A. nidulans MedA. Alignment of the A. fumigatus medA gene product with other putative MedA proteins from Aspergillus clavatus NRRL1, Aspergillus terreus NIH2624, Aspergillus oryzae RIB 40, Fusarium oxysporum Me102010, Neosartorya fischeri NRRL 181 and Neurospora crassa OR74A revealed an area of 92% amino acid identity from amino acid position 431 to 533 (Supplementary Material, Figure S1). No conserved protein domains of predicted function were identified in this or other regions of A. fumigatus MedA.

MedA is required for normal A. fumigatus development

To evaluate the function of MedA in A. fumigatus, a ΔmedA mutant was constructed (method illustrated in Supplementary Material, Figure S2A). To verify that any observed phenotypes were due specifically to the deletion of medA, the ΔmedA mutant was complemented by reintroducing a wild-type allele of medA at its original locus (method illustrated in Supplementary Material, Figure S2B). Deletion and single copy reintegration of medA were confirmed by Southern blot analysis (Supplementary Material, Figure S2C). Interestingly, as we have observed with stuA and brlA (Sheppard et al., 2005, Twumasi-Boateng et al., 2009), the reintroduction of an intact allele of medA was associated with a consistently increased level of medA mRNA expression, despite the screening of multiple independent transformants (Figure 4), even though molecular analyses showed a correct reconstruction of the medA promoter.

Figure 4. Expression of the conidiation regulation core genes is not affected by medA deletion.

Figure 4

Open in a new tab

RNA was isolated at the indicated times during growth in RPMI medium. mRNA levels of medA, brlAαβ, brlAβ, abaA, wetA, and stuA, normalized to tef1, were analyzed by real-time RT-PCR. Graphs indicate mean +/− standard error (S.E.). Data comprise three independent experiments, each performed in duplicate.

Conidiation was dramatically affected by medA deletion (Figure 1). The ΔmedA mutant produced fewer conidia than did either the wild-type or medA-complemented strain. The initial production of conidiophores was not delayed, but the conidiophores remained poorly developed and produced relatively few conidia even after three weeks of incubation (Figure 2A). Interestingly, unlike the A. nidulans ΔmedA mutant, classic medusoid conidiophores with chaining sterigmata were not observed in the A. fumigatus ΔmedA (Figure 1). Exhaustive harvesting of A. fumigatus ΔmedA mutant recovered only ~2% of the conidia produced by either the wild-type or the medA-complemented strain (Figure 2A). Conidia produced by colonies of the ΔmedA mutant were morphologically normal, yet slightly larger than those of wild-type Af293 or medA-complemented strains (Figure 2B). Conidia of the ΔmedA mutant strain germinated slightly faster than those of other strains (Figure 2C) and remained bright green for a longer time, turning dark brown only after two weeks of growth (Figure 2D, 2E).

Figure 1. MedA is required for normal conidiophore morphology.

Figure 1

Open in a new tab

YPD agar was inoculated with conidia of A. nidulans FGSC A26 (A) and FGSC 586 (medA mutant) (B), A. fumigatus Af293 (C), the ΔmedA mutant (D) and medA-complemented strains (E), and grown for 2 days. Slide cultures were then imaged by scanning electronic microscopy. Magnifications were 2,000X (left column) and 800X (right column). Picture width represents respectively 20 μm and 50 μm.

Figure 2. MedA is required for the formation of normal conidia.

Figure 2

Open in a new tab

A. The A. fumigatus ΔmedA strain produced markedly less conidia than A. fumigatus Af293 and A. fumigatus medA-complemented strains, at all time points. Conidial production was determined as the total number of conidia available for harvesting on 10 cm diameter plates inoculated with YPD-agar and incubated for 1, 2 or 3 weeks at 37°C. Graphs indicate mean +/− standard error (S.E.). Data comprise three independent experiments for each time point.

B. The ΔmedA strain produced larger conidia. Relative size of conidia was determined by forward light scatter during flow cytometry. A total of 106 conidia of each strain were analyzed.

C. The ΔmedA mutant germinates slightly faster at 37°C. Germination of Af293, ΔmedA, and medA-complemented conidia was monitored hourly in YPD medium. For each time point, 100 cells were examined for each strain. Data are presented as the mean +/− standard deviation (S.D.) of three independent experiments.

D, E. Colonial morphology of the ΔmedA mutant strain. Strains were incubated on YPD agar for 7 (A) and 14 days (B) at 37°C. Conidia of the ΔmedA mutant strain displayed delayed development of brown pigmentation as compared to the wild-type A. fumigatus Af293 and A. fumigatus medA-complemented strains.

F. Real-time RT-PCR analysis of conidial pigmentation gene expression. After 48 hours of growth, the ΔmedA mutant strain exhibited modestly reduced levels of mRNA expression of the conidial pigment biosynthesis cluster than did A. fumigatus Af293 and A. fumigatus medA-complemented strains. Graphs indicate mean +/− standard error (S.E.). Data comprise three independent experiments for each time point.

To examine these differences in conidia pigmentation, we used real-time RT-PCR to analyze the expression of the 6-gene cluster which mediates conidial pigmentation and DHN-melanin synthesis (Tsai et al., 1999, Tsai et al., 2001). Consistent with the delay in conidial pigment development, expression of these genes in the ΔmedA mutant strain was modestly reduced as compared with the expression in the wild-type and medA-complemented strain after 48 hours of growth (Figure 2F).

Finally, similar hyphal growth rates were observed for the wild-type, ΔmedA mutant and medA-complemented A. fumigatus strains grown in both liquid and solid media (Figure 3). Similarly, no difference in the time to acquisition of developmental competence was observed between the three strains (data not shown).

Figure 3. Mycelial growth rate is unaffected by deletion of medA.

Figure 3

Open in a new tab

No significant difference in growth between A. fumigatus strains was showed. Mycelium growth was assessed as following:

A. Radial growth rate on YPD-agar plate. Plates were incubated at 37°C for 3 days. Graphs indicate mean +/− standard error (S.E.). Data comprise five independent experiments, each performed in triplicate.

B. Dry weight of 16h and 24h cultures in grown in liquid YPD. Graphs indicate mean +/− standard error (S.E.). Data comprise three independent experiments for each time point.

MedA is not required for expression of the core conidiation pathway genes

In A. nidulans, the normal expression of the core conidiation pathway genes (brlA, wetA and abaA) is dependent on MedA (Aguirre, 1993, Busby et al., 1996). We therefore compared the expression of these genes in the A. fumigatus ΔmedA mutant, wild-type and medA complemented strain using real-time RT-PCR. In the wild-type and medA-complemented strains, medA expression increased shortly after germination and remained relatively constant throughout 5 days of hyphal growth. As expected, stuA expression was similar between strains, indicating that overall spatial regulation of development was similar between the three strains. Interestingly, brlAα, brlAβ, abaA and wetA mRNA levels in the ΔmedA strain were similar to those in the wild-type and medA complemented strains (Figure 4). These data, combined with the differences in conidiophore morphology, suggest that A. fumigatus MedA likely governs the expression of different target genes than does its A. nidulans ortholog.

MedA mediates biofilm formation and adherence to host constituents in vitro

During expression profiling, we observed that hyphae of the ΔmedA mutant were less adherent to the walls of glass flasks grown in shaking culture (Figure 5A). To test if this observation correlated with impaired biofilm formation, we evaluated the effects of medA deletion on adherence to plastic and formation of biofilms. Germlings of the ΔmedA strain showed a 35% reduction in adherence to tissue culture treated polystyrene plates as compared to germlings of the wild-type A. fumigatus and of the medA-complemented strains (data not shown). To test if this defect in germling adherence to polystyrene would result in impaired biofilm formation by mature hyphae, wild-type A. fumigatus, the ΔmedA mutant and medA-complemented strains were grown in static culture for 24 hours, washed, and then stained with crystal violet to quantify the biofilm density. Mature hyphae of the ΔmedA mutant strain were markedly attenuated in biofilm formation (Figure 5B, D). Similarly, although wild-type A. nidulans was much less adherent to plastics and formed less extensive biofilms than did wild-type A. fumigatus, the loss of MedA was associated with a marked reduction in biofilm formation (Figure 5C). Collectively, these results suggest that MedA governs adherence to plastic and biofilm formation in both species of Aspergillus.

Figure 5. MedA governs biofilm formation and adherence.

Figure 5

Open in a new tab

A. Adherence of hyphae of A. fumigatus Af293, ΔmedA mutant and medA-complemented strains to glass. Photographs were taken of 24 h cultures of the indicated strains grown in RPMI 1640 medium at 37°C on an orbital shaker.

B. Biofilm density of A. fumigatus strains. Biofilm density in tissue culture treated 96-well polystyrene plates were inoculated with 105 conidia per mL in Sabouraud broth in tissue culture treated polystyrene 96 well plates, grown for 24h, washed and then stained with crystal violet.

C. Biofilm density of A. nidulans strains as above but using an inoculum of 106 conidia per mL.

D. Photomicrographs of biofilm formation by the wild-type strain Af293, the ΔmedA mutant and the medA-complemented strain at 24h. Cultures were grown as in 2B. Arrowed bars on photomicrographs represent 1 mm.

E. Adherence of germlings of the indicated A. fumigatus strains to A549 pulmonary epithelial cells, human umbilical cord vein endothelial cells and fibronectin coated wells.

All results indicate the mean +/− S.E. All experiments were performed in triplicate on three separate occasions. For all panels, * indicates significantly reduced adherence of the medA mutant as compared to Af293 and medA-complemented strains, p<0.05 by factor ANOVA.

Given the reduced adherence of the ΔmedA mutant to inorganic substrates, we hypothesized that MedA might mediate adherence to, and interactions with host constituents. We therefore tested the effects of medA deletion on the adherence of A. fumigatus to pulmonary epithelial cells and endothelial cells, two cell types to which A. fumigatus adheres to during pulmonary infection. In addition, we tested adherence to the macromolecular substrate, fibronectin, a major component of basal lamina that is exposed when A. fumigatus damages epithelial or endothelial cells (Bouchara et al., 1997, Warwas et al., 2007). Consistent with our observations on inorganic substrates, germlings of the ΔmedA mutant adhered remarkably less to pulmonary A549 cells, vascular endothelial cells, and fibronectin coated culture plates than did the wild-type or medA-complemented strain (Figure 5E). Collectively, these data suggest that MedA governs adherence to a wide variety of host substrates.

MedA is required for expression of Afu3g00880, a putative adhesin

The adhesins that mediate A. fumigatus adherence to host cells remain largely unknown. Recently however, a bioinformatic analysis of the A. fumigatus genome was used to develop a list of putative A. fumigatus adhesins (Upadhyay et al., 2009). One of these candidate proteins was subsequently validated experimentally to be an adhesin. Therefore, to identify possible effectors for the reduced adherence of the ΔmedA mutant, we performed expression analysis of a group of these candidate A. fumigatus adhesins. We used real-time RT-PCR to analyse the expression of all these genes with a Pad value (probability of being adhesin) above 0.96. Only one of the 8 genes studied, Afu3g00880, exhibited reduced expression in the ΔmedA mutant strain as compared with the wild-type and medA complemented strain (Figure 6). Interestingly, Afu3g00880 was the gene with the highest reported Pad value in the previous study. This novel protein contains a GPI-anchorage sequence, as well as a conserved Drmip-Hesp c domain (Drmip-Hesp = Developmentally Regulated MAPK Interacting Protein - Haustorially Expressed Secreted Protein) (Szeto et al., 2007). This domain was characterized in a family of proteins expressed in fruiting body formation of the basidiomycet Lentinula edodes and in plant cell invasion by the haustorium of flax rust, Melampsora lini (Szeto et al., 2007). To date, this protein has not been studied in A. fumigatus.

Figure 6. Expression of the putative adhesion Afu3g00880 is reduced in the absence of MedA.

Figure 6

Open in a new tab

RNA was isolated at 16h during growth in YPD broth, and the mRNA expression of 8 putative adhesins was analyzed by real-time RT-PCR. For comparison, results were normalized to tef1, and to the most highly expressed candidate adhesin, Afu3g00880. Graphs indicate mean +/− standard error (S.E.). Data comprise four independent experiments, each performed in duplicate.

MedA mediates epithelial cell damage and stimulation

Pulmonary epithelial cells are the first cell type encountered by A. fumigatus during infection (Wasylnka et al., 2003, Wasylnka et al., 2002, Wasylnka et al., 2005). We therefore examined the role of MedA in governing A. fumigatus-epithelial cell interactions. Because epithelial cell invasion and damage occur following adherence of A. fumigatus to epithelial cells, we first measured the effects of medA deletion on A. fumigatus-induced epithelial cell damage. At 16 hours of infection, growth of all three strains on A549 cell monolayers was indistinguishable, though less extensive than when strains were grown in the absence of A549 cells (Supplemental Material, Figure S3). At this time point the ΔmedA mutant induced significantly less epithelial cell damage than either the wild-type or medA-complemented strain (Figure 7A), despite having grown to a similar extent.

Figure 7. MedA is required for normal interactions with pulmonary epithelial cells.

Figure 7

Open in a new tab

A. A549 lung epithelial cell damage by A. fumigatus strains after 16 h as measured by chromium release. Results are expressed as percentage damage induced by wild-type Af293.

B. Stimulation of A549 epithelial cells by A. fumigatus strains after 24 h. Graph indicate the relative mRNA levels of IL-8, CCL20, and TNF-alpha as determined by real-time RT PCR. Results are expressed relative to the level of expression induced by the wild-type strain Af293.

C. Quantification of IL-8 protein levels by ELISA in culture supernatants of A549 epithelial cells infected with different fungal strains for 24 h.

All results indicate the mean +/− S.E. All experiments were performed in triplicate on three separate occasions. For all panels, * indicates significantly reduced epithelial cell response to the ΔmedA mutant as compared to Af293 and medA-complemented strains, p<0.05 by factor ANOVA.

Pulmonary epithelial cells respond to A. fumigatus invasion by the production of pro-inflammatory cytokines including IL-8, TNF, and CCL-20 (K. Denyese McDonald, unpublished data). We therefore used real-time RT-PCR to determine the effects of medA deletion on the expression of these genes. Infection of A549 cells with the ΔmedA mutant resulted in significantly lower induction of IL-8 and CCL20 mRNA as compared with either the wild-type or medA-complemented strain (Figure 7B). TNF-α mRNA levels also trended lower in cells infected with the ΔmedA mutant, but this difference was not statistically significant (Figure 7B). To confirm these results, we determined IL-8 protein levels in culture supernatants of infected A549 cells. Consistent with the results of our real-time RT-PCR experiments, IL-8 production was significantly lower in epithelial cells infected with the ΔmedA mutant as compared with either wild-type A. fumigatus or the medA-complemented strain (Figure 7C). Collectively these results suggest that factors under the control of MedA govern interactions of A. fumigatus with pulmonary epithelial cells.

MedA is required for normal virulence in an insect and a murine model of invasive aspergillosis

The differences in epithelial cell interactions observed with the ΔmedA mutant suggested the possibility that MedA may mediate A. fumigatus virulence. To test this hypothesis we compared the virulence of the wild-type A. fumigatus, the ΔmedA mutant and the medA-complemented strain in both an invertebrate (Galleria mellonella) and a murine model of invasive aspergillosis.

G. mellonella larvae (waxworms) infected with the ΔmedA mutant survived significantly longer than those infected with either the wild-type A. fumigatus or the medA-complemented strain (Figure 8A; median survival 88 h vs 36 h). Corticosteroid-treated mice that were infected by inhalation with conidia of the ΔmedA mutant also survived longer than mice infected with Af293 and the medA complemented strain, although this difference was more modest (Figure 8B). To further evaluate the effect of MedA on virulence in corticosteroid treated mice, total fungal burden in infected lungs was measured by determining the galactomannan (GM) content of pulmonary homogenates. The galactomannan content in the lungs infected with the various A. fumigatus strains was inversely proportional to the survival of these mice. The pulmonary GM content of mice infected with the ΔmedA mutant was significantly lower than that of mice infected with either the wild-type or medA-complemented strain (Figure 8C). In addition, total lung myeloperoxidase (MPO), a constitutive product of neutrophils and macrophages, was measured to evaluate the accumulation of phagocytes within pulmonary tissue. Total pulmonary MPO content mirrored the pulmonary GM content, with a trend to lower pulmonary MPO levels measured in mice infected with the ΔmedA mutant as compared with the wild-type or medA-complemented strains (Figure 8D), although these results were not statistically significant. Collectively, these data suggest an important role for A. fumigatus MedA in the pathogenesis of invasive aspergillosis.

Figure 8. MedA is required for normal virulence.

Figure 8

Open in a new tab

A. Survival of G. mellonella larvae infected with different A. fumigatus strains. *, indicates significantly increased survival of larvae infected with the ΔmedA mutant compared with the wild-type and medA-complemented strain, p < 0.005 by the log rank test, n =39 worms per fungal strain distributed on 3 separate experiments.

B. Survival of cortisone acetate-treated mice infected with A. fumigatus strains. *, indicates significantly increased survival mice infected with of the ΔmedA mutant compared with those infected with the wild-type and the medA-complemented strain, p = 0.037 and < 0.001 respectively by the log rank test, n = 16 mice per fungal strain distributed on 2 separate experiments.

C. Quantification of galactomannan (GM) in lung homogenates of mice after 4 days of infection. Results are mean +/− SEM of 8 mice per strain. *, indicates a significantly reduced GM in lungs of mice infected with the ΔmedA mutant compared with those infected with the wild-type and the medA-complemented strain, p = 0.015 and 0.004 by the Wilcoxon sum test.

D. Quantification of myeloperoxidase (MPO) in lung homogenates of mice after 4 days of infection. Results are mean +/− SEM of 8 mice per strain. §, indicates reduced MPO in lungs of mice infected with the ΔmedA mutant compared with those infected with the wild-type and the medA-complemented strain, p = 0.115 and 0.016 respectively, in a Wilcoxon sum test.

DISCUSSION

Disruption of medA in A. fumigatus resulted in a markedly different phenotype from that seen in A. nidulans. The A. fumigatus ΔmedA mutant produced conidiophores with impaired phialide and conidia production that more closely resembled the stunted phenotype seen with deletion of the developmental modifier stuA (Sheppard et al., 2005). In contrast, A. nidulans ΔmedA mutants exhibit a medusoid phenotype resulting from a proliferation of branching chains of primary sterigmata (metulae), in addition to delayed phialide and conidia production (Clutterbuck, 1969, Aguirre, 1993). One possible explanation for this observation is that A. fumigatus produces uniseriate conidiophores which lack metulae, while those of A. nidulans are biseriate (Adams et al., 1998, Latge, 1999). These observations suggest that MedA exerts specific effects on the metulae of A. nidulans to produce the medusoid phenotype, and the lack of this cell type in A. fumigatus results in a simple delay of phialide and conidia production. Indeed, the reduction in conidia production reported for the A. nidulans ΔmedA mutant (Busby et al., 1996) was very similar to our findings for the A. fumigatus ΔmedA mutant (99% vs. 98% decrease, respectively).

These differences between A. nidulans and A. fumigatus also extended to the molecular level. In A. nidulans, MedA mediates complex effects on expression of other genes of the core developmental pathway. Early in development A. nidulans MedA is believed to repress both blrAα and brlAβ transcripts, while later in development it downregulates brlAβ only. Further, A. nidulans MedA functions as a coactivator of abaA expression. We found that in A. fumigatus, medA deletion had no significant effects on mRNA levels of either brlA, or abaA. One possible explanation for these findings is that the effects of A. nidulans MedA on conidiation gene expression are confined to the metulae, and hence are not detected in the uniseriate A. fumigatus. Alternately, other MedA independent regulatory mechanisms may govern the expression of brlA and other conidiation genes in A. fumigatus. Support for this hypothesis comes from a comparison of FluG regulation of brlA expression and conidiation in A. fumigatus (Yu et al., 2006, Mah et al., 2006). In study by Mah et al., deletion of A. nidulans fluG abrogated conidiation and brlA expression, whereas deletion of A. fumigatus fluG had minimal effect on conidiation and only modestly reduced brlA expression. Thus, these prior results and the findings in the current study suggest that other unknown pathways govern brlA expression and conidiation in A. fumigatus.

A. fumigatus mutants deficient in MedA were impaired in biofilm formation on glass and plastic, as well as in adherence to pulmonary epithelial cells, vascular endothelial cells, and fibronectin. During infection with other fungi such as C. albicans, adherence to plastic and biofilm formation is an important virulence factor, because it enables the organism to colonize intravascular catheters and resist host and antimicrobial killing (Nobile et al., 2006). The role of biofilm formation in A. fumigatus infection is not well defined, as colonization of foreign bodies and intravascular catheters is rarely seen during invasive aspergillosis (Beauvais et al., 2007). However, biofilm formation may be relevant in chronic colonization with A. fumigatus, in which patients with abnormal airways due to diseases such as cystic fibrosis become infected with A. fumigatus. Although this mold grows only within the airway lumen (Shoseyov et al., 2006), airway colonization is associated with worsening lung function and increased rates of hospitalization (Kraemer et al., 2006). Complex multi-organism biofilms containing A. fumigatus and other pathogens such as Pseudomonas spp. are thought to play an important role in this disease state (Murray et al., 2007), It has been suggested that A. fumigatus biofilm formation may also contribute to the formation of this microbial community (Seidler et al., 2008). However, at the present time there is no animal model of chronic lung disease with A. fumigatus with which to test this hypothesis.

The molecular mechanism whereby MedA enhances A. fumigatus adherence remains undefined. Fungal adherence and biofilm formation has been best studied in the pathogenic yeast C. albicans (Sundstrom, 2002). In C. albicans, adherence to a variety of host substrates is mediated by GPI anchored cell wall proteins, including Hwp1 and members of the agglutin like sequence (Als) family (Fu et al., 1998, Staab et al., 1998). No ortholog of these proteins exist in A. fumigatus, although it is possible that other cell wall proteins may serve the same function. While it is possible that MedA directly interacts with substrates to mediate adherence, the absence of a membrane or cell wall anchor sequence, and lack of homology with any known adhesin proteins makes this possibility unlikely. It is more plausible that MedA serves as a regulatory protein that controls the expression of downstream adhesin genes. In C. albicans, a similar function has been identified for the transcription factor Bcr1p, a regulator of adhesin expression and biofilm production (Nobile et al., 2005, Nobile et al., 2006) In support of this hypothesis, the preliminary expression analyses of putative A. fumigatus adhesins found decreased expression of Afu3g00880, which is predicted to encode a GPI anchored protein. However, the function of this protein in adherence remains to be proven, and it is possible that other factors, such as cell wall carbohydrates, could play a role in MedA-dependent adherence.

MedA-deficient mutants displayed multiple abnormalities upon interaction with pulmonary epithelial cells including decreased adherence, damage and stimulation of cytokine production. It is likely that the differences in epithelial cell damage and stimulation are secondary to decreased hyphal adherence, and subsequent invasion of the pulmonary epithelial cells. In this study, we have observed a reduction in adherence of the ΔmedA mutant to both pulmonary epithelial cells and human umbilical vein endothelial cells. This decrease in host cell adherence, and subsequent damage may explain the impaired virulence of the ΔmedA mutant seen in both the Galleria mellonella and corticosteroid mouse model of invasive aspergillosis (IA). Although the difference in virulence in the murine model of IA was modest, the lungs of the ΔmedA mutant infected mice had a reduction in fungal burden and inflammatory cells. Indeed, the fact that the ΔmedA mutant was not completely avirulent may reflect the residual adherence of this strain to host cells. If this model is correct, then identification and disruption of the adhesins responsible for the remaining adherence of the ΔmedA mutant may further attenuate virulence. It is also possible, though less likely, that other MedA-dependent factors are responsible for mediating the reduced virulence of this strain. Conidia of the ΔmedA mutant displayed alterations in pigmentation, a phenotype that has been linked to virulence previously (Tsai et al., 1998, Tsai et al., 1999). However, we observed that swollen conidia of the ΔmedA mutant, which do not contain pigment were even less virulent in Galleria than were quiescent conidia (data not shown). These results suggest that the virulence factors governed by MedA are independent of pigmentation and are operative after conidia exit from dormancy.

In this work, we have demonstrated that medA expression is necessary for normal conidiation in A. fumigatus and its gene product is functionally distinct from A. nidulans MedA. A. fumigatus MedA is required for adherence to inorganic substrates as well as for maximal pulmonary epithelial cell adherence, stimulation and damage. Moreover, we have found that MedA is required for normal virulence in an invertebrate and in a murine model of invasive aspergillosis. Identification of the MedA-dependent factors mediating these interactions will likely provide further insights into the pathogenesis of IA and may provide the basis for future therapeutic approaches in this disease.

EXPERIMENTAL PROCEDURES

Fungal strains and growth conditions

A. fumigatus strain Af293, (a generous gift from P. Magee, University of Minnesota, St. Paul, MN) was used for all molecular manipulations. Except where indicated, strains were propagated on YPD agar (1% yeast extract, 2% peptone, 2% glucose, solidified with 1.5% agar) and at 37°C while exposed to light. Alternative solid medium was Aspergillus Minimum Medium (Asp-MM) (Cove, 1966). A. nidulans strains (obtained from the Fungal Genetics Stock Center) (McCluskey, 2003) were propagated on YPD agar enriched with 50 μg biotin / mL. Strains were FGSC A26 (biA1) and FGSC A586 (medA15 biA1).

Tissue culture

The type II pneumocyte cell line CCL-185 (lung epithelial cells A549) was obtained from the American Type Culture Collection and grown in DF12K medium containing 10% fetal bovine serum, streptomycin (100 mg/liter) and penicillin (16 mg/liter) (Wisent, Canada). The endothelial cells were isolated from human umbilical cord veins by the method of Jaffe et. al. (Jaffe et al., 1973), and cultured in M-199 medium (Gibco/Invitrogen, Carlsbad, CA) supplemented with 10% fetal bovine serum and 10% defined bovine calf serum (both from Gemini Bio-Products, Inc., West Sacramento, CA), and containing 2 mM L-glutamine with penicillin and streptomycin (Irvine Scientific, Santa Ana, CA). Endothelial cells were used in the experiments after the second or third passage.

Nucleic and proteic sequences comparison

All A. fumigatus genomic sequences were obtained from the TIGR A. fumigatus genome project (http://www.tigr.org/tdb/e2k1/afu1/). Other sequences were obtained from the National Center for Biology Information (http://www.ncbi.nlm.nih.gov). Comparison and alignment of nucleic and proteic sequences were performed with the DNAMAN software (Lynnon Biosoft, Quebec, Canada).

Molecular Genetic Manipulations

Nucleic acid extraction

Total A. fumigatus RNA and DNA were isolated as previously described (Monroy et al., 2005). Briefly, mycelium grown in liquid MOPS buffered RPMI 1640 medium or in YPD broth were ground under liquid nitrogen and the resulting powder was processed for either RNA or DNA extraction. RNA was extracted using the QIAGEN - RNeasy Plant Mini Kit® following the manufacturer instructions (QIAGEN, Mississauga, Canada). DNA was extracted after resuspension of hyphal powder in lysis buffer (0.7 M NaCl, 0.1 M Na2(SO3), 0.05 M EDTA, 1% SDS, 0.1 M Tris-HCl pH 7.5) followed by phenol chloroform purification and ethanol precipitation.

Real-Time RT-PCR

expression of the genes of interest was quantified by real-time RT-PCR analysis as previously described (Gravelat et al., 2008). The primers used for each gene are shown in Table 1. First strand synthesis was performed from total RNA with M-MLV Reverse Transcriptase (Invitrogen, Burlington, Canada) using random primers. Real-time PCR was then performed using an ABI 7000 thermocycler (Applied Biosystems, Streetsville, Canada), and amplification products were detected with SYBR Green Quantitect System® (QIAGEN) for fungal gene expression or with Taqman® System (Roche, Laval, Canada) for human gene expression. Fungal gene expression was normalized to A. fumigatus TEF1 expression, and relative expression was estimated using the formula 2−ΔΔCt, where ΔΔCt = [(Cttarget gene)sample − (CtTEF1)sample] / [(Cttarget gene)reference − (CtTEF1)reference]. Human gene expression was normalized to 18s rRNA expression. To verify the absence of genomic DNA contamination, negative controls were used for each gene set in which reverse transcriptase was omitted from the mix.

Table 1.

PCR primers used in this study

Primer name Target gene Sequence 5′ – 3′
M1 medA AGGACCCTTGTACCACAACTAC
M2 medA TCCTGTGTGAAATTGTTATCCGCTCCATAGGTGGAATAGGAAGCA
M3 medA CGTTACCCAACTTAATCGCCTTGTATTCATTACCCGACCCTTCC
M4 medA CGAAACGACGTAGATGAAAGA
HY hph GGATGCCTCCGCTCGAAGTA
YG hph CGTTGCAAGACCTGCCTGAA
Phleo sense ble GTTTTCCCAGTCACGACGTT
Phleo antisense ble TTTCACACAGGAAACAGCTATGAC
TEF1RT sense TEF1 CCATGTGTGTCGAGTCCTTC
TEF1RT antisense TEF1 GAACGTACAGCAACAGTCTGG
Med-RT sense medA CGAAACATTGAAAAGGATGTG
Med-RT antisense medA CTGAGGGAAATCTGAAGGAAG
Stu-RT sense stuA GAGGACGAAGGGAGTCTCTG
Stu-RT antisense stuA ACCGTTGATCATGTGGTTGT
Brl-RT sense brlAαβ CCATTACACCAAGACCCACA
Brl-RT antisense brlAαβ CCGATAGTCCGGGTTGTAGT
Brl-beta-RT sense brlAβ ACGCGACTCTTTTCGACTCTT
Brl-beta-RT antisense brlAβ GACGTGACTCGCTTTCACCT
Aba-RT sense abaA CACTATGTGCCCTCTCAGCA
Aba-RT antisense abaA GCTATTTCCGATTTCGTCCA
Wet-RT sense wetA CCTCCTACTTCACATCCTGTCC
Wet-RT antisense wetA AGAGCACTTTTGGTGGATTTGT
Alb1-RT sense alb1 TCACAAGGTCAATGGAGTGG
Alb1-RT antisense alb1 GCCCTGGTACTCTGGTTTGT
Ayg1-RT sense ayg1 GATCCTTGGAGACAAGTTCGATA
Ayg1-RT antisense ayg1 CGGCGTCGTTGATGTTTT
Arp1-RT sense arp1 GGTCGAAAAGAAGCCCAATC
Arp1-RT antisense arp1 GTCCGATCTGCCTGTAGTCC
Arp2-RT sense arp2 ACATCGAGTCGCTCATCCA
Arp2-RT antisense arp2 TTGAACACCTCGTTGAAGTCC
Abr1-RT sense abr1 GGCTACTTCGATGGCTACTTTG
Abr1-RT antisense abr1 TTCGATATGGCAGTGGATGA
Abr2-RT sense abr2 GAAGGCAATGGAGGAGACC
Abr2-RT antisense abr2 GAGCTGTTGAGGATAGCCAGTT
Open in a new tab

Disruption of medA

A. fumigatus transformation has been described to generate a high proportion of non-homologous recombinants (Brakhage et al., 2002). To overcome this difficulty we used a split marker approach as described previously (Sheppard et al., 2005). Briefly, PCR was used to construct two DNA fragments, each containing 2 kb of medA flanking sequence fused to an incomplete fragment of the dominant selection marker HYG (hph encoding hygromycin phosphotransferase). The upstream and downstream flanking sequences were first amplified using primers M1-M2, and M3-M4 respectively (Table 1). Next hybrid PCR was used to fuse these flanking sequences to the appropriate HYG fragment (Supplementary Material S2A, Table 1). Protoplasts of strain Af293 were then transformed with 5 μg of each fragment (Twumasi-Boateng et al., 2009). Complete deletion of the medA open reading frame was confirmed by PCR using primers M1, M4, M-RT sense and M-RT antisense (Table 1, data not shown), by real-time RT-PCR to ensure a complete absence of medA mRNA using primers M-RT sense and M-RT antisense (Table 1, Figure 4), and by Southern-blotting. For Southern blot, a 600 bp probe was generated by BamHI digestion of the medA ORF and biotin labeled with Biotin DecaLabel DNA Labelling kit, accordingly to manufacturer instructions (Fermentas, Burlington, ON, Canada). Fungal strain DNAs were digested for 16h by ApaI, separated in agarose gel, transferred to nitrocellulose membrane, and target DNA/probe hybrids were detected using Biotin Chromogenic Detection kit, accordingly to manufacturer instructions (Fermentas).

Construction of the medA-complemented strain (Supplementary Material S2B)

To complement the medA mutation, a wild-type copy of medA was reintroduced into the ΔmedA mutant. To ensure the upstream sequences governing medA expression were intact, and to avoid positional effects, the complementing allele of medA was reintroduced at its native locus. Briefly, a 3 kb BsrG1-SpeI DNA fragment containing the partial medA promoter, medA ORF, and medA terminator was cloned into the phleomycin resistance (ble cassette) plasmid p402. Next, a 5.8 kb PciI- BglII fragment containing the medA product and the ble resistance cassete was subcloned into the hygromycin resistance plasmid pAN7.1. The resulting plasmid was then linearized at the unique SpeI site located between hph cassette and medA partial promoter. Protoplasts of the ΔmedA mutant were transformed with 10 μg of this linear construct. Transformants were selected on 0.038% phleomycin enriched plates. Transformants were tested by PCR and by Southern blotting to ensure correct re-integration of medA at its native locus, and medA expression was verified real-time RT-PCR using primers M-RT sense and M-RT antisense (Table 1) to ensure recovery of medA mRNA production.

Slide culture technique – Scanning electronic microscopy

A. fumigatus conidia were grown on for 48 h on inverted cell-culture treated cover slips (Fisher) placed on top of YPD agar blocks. Specimens were fixed overnight at 4°C with 2.5% glutaraldehyde in 0.1M sodium cacodylate buffer. They were then washed three times with sterile distilled H2O and dehydrated with increasing concentrations of ethanol (30%, 50%, 70%, 80%, 90%, 95%, 100%) for 15 min each, followed by critical point drying with liquid CO2 (Ladd Research SPDryer, Williston, VT, USA). The dried cover slips were mounted on platforms with double sticky tape and coated with gold for 3 min in a Sputter coater Hummer VI before viewing with a Hitachi S-3000N scanning electron microscope.

Determination of fungal growth rates

Hyphal growth was compared by measuring the radial growth rate on YPD plates and dry weight determination of submerged cultures. For radial growth experiments, YPD plates were inoculated with 105 conidia and colony diameter measured twice daily for three days. Dry weight was determined as follow: 200 mL of YPD broth was inoculated with 108 conidia and incubated in shaking culture at 37°C for 16 and 24h. Mycelia were collected by filtration, killed by flash freezing with liquid nitrogen for 10-20 sec, and allowed to dry over-night at 60°C. All assays were performed in triplicate on at least three occasions.

Conidia phenotypes

To determine the quantitative conidial yield, conidia were exhaustively harvested from 6 day old solid growth medium plates incubated at 37°C while exposed to light. All strains displayed a similar degree of radial growth. Ten milliliters of PBS-T (0.8% NaCl, 0.02% KCl, 0.144% Na2HPO4, 0.024% KH2PO4, 0.1% Tween 80, pH adjusted to 7.0) were used to extensively rinse the surface of the mycelium until the resulting wash was visually clear (a minimum of 5 washes). Washes were pooled and the conidia were concentrated by centrifugation, and enumerated using a phase hemacytometer (Hausser)

The relative size of conidia was determined by flow cytometry. A 106 conidia were fixed in 3% formaldhehyde for 1h, washed with PBS-T, and resuspended in 300 μL PBS-T for analysis with a 15 milliwatt 488 nM argon ion laser FACScan analyzer (Becton Dickinson). Germination rate was assessed by incubation at 37°C of 1×105 conidia of the strain of interest in 5 mL of liquid YPD medium in 6 well-plates. Every hour, 100 fungal progulates were counted under microscope, and were considered as germinated when germ tube reached half the size of the conidium it grew from.

Adherence assays

The capacity of the various strains of A. fumigatus to adhere to epithelial cells, plastic, and endothelial cells was analyzed using a modification of our previously described method (Sheppard et al., 2004b). Germlings of the strain of interest were prepared by growing 1×104 conidia / mL of Sabouraud broth at 37°C for 8 hours. For epithelial and endothelial cells, adherence of germlings was determined using 6-well tissue culture plates containing confluent cells. For adherence to fibronection, wells were coated with fibronectin (Becton-Dickinson, Franklin Lakes, NJ, USA) 0.01 mg/mL in PBS (without Ca/Mg), 1 mL each well, incubated at 37°C for at least 4 hours, and rinse with PBS. For all substrates, each well was incubated with 1.5 × 102 hyphae in HBSS/Tween 20 0.01% at 37°C for 30 min. Afterward, the wells were washed three times with HBSS to remove non-adherent fungi, and then overlaid with Sabouraud dextrose agar. The number of adherent organisms was quantified by colony counting. Adherence was determined as the percentage of colonies related to the initial inoculum. The adherence assays were performed in triplicate on at least three separate occasions.

Biofilm quantification

Biofilm studies were based on methods described and developed by E. Mowat et al. (Mowat et al., 2007). Briefly, 96 well plates were inoculated with 100μL per well of Sabouraud broth containing the indicated concentration of conidia. After a 24h incubation at 37°C, the spent culture medium was removed from each well and the adherent cells were washed three times with PBS. Biofilm density was estimated by staining the residual material with 150 μl of 0.5 % (w/v) crystal violet solution for 5 min. Excess stain was gently removed under running water. The biofilms were then destained by adding 200 μl of 95 % ethanol to each well. The density of the biofilm was estimated by determining the absorbance of the destaining solution at 570 nm. In addition, unstained biofilms were also observed under phase contrast microscopy and digital images were obtained. To assay adherence to non-tissue culture treated polystyrene plates, wells of 6 well suspension cell culture plates were inoculated with 104 to 106 conidia in 1 mL of Sabouraud broth. After incubation 24h at 37°C or 48h at 30°C, plates were washed and stained as described above. Assays were performed in 6 independent wells on at least three separate days.

Epithelial cell stimulation

A549 pulmonary epithelial cells were grown in 6-well culture plates to 80% confluency (about 7×105 cells per well of a 6 well plate). Monolayers were infected with 5 × 105 conidia of the appropriate fungal strain in 4 mL of F12K medium (HyClone, Canada) containing and incubated at 37°C 5% CO2 for 24h. The conditioned medium above the cells was then collected, filter sterilized, and stored at −80°C for cytokine assays. Epithelial cell RNA was harvested using TRIzol (Gibco-Invitrogen, Burlington, Canada), followed by phenol chloroform extraction and ethanol precipitation. Cytokine mRNA levels were analyzed by real-time RT-PCR as described above. To confirm the results of the gene expression studies, the IL-8 content of culture supernatants was determined by solid phase sandwich EIA (Biosource-Medicorp, Quebec, Canada) according to the manufacturer's instructions.

Epithelial cell damage assay

The extent of damage to epithelial cells caused by the various strains of A. fumigatus was determined using a minor modification of our previously described method (Bezerra et al., 2004). Briefly, A549 cells were loaded with chromium by incubating monolayers grown in 24-well tissue culture plates with 3 μCi of 51Cr at 37°C in 5% CO2 for 24 hours. Excess chromium was removed by washing with HBSS. The labeled A549 cells were then infected with 5×105 conidia in 1 ml serum free DF12K medium. After a 16 h incubation, the medium above the cells was retrieved. The cells were then lysed with 6N NaOH and the lysate collected. The 51Cr content of the medium and lysates was then measured in a gamma counter and the degree of epithelial cell damage was calculated. . All results were corrected for spontaneous chromium release by uninfected epithelial cells.

Virulence studies

The virulence of the ΔmedA mutant was compared with that of the wild-type strain Af293 and medA-complemented strain in two models of invasive aspergillosis: G. mellonella larvae (waxworms) (Renwick et al., 2006, Kavanagh et al., 2004) and cortisone acetate-treated mice (Spikes et al., 2008).

Waxworm model of invasive aspergillosis

Sixth instar G. mellonella larvae (Magazoo, Montréal, Canada) were stored in wood shavings in the dark at 15 °C and used within 1 week of delivery. Larvae were inoculated with swollen conidia by injecting 10 μl of a 105 conidia/mL suspension into the haemocoel through the last pro-leg using a Hamilton 1702RN gas tight syringe with a Hamilton 33/1.5″/3 needle (Hamilton, Reno, NV, USA). Sham infected larvae were injected with 10 μl of sterile RPMI 1640 culture medium. For each test strain, 10 larvae were infected, and all experiments were repeated on at least two separate occasions. Larvae were maintained in wood shaving filled Petri-dishes in the dark at 37°C and monitored for mortality. The experiment was repeated four times and the results were combined.

Intranasal model of invasive murine aspergillosis

male BALB/c mice (Taconic Labs, Germantown, NY, USA), weighing 18–22 g, were immunosuppressed with 10 mg of cortisone acetate (Sigma-Aldrich) administered subcutaneously every other day, starting on day −4 relative to infection, for a total of 5 doses (Spikes et al., 2008) . For each strain, 11 mice were infected using an aerosol chamber as previously described (Sheppard et al., 2004a). Three mice were killed immediately after inoculation to verify the inoculums and remaining eight mice were followed for survival. An additional 8 mice were immunosuppressed but not infected. To prevent bacterial infections, the mice were given 5 mg of ceftazidime intraperitoneally daily while they were immunosuppressed. The mice were monitored for signs of illness and moribund animals were euthanized. The survival experiment was performed twice and the results were combined. All procedures involving mice were approved by the Institutional Animal Use and Care Committee, according to the National Institutes of Health guidelines for animal housing and care. In both in vivo models, differences in survival between experimental groups were compared using the log-rank test.

In a separate third experiment, 11 mice per strain were immunousspressed and infected with the various strains as above. After 4 days of infection, the mice were sacrificed and their lungs were harvested. They were immediately homogenized ice cold PBS containing protease inhibitors (Sigma Aldrich), and then aliquoted and stored at −80°C until use. To determine the pulmonary fungal burden, galactomannan (GM) content was measured in homogenates of the mouse lungs using the Platelia® Aspergillus kit (Bio-Rad) according to manufacturer instructions (Sheppard et al., 2006) . Serial dilutions of a pool of lung homogenates from five heavily infected mice (7 days after intranasal infection with strain Af293) were used to establish a standard curve. In preliminary experiments, we determined that the ΔmedA mutant released a similar amount of GM into the medium when grown in RPMI 1640 medium as compared to strain Af293. The accumulation of phagocytes in the lungs was estimated by measuring the myeloperoxidase (MPO) concentration in the homogenates using an enzyme immunoassay (Cell Sciences, Canton, MA, USA) according to the manufacturer's instructions. To avoid the healthy survivor bias, the GM and MPO studies were performed on the fourth day after infection at which point 90% of infected animals remained alive.

Supplementary Material

Supplementary Figure S1. Sequence alignment of MedA orthologues.

Alignment of the predicted amino acid sequences of MedA orthologues among the following fungal species: Aspergillus fumigatus Af293 (Af), Aspergillus clavatus NRRL1 (Ac), Aspergillus terreus NIH2624 (At), Aspergillus oryzae RIB 40 (Ao), Emericella nidulans FGSC A4 (En), Fusarium oxysporum Me102010 (Fo), and Neurospora crassa OR74A (Nc), Neosartorya fischeri NRRL 181 (Nf).

Supplementary Figure S2. Construction of ΔmedA mutant and medA-complemented strains.

A. Split marker strategy for the deletion of medA. First medA flanking sequence fragments were amplified by PCR. Next, fusion PCR was used to join each flanking sequence to a fragment of the HYG cassette. Finally, Af293 was co-transformed with the two deletion fragments. A triple cross-over event resulted in replacement of medA by the hph cassette, thus generating the strain ΔmedA. Legend: M1, M2, M3, M4, HY, and YG - primers used for amplification; hph - hygromycin resistance cassette bore by pAN7-1.

B. Complementation of the ΔmedA strain. A pAN7.1::medA::ble construct was linearized at the unique SpeI restriction site, which was located 0.8 kb upstream of the medA deletion. Transformation with this cassette yielded integration of the cloned medA allele downstream of an intact promoter and upstream sequences. Legend: ble - phleomycin resistance cassette initially bore by p402.

C. Southern blot analysis of medA deletion and complementation were assessed at the genomic DNA level by Southern blotting. Genomic DNA were from Af293 (lane 1), ΔmedA mutant (lane 2) and medA-complemented (lane 3) strains was digested with ApaI and probed with a 0.3 kb fragment of medA.

Supplementary Figure S3. The deletion of medA does not affect growth rate of A. fumigatus (top lane).

Photomicrograph of hyphal mats grown in F12K media alone (A) or in the presence of A549 cells (B): All A. fumigatus. strains demonstrated identical growth rates under each condition.

ACKNOWLEDGMENTS

The authors wish to express their gratitude to Dr Kevin Kavanagh for helpful advice in establishing the Galleria mellonella model in our laboratory. This research was supported by an operating grant from the Canadian Institutes of Health Research and by grants M01RR00425, R21AI064511, and R01AI073829, as well as contract no. N01-AI-30041 from the National Institutes of Health, U.S.A. DCS is a Canadian Institute of Health Research Clinician Scientist, and recipient of a Burroughs Welcome Fund Career Award in the Biomedical Sciences.

References

  1. Adams TH, Wieser JK, Yu J-H. Asexual sporulation in Aspergillus nidulans. Microbiol. Mol. Biol. Rev. 1998;62:35–54. doi: 10.1128/mmbr.62.1.35-54.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Aguirre J. Spatial and temporal controls of the Aspergillus brlA developmental regulatory gene. Mol Microbiol. 1993;8:211–218. doi: 10.1111/j.1365-2958.1993.tb01565.x. [DOI] [PubMed] [Google Scholar]
  3. Axelrod DE, Gealt M, Pastushok M. Gene control of developmental competence in Aspergillus nidulans. Developmental Biology. 1973;34:9–15. doi: 10.1016/0012-1606(73)90335-7. [DOI] [PubMed] [Google Scholar]
  4. Bahn YS, Sundstrom P. CAP1, an adenylate cyclase-associated protein gene, regulates bud-hypha transitions, filamentous growth, and cyclic AMP levels and is required for virulence of Candida albicans. J Bacteriol. 2001;183:3211–3223. doi: 10.1128/JB.183.10.3211-3223.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Beauvais A, Schmidt C, Guadagnini S, Roux P, Perret E, Henry C, et al. An extracellular matrix glues together the aerial-grown hyphae of Aspergillus fumigatus. Cell Microbiol. 2007;9:1588–1600. doi: 10.1111/j.1462-5822.2007.00895.x. Epub 2007 Feb 1516. [DOI] [PubMed] [Google Scholar]
  6. Bezerra LML, Filler SG. Interactions of Aspergillus fumigatus with endothelial cells: internalization, injury, and stimulation of tissue factor activity. Blood. 2004;103:2143–2149. doi: 10.1182/blood-2003-06-2186. [DOI] [PubMed] [Google Scholar]
  7. Bouchara JP, Sanchez M, Chevailler A, Marot-Leblond A, Lissitzky JC, Tronchin G, Chabasse D. Sialic acid-dependent recognition of laminin and fibrinogen by Aspergillus fumigatus conidia. Infect. Immun. 1997;65:2717–2724. doi: 10.1128/iai.65.7.2717-2724.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Brakhage AA, Langfelder K. Menacing mold: the molecular biology of Aspergillus fumigatus. Annu Rev Microbiol. 2002;56:433–455. doi: 10.1146/annurev.micro.56.012302.160625. Epub 2002 Jan 2030. [DOI] [PubMed] [Google Scholar]
  9. Busby TM, Miller KY, Miller BL. Suppression and enhancement of the Aspergillus nidulans medusa mutation by altered dosage of the bristle and stunted genes. Genetics. 1996;143:155–163. doi: 10.1093/genetics/143.1.155. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Clutterbuck AJ. A mutational analysis of conidial development in Aspergillus nidulans. Genetics. 1969;63:317–327. doi: 10.1093/genetics/63.2.317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Cove DJ. The induction and repression of nitrate reductase in the fungus Aspergillus nidulans. Biochim Biophys Acta. 1966;113:51–56. doi: 10.1016/s0926-6593(66)80120-0. [DOI] [PubMed] [Google Scholar]
  12. Cramer RA, Jr., Gamcsik MP, Brooking RM, Najvar LK, Kirkpatrick WR, Patterson TF, et al. Disruption of a nonribosomal peptide synthetase in Aspergillus fumigatus eliminates gliotoxin production. Eukaryot Cell. 2006;5:972–980. doi: 10.1128/EC.00049-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Denning DW. Aspergillus species. In: Mandell GL, Bennett JE, Dolin R, editors. Mandell, Douglas, and Bennett's principals and practice of infectious diseases. 5th edn. Chuchill Livingston; Philadelphia: 2000. pp. 2674–2684. [Google Scholar]
  14. Felk A, Kretschmar M, Albrecht A, Schaller M, Beinhauer S, Nichterlein T, et al. Candida albicans hyphal formation and the expression of the Efg1-regulated proteinases Sap4 to Sap6 are required for the invasion of parenchymal organs. Infect Immun. 2002;70:3689–3700. doi: 10.1128/IAI.70.7.3689-3700.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Fu Y, Ibrahim AS, Sheppard DC, Chen YC, French SW, Cutler JE, et al. Candida albicans Als1p: an adhesin that is a downstream effector of the EFG1 filamentation pathway. Mol Microbiol. 2002;44:61–72. doi: 10.1046/j.1365-2958.2002.02873.x. [DOI] [PubMed] [Google Scholar]
  16. Fu Y, Rieg G, Fonzi WA, Belanger PH, Edwards JE, Jr., Filler SG. Expression of the Candida albicans gene ALS1 in Saccharomyces cerevisiae induces adherence to endothelial and epithelial cells. Infect Immun. 1998;66:1783–1786. doi: 10.1128/iai.66.4.1783-1786.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Garcia-Sanchez S, Aubert S, Iraqui I, Janbon G, Ghigo JM, d'Enfert C. Candida albicans biofilms: a developmental state associated with specific and stable gene expression patterns. Eukaryot Cell. 2004;3:536–545. doi: 10.1128/EC.3.2.536-545.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Gravelat FN, Doedt T, Chiang LY, Liu H, Filler SG, Patterson TF, Sheppard DC. In vivo analysis of Aspergillus fumigatus developmental gene expression determined by real-time reverse transcription-PCR. Infect. Immun. 2008;76:3632–3639. doi: 10.1128/IAI.01483-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Jaffe EA, Nachman RL, Becker CG, Minick CR. Culture of human endothelial cells derived from umbilical veins. Identification by morphologic and immunologic criteria. J Clin Invest. 1973;52:2745–2756. doi: 10.1172/JCI107470. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kavanagh K, Reeves EP. Exploiting the potential of insects for in vivo pathogenicity testing of microbial pathogens. FEMS Microbiology Reviews. 2004;28:101–112. doi: 10.1016/j.femsre.2003.09.002. [DOI] [PubMed] [Google Scholar]
  21. Kraemer R, Delosea N, Ballinari P, Gallati S, Crameri R. Effect of allergic bronchopulmonary aspergillosis on lung function in children with cystic fibrosis. Am J Respir Crit Care Med. 2006;174:1211–1220. doi: 10.1164/rccm.200603-423OC. Epub 2006 Sep 1217. [DOI] [PubMed] [Google Scholar]
  22. Latge JP. Aspergillus fumigatus and aspergillosis. Clin Microbiol Rev. 1999;12:310–350. doi: 10.1128/cmr.12.2.310. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Lengeler KB, Davidson RC, D'Souza C, Harashima T, Shen WC, Wang P, et al. Signal transduction cascades regulating fungal development and virulence. Microbiol Mol Biol Rev. 2000;64:746–785. doi: 10.1128/mmbr.64.4.746-785.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Lo HJ, Kohler JR, DiDomenico B, Loebenberg D, Cacciapuoti A, Fink GR. Nonfilamentous C. albicans mutants are avirulent. Cell. 1997;90:939–949. doi: 10.1016/s0092-8674(00)80358-x. [DOI] [PubMed] [Google Scholar]
  25. Mah J-H, Yu J-H. Upstream and downstream regulation of asexual development in Aspergillus fumigatus. Eukaryotic Cell. 2006;5:1585–1595. doi: 10.1128/EC.00192-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Marr KA, Patterson T, Denning D. Aspergillosis. Pathogenesis, clinical manifestations, and therapy. Infect Dis Clin North Am. 2002;16:875–894. doi: 10.1016/s0891-5520(02)00035-1. vi. [DOI] [PubMed] [Google Scholar]
  27. McCluskey K. The Fungal Genetics Stock Center: from molds to molecules. Adv Appl Microbiol. 2003;52:245–262. doi: 10.1016/s0065-2164(03)01010-4. [DOI] [PubMed] [Google Scholar]
  28. Monroy F, Sheppard DC. Taf1: a class II transposon of Aspergillus fumigatus. Fungal Genet Biol. 2005;42:638–645. doi: 10.1016/j.fgb.2005.04.003. [DOI] [PubMed] [Google Scholar]
  29. Mowat E, Butcher J, Lang S, Williams C, Ramage G. Development of a simple model for studying the effects of antifungal agents on multicellular communities of Aspergillus fumigatus. J Med Microbiol. 2007;56:1205–1212. doi: 10.1099/jmm.0.47247-0. [DOI] [PubMed] [Google Scholar]
  30. Murray TS, Egan M, Kazmierczak BI. Pseudomonas aeruginosa chronic colonization in cystic fibrosis patients. Curr Opin Pediatr. 2007;19:83–88. doi: 10.1097/MOP.0b013e3280123a5d. [DOI] [PubMed] [Google Scholar]
  31. Nobile CJ, Andes DR, Nett JE, Smith FJ, Yue F, Phan QT, et al. Critical role of Bcr1-dependent adhesins in C. albicans biofilm formation in vitro and in vivo. PLoS Pathog. 2006;2:e63. doi: 10.1371/journal.ppat.0020063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Nobile CJ, Mitchell AP. Regulation of cell-surface genes and biofilm formation by the C. albicans transcription factor Bcr1p. Curr Biol. 2005;15:1150–1155. doi: 10.1016/j.cub.2005.05.047. [DOI] [PubMed] [Google Scholar]
  33. Park H, Myers CL, Sheppard DC, Phan QT, Sanchez AA, Edwards JE, Jr., Filler SG. Role of the fungal Ras-protein kinase A pathway in governing epithelial cell interactions during oropharyngeal candidiasis. Cell Microbiol. 2005;7:499–510. doi: 10.1111/j.1462-5822.2004.00476.x. [DOI] [PubMed] [Google Scholar]
  34. Phan QT, Belanger PH, Filler SG. Role of hyphal formation in interactions of Candida albicans with endothelial cells. Infect Immun. 2000;68:3485–3490. doi: 10.1128/iai.68.6.3485-3490.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Renwick J, Daly P, Reeves EP, Kavanagh K. Susceptibility of larvae of Galleria mellonella to infection by Aspergillus fumigatus is dependent upon stage of conidial germination. Mycopathologia. 2006;161:377–384. doi: 10.1007/s11046-006-0021-1. [DOI] [PubMed] [Google Scholar]
  36. Sanchez AA, Johnston DA, Myers C, Edwards JE, Jr., Mitchell AP, Filler SG. Relationship between Candida albicans virulence during experimental hematogenously disseminated Infection and endothelial cell damage In vitro. Infect Immun. 2004;72:598–601. doi: 10.1128/IAI.72.1.598-601.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Seidler MJ, Salvenmoser S, Muller F-MC. Aspergillus fumigatus forms biofilms with reduced antifungal drug susceptibility on bronchial epithelia cells. Antimicrob. Agents Chemother. 2008 doi: 10.1128/AAC.00234-08. AAC.00234-00208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Sheppard DC, Doedt T, Chiang LY, Kim HS, Chen D, Nierman WC, Filler SG. The Aspergillus fumigatus StuA protein governs the up-regulation of a discrete transcriptional program during the acquisition of developmental competence. Mol Biol Cell. 2005;16:5866–5879. doi: 10.1091/mbc.E05-07-0617. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Sheppard DC, Marr KA, Fredricks DN, Chiang LY, Doedt T, Filler SG. Comparison of three methodologies for the determination of pulmonary fungal burden in experimental murine aspergillosis. Clin Microbiol Infect. 2006;12:376–380. doi: 10.1111/j.1469-0691.2005.01349.x. [DOI] [PubMed] [Google Scholar]
  40. Sheppard DC, Rieg G, Chiang LY, Filler SG, Edwards JE, Jr., Ibrahim AS. Novel Inhalational Murine Model of Invasive Pulmonary Aspergillosis. Antimicrob. Agents Chemother. 2004a;48:1908–1911. doi: 10.1128/AAC.48.5.1908-1911.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Sheppard DC, Yeaman MR, Welch WH, Phan QT, Fu Y, Ibrahim AS, et al. Functional and structural diversity in the Als protein family of Candida albicans. J. Biol. Chem. 2004b doi: 10.1074/jbc.M401929200. M401929200. [DOI] [PubMed] [Google Scholar]
  42. Shoseyov D, Brownlee KG, Conway SP, Kerem E. Aspergillus bronchitis in cystic fibrosis. Chest. 2006;130:222–226. doi: 10.1378/chest.130.1.222. [DOI] [PubMed] [Google Scholar]
  43. Sonneborn A, Bockmuhl DP, Gerads M, Kurpanek K, Sanglard D, Ernst JF. Protein kinase A encoded by TPK2 regulates dimorphism of Candida albicans. Mol Microbiol. 2000;35:386–396. doi: 10.1046/j.1365-2958.2000.01705.x. [DOI] [PubMed] [Google Scholar]
  44. Spikes S, Xu R, Nguyen CK, Chamilos G, Kontoyiannis DP, Jacobson RH, et al. Gliotoxin production in Aspergillus fumigatus contributes to host-specific differences in virulence. J Infect Dis. 2008;197:479–486. doi: 10.1086/525044. [DOI] [PubMed] [Google Scholar]
  45. Staab JF, Sundstrom P. Genetic organization and sequence analysis of the hypha-specific cell wall protein gene HWP1 of Candida albicans. Yeast. 1998;14:681–686. doi: 10.1002/(SICI)1097-0061(199805)14:7<681::AID-YEA256>3.0.CO;2-8. [DOI] [PubMed] [Google Scholar]
  46. Sugui JA, Pardo J, Chang YC, Zarember KA, Nardone G, Galvez EM, et al. Gliotoxin is a virulence factor of Aspergillus fumigatus: gliP deletion attenuates virulence in mice immunosuppressed with hydrocortisone. Eukaryotic Cell. 2007;6:1562–1569. doi: 10.1128/EC.00141-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Sundstrom P. Adhesion in Candida spp. Cell Microbiol. 2002;4:461–469. doi: 10.1046/j.1462-5822.2002.00206.x. [DOI] [PubMed] [Google Scholar]
  48. Szeto CYY, Leung GS, Kwan HS. Le.MAPK and its interacting partner, Le.DRMIP, in fruiting body development in Lentinula edodes. Gene. 2007;393:87–93. doi: 10.1016/j.gene.2007.01.030. [DOI] [PubMed] [Google Scholar]
  49. Tsai H-F, Chang YC, Washburn RG, Wheeler MH, Kwon-Chung KJ. The Developmentally Regulated alb1 Gene of Aspergillus fumigatus: Its Role in Modulation of Conidial Morphology and Virulence. J. Bacteriol. 1998;180:3031–3038. doi: 10.1128/jb.180.12.3031-3038.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Tsai H-F, Fujii I, Watanabe A, Wheeler MH, Chang YC, Yasuoka Y, et al. Pentaketide Melanin Biosynthesis in Aspergillus fumigatus Requires Chain-length Shortening of a Heptaketide Precursor. J. Biol. Chem. 2001;276:29292–29298. doi: 10.1074/jbc.M101998200. [DOI] [PubMed] [Google Scholar]
  51. Tsai H-F, Wheeler MH, Chang YC, Kwon-Chung KJ. A Developmentally Regulated Gene Cluster Involved in Conidial Pigment Biosynthesis in Aspergillus fumigatus. J. Bacteriol. 1999;181:6469–6477. doi: 10.1128/jb.181.20.6469-6477.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Twumasi-Boateng K, Yu Y, Chen D, Gravelat FN, Nierman WC, Sheppard DC. Transcriptional profiling identifies a role for BrlA in the response to nitrogen depletion, and for StuA in the regulation of secondary metabolite clusters in Aspergillus fumigatus. Eukaryot Cell. 2009;8:104–115. doi: 10.1128/EC.00265-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Upadhyay SK, Mahajan L, Ramjee S, Singh Y, Basir SF, Madan T. Identification and characterization of a laminin-binding protein of Aspergillus fumigatus: extracellular thaumatin domain protein (AfCalAp) J Med Microbiol. 2009;58:714–722. doi: 10.1099/jmm.0.005991-0. [DOI] [PubMed] [Google Scholar]
  54. Warwas ML, Watson JN, Bennet AJ, Moore MM. Structure and role of sialic acids on the surface of Aspergillus fumigatus conidiospores. Glycobiology. 2007;17:401–410. doi: 10.1093/glycob/cwl085. [DOI] [PubMed] [Google Scholar]
  55. Wasylnka JA, Hissen AH, Wan AN, Moore MM. Intracellular and extracellular growth of Aspergillus fumigatus. Med Mycol. 2005;43:S27–30. doi: 10.1080/13693780400029247. [DOI] [PubMed] [Google Scholar]
  56. Wasylnka JA, Moore MM. Uptake of Aspergillus fumigatus conidia by phagocytic and nonphagocytic cells in vitro: quantitation using strains expressing green fluorescent protein. Infect Immun. 2002;70:3156–3163. doi: 10.1128/IAI.70.6.3156-3163.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Wasylnka JA, Moore MM. Aspergillus fumigatus conidia survive and germinate in acidic organelles of A549 epithelial cells. J Cell Sci. 2003;116:1579–1587. doi: 10.1242/jcs.00329. [DOI] [PubMed] [Google Scholar]
  58. Yu J-H, Mah J-H, Seo J-A. Growth and developmental control in the model and pathogenic Aspergilli. Eukaryotic Cell. 2006;5:1577–1584. doi: 10.1128/EC.00193-06. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Figure S1. Sequence alignment of MedA orthologues.

Alignment of the predicted amino acid sequences of MedA orthologues among the following fungal species: Aspergillus fumigatus Af293 (Af), Aspergillus clavatus NRRL1 (Ac), Aspergillus terreus NIH2624 (At), Aspergillus oryzae RIB 40 (Ao), Emericella nidulans FGSC A4 (En), Fusarium oxysporum Me102010 (Fo), and Neurospora crassa OR74A (Nc), Neosartorya fischeri NRRL 181 (Nf).

NIHMS185005-supplement-supp_fig_01.ppt (114KB, ppt)
Supplementary Figure S2. Construction of ΔmedA mutant and medA-complemented strains.

A. Split marker strategy for the deletion of medA. First medA flanking sequence fragments were amplified by PCR. Next, fusion PCR was used to join each flanking sequence to a fragment of the HYG cassette. Finally, Af293 was co-transformed with the two deletion fragments. A triple cross-over event resulted in replacement of medA by the hph cassette, thus generating the strain ΔmedA. Legend: M1, M2, M3, M4, HY, and YG - primers used for amplification; hph - hygromycin resistance cassette bore by pAN7-1.

B. Complementation of the ΔmedA strain. A pAN7.1::medA::ble construct was linearized at the unique SpeI restriction site, which was located 0.8 kb upstream of the medA deletion. Transformation with this cassette yielded integration of the cloned medA allele downstream of an intact promoter and upstream sequences. Legend: ble - phleomycin resistance cassette initially bore by p402.

C. Southern blot analysis of medA deletion and complementation were assessed at the genomic DNA level by Southern blotting. Genomic DNA were from Af293 (lane 1), ΔmedA mutant (lane 2) and medA-complemented (lane 3) strains was digested with ApaI and probed with a 0.3 kb fragment of medA.

NIHMS185005-supplement-supp_fig_02.ppt (357KB, ppt)
Supplementary Figure S3. The deletion of medA does not affect growth rate of A. fumigatus (top lane).

Photomicrograph of hyphal mats grown in F12K media alone (A) or in the presence of A549 cells (B): All A. fumigatus. strains demonstrated identical growth rates under each condition.

NIHMS185005-supplement-supp_fig_03.ppt (542KB, ppt)

RESOURCES