Skip to main content
Molecular Vision logoLink to Molecular Vision
. 2012 Jun 1;18:1421–1427.

Absence of altered expression of optineurin in primary open angle glaucoma patients

Khaled K Abu-Amero 1,3,✉, Taif Anwar Azad 1, George L Spaeth 2, Jonathan Myers 2, L Jay Katz 2, Marlene Moster 2, Thomas M Bosley 1
PMCID: PMC3370688  PMID: 22690120

Abstract

Purpose

To investigate the expression level of the optineurin gene (OPTN) in the blood of primary open angle glaucoma (POAG) patients to determine if altered expression is playing a role in primary open angle glaucoma systemically.

Methods

Patients (n=47) were eligible for inclusion if they met standard clinical criteria for POAG, including age greater than 40 years, intraocular pressure ≥21 mmHg in at least one eye before treatment, normal-appearing anterior chamber angles bilaterally on gonioscopy, and optic nerve injury characteristic of POAG. Control subjects (n=27) were recruited who were free from glaucoma by examination. DNA from patient was sequenced to look for possible mutations in the coding region of OPTN or its promoter. RNA was extracted from leukocytes of patients and controls and converted to cDNA by reverse transcriptase enzyme, and quantitative PCR was used to assess expression levels of OPTN and the β-globulin gene. The ratio of OPTN expression to β-globulin gene expression for POAG patients was compared to that of controls and to clinical characteristics of POAG patients.

Results

No mutation(s) were detected in any of the patients after sequencing the full OPTN gene and its promoter region. Mean OPTN (p≤0.35), and β-globulin (p≤0.48) gene expression values were statistically similar in POAG patients and controls. OPTN/β-globulin (p≤0.83) ratios were also indistinguishable between POAG patients and controls. OPTN/β-globulin ratios were not significantly associated with age, sex, or ethnicity of patients within the POAG group. Similarly, OPTN/β-globulin ratios were not significantly affected by ethnicity or clinical parameters related to POAG severity including maximum intraocular pressure, vertical cup-to-disk ratio, static perimetry mean deviation, or static perimetry pattern standard deviation.

Conclusions

OPTN expression is not altered in the blood of POAG patients, suggesting that OPTN expression is not changed systemically and implying that other mechanisms are involved in POAG pathogenesis.

Introduction

Glaucoma is one of the leading cause of blindness worldwide [1], characterized by progressive degeneration of axons in the optic nerve [2]. Primary open angle glaucoma (POAG) is the most prevalent glaucoma variant in Western countries and has risk factors that include elevated intraocular pressure (IOP) and age [3]. Elevated IOP is likely the result of the increased aqueous humor outflow resistance in the trabecular meshwork (TM) [4], but the exact mechanism and causative factors for this increase is still unclear. Up to half of all patients with POAG have a positive family history, and the risk of POAG is increased 3–9 times in first-degree relatives of POAG patients [5,6]. In addition, a maternal family history of POAG is 6–8 times more likely than a paternal family history [7-9]. These observations suggest that genetic factors may contribute to POAG, with a mitochondrial component being particularly likely [1,10-12]. A potential role of Optineurin (OPTN) when it was first established in 1998 as a second gene in linkage to normal tension glaucoma in the GLCE1 region at locus p15–14 on chromosome 10 [13]. Initial studies indicated that 16.7% of families with hereditary POAG had putative disease causing OPTN variations [14]. Subsequently, several screening studies have been conducted in different populations to identify possible changes in OPTN that might cause adult POAG [15-19]. OPTN covers a 37 kb genomic region and contains 13 exons that code for 577 amino acids. Its expression had been reported in both ocular and non-ocular tissues including the TM, non-pigmented ciliary epithelium, heart, brain, placenta, skeletal muscle, and kidney [14]. Overexpression of optineurin increases cellular protection from H2O2-induced cell death by inhibiting release of cytochrome C from mitochondria [20]. A well established mutation in OPTN, E50K, impairs the trafficking of OPTN and also is capable of causing oxidative stress to cells, possibly inducing the death of retinal ganglion cells [21]. Further recent reports suggest the role of OPTN in negatively regulating tumor necrosis factor-alpha (TNFα)-induced nuclear factor kappa beta (NFkB) activation [22,23].

Overexpression of OPTN in trabecular meshwork results in prolonged turnover rate of OPTN mRNA without a major impact on OPTN promoter activity [24].The exact role of OPTN in genetics remains elusive in spite of many investigations into OPTN gene sequence and expression variations [25]. Functional studies have also been unable to unravel its relevance to POAG [14]. Whole blood gene expression studies have been shown to have value previously in the investigation of POAG [26], other hereditary optic neuropathies [27], and diseases affecting brain anatomy and function [28,29]. The current study investigates OPTN expression in whole blood from POAG patients in hope that this approach will add to our knowledge of whether there is altered systemic expression of this gene in POAG.

Methods

Patients and controls

Patients (n=47) were evaluated in the Glaucoma Service at the Wills Eye Institute and enrolled after examination by a glaucoma specialist. Patients were eligible for inclusion if they met the following clinical criteria for POAG [30-33]: age greater than 40 years; intraocular pressure (IOP) ≥21 mmHg in one or both eyes before initiation of glaucoma treatment; normal-appearing, open anterior chamber angles bilaterally by gonioscopy; optic nerve appearance characteristic of the optic discs typically observed in primary open-angle glaucoma (with localized narrowing or absence of the neuro-retinal rim, with the amount of cupping exceeding the amount of pallor of the rim, and with asymmetric cupping of the optic discs in the two eyes); and static visual field (Humphrey Field Analyzer II; Carl Zeiss Meditec, Inc., Dublin, CA; using a full threshold 24–2 program) abnormalities typical of glaucoma (as per Advanced Glaucoma Intervention Study criteria [34]. There had to be good agreement between the appearance of the optic disc and the visual field. Exclusion criteria included historical, neuroimaging, or biochemical evidence of another possible optic neuropathic process affecting either eye, significant visual loss in both eyes not associated with glaucoma, or choosing not to participate. This research adhered to the tenets of the Declaration of Helsinki, and all patients and controls signed an informed consent approved by the Wills Eye Institute institutional review board.

All control subjects (n=27), frequently spouses of patients, had full ophthalmologic examinations and static perimetry. Each had IOPs that were <21 mmHg and symmetric in the two eyes, normal anterior chambers, optic discs that were normal and symmetric in appearance, entirely normal static perimetry OU, and no prior history of glaucoma. All controls had static perimetry performed in the same fashion as POAG patients.

DNA testing

Five ml of peripheral blood were collected in EDTA tubes from all participating individuals. DNA was extracted using the Illustra blood genomic Prep Mini Spin Kit from GE Healthcare (Buckinghamshire, UK), and stored at −20 °C in aliquots until required.

All patient and control DNA samples were tested for mutations in the OPTN gene.

Successfully amplified fragments were sequenced in both directions using the M13 forward and reverse primers and the BigDye terminator v3.1 cycle sequencing kit (Applied Biosystems, Foster city, CA). Fragments were then run on the 3130xl Genetic Analyzer (Applied Biosystems) according to the manufacturer protocol. All the sequenced fragments were then analyzed using SeqScape software v2.6 (Applied Biosystems). Table 1 details the sequence of the primers used, the PCR annealing temperature and the expected amplicon size.

Table 1. Primer sequences, PCR annealing temperature and amplicon size for OPTN.

Exon Primer sequence Annealing temp. (°C) Amplicon size (bp)
OPTN-1F
TGTAAAACGACGGCCAGTCTTGGTCGGGTGGGGTAT
57
420
OPTN-1R
CAGGAAACAGCTATGACCGCGGGTACCGTTTTCAGG
57
 
OPTN-2F
TGTAAAACGACGGCCAGTTCTTAGTCTTTTCAGTATGCATTGA
59
351
OPTN-2R
CAGGAAACAGCTATGACCAGTTTATTGTGTTTTTGGTTAAGAAGA
59
 
OPTN-3F
TGTAAAACGACGGCCAGTTACACACACACGCACACACA
57
253
OPTN-3R
CAGGAAACAGCTATGACCTTCCTGTGGAAAAGTCACCTG
57
 
OPTN-4aF
TGTAAAACGACGGCCAGTAAGTGGGCAACTTTTGGAGT
57
391
OPTN-4aR
CAGGAAACAGCTATGACCAAGGGAGCTCACCACCAAG
57
 
OPTN-4bF
TGTAAAACGACGGCCAGTATCGCCAATGGGTTTGTG
59
376
OPTN-4bR
CAGGAAACAGCTATGACCAAGGGAGCTCACCACCAAG
59
 
OPTN-5F
TGTAAAACGACGGCCAGTCAGAGCCATGTGGTCAAGTG
57
402
OPTN-5R
CAGGAAACAGCTATGACCCCATGAAAGGTTTTGATCTAGGA
57
 
OPTN-6F
TGTAAAACGACGGCCAGTCCACTTCAGCCTCCCAGAG
57
382
OPTN-6R
CAGGAAACAGCTATGACCCTTGGCTTGTGTTGACAAGAA
57
 
OPTN-7F
TGTAAAACGACGGCCAGTCAAAAATTCATCTTTTGTCTTTTTC
57
272
OPTN-7R
CAGGAAACAGCTATGACCACTTCCTCAGGTCACAACATTT
57
 
OPTN-8F
TGTAAAACGACGGCCAGTAAGCAGTTCCTTTAAGCTGGTC
59
352
OPTN-8R
CAGGAAACAGCTATGACCCTTTAAATGGGTGAACTGTATGG
59
 
OPTN-9F
TGTAAAACGACGGCCAGTCCCAATTGTAAACAATGTTCTTTTT
57
302
OPTN-9R
CAGGAAACAGCTATGACCAAAGCAAATAACCCATCACAAGA
57
 
OPTN-10F
TGTAAAACGACGGCCAGTGGCTACTAATGGTTCAGCCTGT
57
315
OPTN-10R
CAGGAAACAGCTATGACCTGTAAAAATGTATATTTCAAAGGAGGA
57
 
OPTN-11F
TGTAAAACGACGGCCAGTTTATATTGTACATAACCTTGGGGTTT
59
349
OPTN-11R
CAGGAAACAGCTATGACCCAAATCCGAATTCCAATCTGTATAA
59
 
OPTN-12F
TGTAAAACGACGGCCAGTCTGGAGTGTTCAGAAGGTTGG
57
293
OPTN-12R
CAGGAAACAGCTATGACCCCAGATTTAGTGAAGGATTCATGT
57
 
OPTN-13F
TGTAAAACGACGGCCAGTCTAAAACAGGCAGAATTATTTCAAAAC
57
358
OPTN-13R
CAGGAAACAGCTATGACCAGAAAATTACAAACATTCTAAACACCA
57
 
OPTN-14F
TGTAAAACGACGGCCAGTGGCTATTGAAGGATACAGCACT
55
330
OPTN-14R
CAGGAAACAGCTATGACCTCAAATCAGGAACGTCTTTGG
55
 
OPTN-15F
TGTAAAACGACGGCCAGTTTTTTCCCCTACTTCTGTGGAC
59
279
OPTN-15R
CAGGAAACAGCTATGACCGAATCCATTGTAGAGAATGAAGTGG
59
 
OPTN-16aF
TGTAAAACGACGGCCAGTGAAGTTGAACTGATGTTAAAACTCG
57
777
OPTN-16aR
CAGGAAACAGCTATGACCTAAGGATTCTACTTTGCGAGTTGATG
57
 
OPTN-16bF
TGTAAAACGACGGCCAGTGAGACGACACCACTGCACTC
57
777
OPTN-16bR
CAGGAAACAGCTATGACCAACAATGTAAAAGATTCATAAGCAAAA
57
 
OPTN-16cF
TGTAAAACGACGGCCAGTCCCATTCACAGTGTAAAGAAGTT
57
777
OPTN-16cR
CAGGAAACAGCTATGACCCCTCCAGTATAAGATGATAAGGGAAA
57
 
OPTNPROM-F
TGTAAAACGACGGCCAGTGCAGCTTCCCTCCTCCAC
57
630
OPTNPROM-R CAGGAAACAGCTATGACCGGGGTGCCTAGGGCTGAT 57  

F=forward; R=reverse. Bold and underlined sequences are those of the M13.

Quantitative RT–PCR

A two-step semi-quantitative RT–PCR method was used to measure gene expression levels of OPTN and β-globulin in POAG patients and controls. Random hexameres were used as primers in the first step of cDNA synthesis. Total RNA (1 μg) was combined with 0.5 μg primers, 200 μM dNTPs, and sterile Milli-Q water and preheated at 65 °C for 2 min to denature secondary structures. The mixture was then cooled rapidly to 20 °C and then 10 μl 5× RT Buffer, 10 mM dithiothreitol, and 200 U Moloney Murine Leukemia Virus Reverse Transcriptase were added for a total volume of 50 μl. The RT mix was incubated at 37 °C for 90 min then stopped by heating at 95 °C for 5 min. The cDNA stock was stored at −20 °C.

Relative RT–PCR was performed to measure gene expression of OPTN and β-globulin according to standard guidelines [35]. Primer sequences and optimal PCR annealing temperatures (ta) are listed in Table 2. Primer sequences were designed to span intron regions to insure that no false positive PCR fragments would be generated from pseudogenes and contaminate genomic DNA. In addition, all forward PCR primers were labeled with fluorescein (6-FAM), making quantitation more accurate. Polymerase chain reactions were performed using 100 ng of cDNA, 5 pmoles of each oligonucleotide primer, 200 μM of each dNTP, 1 unit of HotStar Taq-polymerase (Qiagen, Valencia, CA) and 1× PCR buffer in a 20 μl volume. The PCR program initially started with a 95 °C denaturation for 5 min, followed by 25 cycles of 95 °C for 1 min, ta °C for 45 s, and 72 °C for 1 min. Linear amplification range for each gene was tested on the adjusted cDNA, and 25 cycles were found to be optimal for both OPTN and β-globulin. The PCR samples were electrophoresed on the 3130xl Genetic Analyzer (Applied Biosystems).

Table 2. Primer sequences and annealing temperature β-globulin and OPTN fluorescent labeled primers.

Primer name Primer sequence Annealing temp. (°C)
β-globulin F
(6-FAM)AGCCTCGCCTTTGCCGA
57
β-globulin R
CTGGTGCCTGGGGCG
 
OPTN-LAB F
(6-FAM)GCAGGTTCCCTGGTCAGC
59
OPTN-LAB R CAGGCAGCTGTTTCAAAGGT  

F=forward; R=reverse. The forward primers were labeled with 6-FAM.

Statistical analysis

Absolute RT–PCR values were used to calculate a ratio of the OPTN peak area in the selected linear amplification cycle divided by that of the β-globulin gene, creating an OPTN/β-globulin ratio. All clinical and genetic data were analyzed using SPSS v 10 (IBM, Armonk, NY).

Results

Age (POAG patients 67.3 years; controls 63.6 years; p≤0.17) and sex (POAG 26 males/21 females; controls 12/15; p≤0.18) of the 47 unrelated POAG patients were similar to the 27 control individuals, but ethnicity differed between the POAG group (25 Caucasian/22 African American) and the control group (23 Caucasian/4 African American; p≤0.003).

Neither POAG patients nor controls had any significant mutation(s) polymorphism(s) in the coding or promoter regions of OPTN after reading all sequences in the forward and reverse directions.

Mean OPTN (p≤0.35), and β-globulin (p≤0.48) gene expression values were statistically similar in POAG patients and controls (Table 3). OPTN/β-globulin (p≤0.83) ratios were also indistinguishable between POAG patients and controls. Because of the ethnic difference between the POAG group and controls, gene expression values and ratios were also compared between Caucasian POAG patients and Caucasian controls. Mean OPTN (p≤0.54) gene expression and OPTN/β-globulin (p≤0.79) ratios also did not differ between these groups.

Table 3. OPTN gene expression in POAG patients and controls.

Parameter Number POAG:Control Ψ POAG Control p≤
OPTN expression; mean (SD)
38:19
102205 (33682)
90885 (45922)
0.35
β-globulin expression; mean (SD)
44:24
109533 (31355)
103885 (31047)
0.48
OPTN/β-globulin; mean (SD)
38:19
1.0571 (0.606)
1.0196 (0.671)
0.83
OPTN expression in Caucasians; mean (SD)
20:18
101113 34580)
92916 (46368)
0.54
β-globulin expression in Caucasians; mean (SD)
22:20
104941 (31552)
99392 (32171)
0.58
OPTN/β-globulin in Caucasians; mean (SD) 20:18 1.1091 (0.648) 1.0512 (0.675) 0.79

POAG=primary open angle glaucoma; OPTN=Optineurin gene; SD=standard deviation. Ψ the number of patients or controls tested were limited to available samples and their RNA quality and quantity.

OPTN/β-globulin ratios were not significantly associated with age, sex, or ethnicity of patients within the POAG group (Table 4). Similarly, OPTN/β-globulin ratios were not significantly associated with most clinical parameters related to POAG severity, including maximum intraocular pressure, vertical cup-to-disk ratio, static perimetry mean deviation, or static perimetry pattern standard deviation. Power calculations indicated power ≤80% on these tests, leaving open the possibility of false negative type II statistical errors.

Table 4. Correlation between clinical parameters and OPTN/β-globulin ratios.

Clinical Parameter OPTN/β-globulin p≤
Age in years
0.146
0.40
Sex
−0.131
0.45
Ethnicity
−0.120
0.49
Visual acuity [OD]
0.328
0.05
Visual acuity [OS]
0.331
0.05
Maximum IOP [OD]
−0.026
0.88
Maximum IOP [OS]
−0.099
0.57
Vertical c/d ratio [OD]
−0.065
0.71
Vertical c/d ratio [OS]
−0.091
0.60
MD [OD]
0.210
0.23
MD [OS]
0.185
0.30
PSD [OD]
−0.135
0.43
PSD [OS] −0.157 0.37

OPTN/β-globulin column contains correlation coefficients; OD=right eye; OS=left eye; IOP=intraocular pressure; c/d=cup to disk; MD=Humphrey visual field mean deviation; PSD=Humphrey visual field pattern standard deviation.

Discussion

The 47 patients reported here met rigorous clinical criteria for POAG [36] with elevated IOP, normal anterior chamber, and evidence on funduscopic exam and visual fields of glaucomatous optic nerve damage. They did not have evidence by clinical criteria of other types of glaucoma or alternative causes of optic nerve injury. None had dysmorphism or an obvious genetic syndrome. They were compared to 27 control individuals in whom POAG and other evidence of optic nerve damage were carefully excluded.

Screening the full OPTN gene and its promoter region revealed no mutations or significant polymorphisms in POAG patients or controls. These results are not surprising, since the prevalence of OPTN mutations is generally less than 5% in adult POAG populations [37]. Currently, there are 29 mutations listed in the human genome mutation database (HGMD). None of those mutation(s) were reported in the promoter region. This may indicate that the promoter region is free of mutations which could alter its expression.

Almost all studies which have investigated the OPTN expression in POAG have done so in cultured human TM cells [24,38-40]. However, providing conditions of TM cells capable of preserving the characteristics of TM cells in vivo is a challenge. This genetic resemblance has been exploited recently with genome-wide gene expression studies using whole blood to investigate diseases affecting brain anatomy and function [28,29,41-43]. Complex neurologic diseases such as autism [44] and schizophrenia [45] have also been investigated using similar strategies. Due to unavailability of the target tissue in glaucoma (i.e., the optic nerve), we decided to utilize whole blood from POAG patients. We studied the expression of OPTN gene in POAG patients and compare the rates to those of the controls. Expression of OPTN in blood of POAG patients was unchanged compared to that of controls (Table 3). Expression was statistically similar to that of the housekeeping gene β-globulin, and the normalized expression of OPTN (OPTN/β-globulin) also did not differ between patients and controls. OPTN expression did not differ between Caucasian and African American POAG patients and ethnicity matched controls.

Since our patient population had Caucasian and African Americans subjects, we compared each group of patients with their ethnicity matched controls and the results remain the same, no difference in expression level between patients and their ethnicity matched controls. Additionally, since age is a factor contributing to adult POAG, correlation between age in years and the OPTN expression level could not be established. Thus, aging is not a contributing factor to altered expression of this gene.

Finally, OPTN/β-globulin did not correlate with age or with various clinical factors associated with POAG such as visual acuity, IOP, and C/D ratio (Table 4). These findings indicate that OPTN expression is not altered in the blood and that other gene(s) or epigenetic factors contributing to POAG pathogenesis in this group of patients. The normal expression of OPTN in POAG patients contradict previous studies which showed down-regulation of OPTN in TM cell primary cultures and the majority of these studies had reported overexpression of OPTN in cultured human TM cells [38,46].

OPTN spans ~37-kb genomic region and contains three non-coding exons in the 5′ region and 13 exons that code for a 577-amino acid protein. Alternative splicing generates at least three different isoforms. It is possible that an imbalance in the expression of these isoforms leads to glaucoma. However, any conclusive evidence for imbalance of splice variants of OPTN is still lacking and remains a possible testable hypothesis [47].

Multiple interacting partners of optineurin have been reported viz huntingtin, myosin VI, rab8, and TBK1 (TANK binding kinase) [48]. Optineurin was found to be localized in golgi apparatus and upon apoptotic stimuli it translocates to the nucleus. This translocation is mediated via a GTpase rab8, an interactor of optineurin [48]. It was also found that optineurin protects the cell from oxidative damage and blocks the release of cytochrome c from mitochondria. A well documented mutation of optineurin, E50K, was found to impair the trafficking of optineurin to the nucleus and also it can cause oxidative stress to the cells which can lead to apoptosis [20]. Optineurin can mediate this action through the antiapoptotic affect of NFk-B. It is known that optineurin negatively regulates NFk-B by competing with NF-kappa-B essential modulator (NEMO), a subunit of protein kinase IKK complex involved in NFk-B regulation. I kappa B kinase (IKK) sequesters NFk-B in the cytoplasm and, upon ubiquitin-mediated destruction of IKK, it translocates to the nucleus and induces the expression of many anti-apoptotic genes. By competing with NEMO optineurin prevents the NFk-B translocation to the nucleus [49]. Upon apoptotic signal, its translocation to the nucleus can alleviate its negative regulation of NFk-B and infer a protection from cell death. But again NFk-B positively regulates optineurin [23] and upon release from apoptotic stress it can quickly render the NFk-B to its inactive state. It can be said that optineurin maintain the cell heath by its expression pattern [50]. We screened the promoter region of this gene for probable POAG causing mutations and found none. This may eliminate and support our findings that at least in the promoter region there is no apparent sequence changes which may influence expression.

Park et al. [51] has previously shown that overexpression of OPTN in TM cells results in prolonged turnover rate of OPTN mRNA but had little effect on the promoter activity [51]. The authors have speculated the interaction through control of mRNA stability. Optinuerin also interacts with metabotropic glutamate receptors (mGluR) and selectively inhibit mGluR1a [52]. Many functional studies attempted to unravel the role of OPTN in ocular cells but its relevance to POAG is not entirely persuasive for lack of enough genetic evidence for its major role in pathogenesis of the disease. These results contradict what we seen here of unaltered expression. This may be due to the fact that we are screening blood leucocytes and they are using TM cell lines. Providing conditions of TM cells capable of preserving the characteristics of TM cells in vivo is a challenge and this may be a weakness in studies using TM cell lines and investigating POAG pathogenesis.

In summary, we showed that OPTN expression is not altered in the blood of POAG patients and thus suggest other mechanism(s), gene(s) or factors contributing to the POAG pathogenesis.

Acknowledgments

Khaled K. Abu-Amero, Ph.D., FRCPath is supported by the Glaucoma Research Chair at the Department of Ophthalmology at King Saud University, Riyadh, Saudi Arabia.

References

  • 1.Quigley HA. Number of people with glaucoma worldwide. Br J Ophthalmol. 1996;80:389–93. doi: 10.1136/bjo.80.5.389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Quigley HA. Glaucoma. Lancet. 2011;377:1367–77. doi: 10.1016/S0140-6736(10)61423-7. [DOI] [PubMed] [Google Scholar]
  • 3.Gherghel D, Hosking SL, Orgul S. Autonomic nervous system, circadian rhythms, and primary open-angle glaucoma. Surv Ophthalmol. 2004;49:491–508. doi: 10.1016/j.survophthal.2004.06.003. [DOI] [PubMed] [Google Scholar]
  • 4.Llobet A, Gasull X, Gual A. Understanding trabecular meshwork physiology: a key to the control of intraocular pressure? News Physiol Sci. 2003;18:205–9. doi: 10.1152/nips.01443.2003. [DOI] [PubMed] [Google Scholar]
  • 5.Tielsch JM, Sommer A, Katz J, Royall RM, Quigley HA, Javitt J. Racial variations in the prevalence of primary open-angle glaucoma. The Baltimore Eye Survey. JAMA. 1991;266:369–74. [PubMed] [Google Scholar]
  • 6.Wilson MR, Hertzmark E, Walker AM, Childs-Shaw K, Epstein DL. A case-control study of risk factors in open angle glaucoma. Arch Ophthalmol. 1987;105:1066–71. doi: 10.1001/archopht.1987.01060080068030. [DOI] [PubMed] [Google Scholar]
  • 7.Morgan RW, Drance SM. Chronic open-angle glaucoma and ocular hypertension. An epidemiological study. Br J Ophthalmol. 1975;59:211–5. doi: 10.1136/bjo.59.4.211. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Shin DH, Becker B, Kolker AE. Family history in primary open-angle glaucoma. Arch Ophthalmol. 1977;95:598–600. doi: 10.1001/archopht.1977.04450040064007. [DOI] [PubMed] [Google Scholar]
  • 9.Charliat G, Jolly D, Blanchard F. Genetic risk factor in primary open-angle glaucoma: a case-control study. Ophthalmic Epidemiol. 1994;1:131–8. doi: 10.3109/09286589409047221. [DOI] [PubMed] [Google Scholar]
  • 10.Tielsch JM, Katz J, Sommer A, Quigley HA, Javitt JC. Family history and risk of primary open angle glaucoma. The Baltimore Eye Survey. Arch Ophthalmol. 1994;112:69–73. doi: 10.1001/archopht.1994.01090130079022. [DOI] [PubMed] [Google Scholar]
  • 11.Quigley HA, Broman AT. The number of people with glaucoma worldwide in 2010 and 2020. Br J Ophthalmol. 2006;90:262–7. doi: 10.1136/bjo.2005.081224. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Abu-Amero KK, Morales J, Bosley TM. Mitochondrial abnormalities in patients with primary open-angle glaucoma. Invest Ophthalmol Vis Sci. 2006;47:2533–41. doi: 10.1167/iovs.05-1639. [DOI] [PubMed] [Google Scholar]
  • 13.Sarfarazi M, Child A, Stoilova D, Brice G, Desai T, Trifan OC, Poinoosawmy D, Crick RP. Localization of the fourth locus (GLC1E) for adult-onset primary open-angle glaucoma to the 10p15-p14 region. Am J Hum Genet. 1998;62:641–52. doi: 10.1086/301767. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Rezaie T, Child A, Hitchings R, Brice G, Miller L, Coca-Prados M, Heon E, Krupin T, Ritch R, Kreutzer D, Crick RP, Sarfarazi M. Adult-onset primary open-angle glaucoma caused by mutations in optineurin. Science. 2002;295:1077–9. doi: 10.1126/science.1066901. [DOI] [PubMed] [Google Scholar]
  • 15.Alward WL, Kwon YH, Kawase K, Craig JE, Hayreh SS, Johnson AT, Khanna CL, Yamamoto T, Mackey DA, Roos BR, Affatigato LM, Sheffield VC, Stone EM. Evaluation of optineurin sequence variations in 1,048 patients with open-angle glaucoma. Am J Ophthalmol. 2003;136:904–10. doi: 10.1016/s0002-9394(03)00577-4. [DOI] [PubMed] [Google Scholar]
  • 16.Aung T, Ebenezer ND, Brice G, Child AH, Prescott Q, Lehmann OJ, Hitchings RA, Bhattacharya SS. Prevalence of optineurin sequence variants in adult primary open angle glaucoma: implications for diagnostic testing. J Med Genet. 2003;40:e101. doi: 10.1136/jmg.40.8.e101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Leung YF, Fan BJ, Lam DS, Lee WS, Tam PO, Chua JK, Tham CC, Lai JS, Fan DS, Pang CP. Different optineurin mutation pattern in primary open-angle glaucoma. Invest Ophthalmol Vis Sci. 2003;44:3880–4. doi: 10.1167/iovs.02-0693. [DOI] [PubMed] [Google Scholar]
  • 18.Baird PN, Richardson AJ, Craig JE, Mackey DA, Rochtchina E, Mitchell P. Analysis of optineurin (OPTN) gene mutations in subjects with and without glaucoma: the Blue Mountains Eye Study. Clin Experiment Ophthalmol. 2004;32:518–22. doi: 10.1111/j.1442-9071.2004.00886.x. [DOI] [PubMed] [Google Scholar]
  • 19.Mukhopadhyay A, Komatireddy S, Acharya M, Bhattacharjee A, Mandal AK, Thakur SK, Chandrasekhar G, Banerjee A, Thomas R, Chakrabarti S, Ray K. Evaluation of Optineurin as a candidate gene in Indian patients with primary open angle glaucoma. Mol Vis. 2005;11:792–7. [PubMed] [Google Scholar]
  • 20.De Marco N, Buono M, Troise F, Diez-Roux G. Optineurin increases cell survival and translocates to the nucleus in a Rab8-dependent manner upon an apoptotic stimulus. J Biol Chem. 2006;281:16147–56. doi: 10.1074/jbc.M601467200. [DOI] [PubMed] [Google Scholar]
  • 21.Chalasani ML, Radha V, Gupta V, Agarwal N, Balasubramanian D, Swarup G. A glaucoma-associated mutant of optineurin selectively induces death of retinal ganglion cells which is inhibited by antioxidants. Invest Ophthalmol Vis Sci. 2007;48:1607–14. doi: 10.1167/iovs.06-0834. [DOI] [PubMed] [Google Scholar]
  • 22.Fenner BJ, Scannell M, Prehn JH. Identification of polyubiquitin binding proteins involved in NF-kappaB signaling using protein arrays. Biochim Biophys Acta. 2009;1794:1010–6. doi: 10.1016/j.bbapap.2009.02.013. [DOI] [PubMed] [Google Scholar]
  • 23.Sudhakar C, Nagabhushana A, Jain N, Swarup G. NF-kappaB mediates tumor necrosis factor alpha-induced expression of optineurin, a negative regulator of NF-kappaB. PLoS ONE. 2009;4:e5114. doi: 10.1371/journal.pone.0005114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Park BC, Tibudan M, Samaraweera M, Shen X, Yue BY. Interaction between two glaucoma genes, optineurin and myocilin. Genes Cells. 2007;12:969–79. doi: 10.1111/j.1365-2443.2007.01102.x. [DOI] [PubMed] [Google Scholar]
  • 25.Quigley HA. Glaucoma. Lancet. 2011;377:1367–77. doi: 10.1016/S0140-6736(10)61423-7. [DOI] [PubMed] [Google Scholar]
  • 26.Bosley TM, Hellani A, Spaeth GL, Myers J, Katz LJ, Moster MR, Milcarek B, Abu-Amero KK. Down-regulation of OPA1 in patients with primary open angle glaucoma. Mol Vis. 2011;17:1074–9. [PMC free article] [PubMed] [Google Scholar]
  • 27.Abu-Amero KK, Jaber M, Hellani A, Bosley TM. Genome-wide expression profile of LHON patients with the 11778 mutation. Br J Ophthalmol. 2010;94:256–9. doi: 10.1136/bjo.2009.165571. [DOI] [PubMed] [Google Scholar]
  • 28.Sullivan PF, Fan C, Perou CM. Evaluating the comparability of gene expression in blood and brain. Am J Med Genet B Neuropsychiatr Genet. 2006;141B:261–8. doi: 10.1002/ajmg.b.30272. [DOI] [PubMed] [Google Scholar]
  • 29.Tang Y, Gilbert DL, Glauser TA, Hershey AD, Sharp FR. Blood gene expression profiling of neurologic diseases: a pilot microarray study. Arch Neurol. 2005;62:210–5. doi: 10.1001/archneur.62.2.210. [DOI] [PubMed] [Google Scholar]
  • 30.Spaeth GL. Prognostic factors for progression of visual field damage in patients with normal-tension glaucoma. Jpn J Ophthalmol. 2007;51:156–7. doi: 10.1007/s10384-006-0415-0. [DOI] [PubMed] [Google Scholar]
  • 31.Eid TM, Spaeth GL, Bitterman A, Steinmann WC. Rate and amount of visual loss in 102 patients with open-angle glaucoma followed up for at least 15 years. Ophthalmology. 2003;110:900–7. doi: 10.1016/S0161-6420(03)00076-9. [DOI] [PubMed] [Google Scholar]
  • 32.Bayer A, Harasymowycz P, Henderer JD, Steinmann WG, Spaeth GL. Validity of a new disk grading scale for estimating glaucomatous damage: correlation with visual field damage. Am J Ophthalmol. 2002;133:758–63. doi: 10.1016/s0002-9394(02)01422-8. [DOI] [PubMed] [Google Scholar]
  • 33.Read RM, Spaeth G. The natural history of cup progression and some specific disc field correlations. Trans Am Acad Ophthalmol Otolaryngol. 1974;78:OP255–74. [PubMed] [Google Scholar]
  • 34.Kim J, Dally LG, Ederer F, Gaasterland DE, VanVeldhuisen PC, Blackwell B, Sullivan EK, Prum B, Shafranov G, Beck A, Spaeth GL, Investigators A. The Advanced Glaucoma Intervention Study (AGIS): 14. Distinguishing progression of glaucoma from visual field fluctuations. Ophthalmology. 2004;111:2109–16. doi: 10.1016/j.ophtha.2004.06.029. [DOI] [PubMed] [Google Scholar]
  • 35.Bustin SA, Beaulieu JF, Huggett J, Jaggi R, Kibenge FS, Olsvik PA, Penning LC, Toegel S. MIQE precis: Practical implementation of minimum standard guidelines for fluorescence-based quantitative real-time PCR experiments. BMC Mol Biol. 2010;11:74. doi: 10.1186/1471-2199-11-74. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Spaeth GL. Prognostic factors for progression of visual field damage in patients with normal-tension glaucoma. Jpn J Ophthalmol. 2007;51:156–7. doi: 10.1007/s10384-006-0415-0. [DOI] [PubMed] [Google Scholar]
  • 37.Allingham RR, Liu Y, Rhee DJ. The genetics of primary open-angle glaucoma: a review. Exp Eye Res. 2009;88:837–44. doi: 10.1016/j.exer.2008.11.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Liu Y, Munro D, Layfield D, Dellinger A, Walter J, Peterson K, Rickman CB, Allingham RR, Hauser MA. Serial analysis of gene expression (SAGE) in normal human trabecular meshwork. Mol Vis. 2011;17:885–93. [PMC free article] [PubMed] [Google Scholar]
  • 39.Pfeffer BA, DeWitt CA, Salvador-Silva M, Cavet ME, Lopez FJ, Ward KW. Reduced myocilin expression in cultured monkey trabecular meshwork cells induced by a selective glucocorticoid receptor agonist: comparison with steroids. Invest Ophthalmol Vis Sci. 2010;51:437–46. doi: 10.1167/iovs.09-4202. [DOI] [PubMed] [Google Scholar]
  • 40.Liton PB, Luna C, Challa P, Epstein DL, Gonzalez P. Genome-wide expression profile of human trabecular meshwork cultured cells, nonglaucomatous and primary open angle glaucoma tissue. Mol Vis. 2006;12:774–90. [PMC free article] [PubMed] [Google Scholar]
  • 41.Coimbra RS, Voisin V, de Saizieu AB, Lindberg RL, Wittwer M, Leppert D, Leib SL. Gene expression in cortex and hippocampus during acute pneumococcal meningitis. BMC Biol. 2006;4:15. doi: 10.1186/1741-7007-4-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Kurian SM, Le-Niculescu H, Patel SD, Bertram D, Davis J, Dike C, Yehyawi N, Lysaker P, Dustin J, Caligiuri M, Lohr J, Lahiri DK, Nurnberger JI, Jr, Faraone SV, Geyer MA, Tsuang MT, Schork NJ, Salomon DR, Niculescu AB. Identification of blood biomarkers for psychosis using convergent functional genomics. Mol Psychiatry. 2011 doi: 10.1038/mp.2009.117. [DOI] [PubMed] [Google Scholar]
  • 43.Saris CG, Horvath S, van Vught PW, van Es MA, Blauw HM, Fuller TF, Langfelder P, DeYoung J, Wokke JH, Veldink JH, van den Berg LH, Ophoff RA. Weighted gene co-expression network analysis of the peripheral blood from Amyotrophic Lateral Sclerosis patients. BMC Genomics. 2009;10:405. doi: 10.1186/1471-2164-10-405. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Hu VW, Nguyen A, Kim KS, Steinberg ME, Sarachana T, Scully MA, Soldin SJ, Luu T, Lee NH. Gene expression profiling of lymphoblasts from autistic and nonaffected sib pairs: altered pathways in neuronal development and steroid biosynthesis. PLoS ONE. 2009;4:e5775. doi: 10.1371/journal.pone.0005775. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Takahashi M, Hayashi H, Watanabe Y, Sawamura K, Fukui N, Watanabe J, Kitajima T, Yamanouchi Y, Iwata N, Mizukami K, Hori T, Shimoda K, Ujike H, Ozaki N, Iijima K, Takemura K, Aoshima H, Someya T. Diagnostic classification of schizophrenia by neural network analysis of blood-based gene expression signatures. Schizophrenia Research. doi: 10.1016/j.schres.2009.12.024. [DOI] [PubMed] [Google Scholar]
  • 46.Paper W, Kroeber M, Heersink S, Stephan DA, Fuchshofer R, Russell P, Tamm ER. Elevated amounts of myocilin in the aqueous humor of transgenic mice cause significant changes in ocular gene expression. Exp Eye Res. 2008;87:257–67. doi: 10.1016/j.exer.2008.06.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Ray K, Mookherjee S. Molecular complexity of primary open angle glaucoma: current concepts. J Genet. 2009;88:451–67. doi: 10.1007/s12041-009-0065-3. [DOI] [PubMed] [Google Scholar]
  • 48.del Toro D, Alberch J, Lazaro-Dieguez F, Martin-Ibanez R, Xifro X, Egea G, Canals JM. Mutant huntingtin impairs post-Golgi trafficking to lysosomes by delocalizing optineurin/Rab8 complex from the Golgi apparatus. Mol Biol Cell. 2009;20:1478–92. doi: 10.1091/mbc.E08-07-0726. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Fenner BJ, Scannell M, Prehn JH. Identification of polyubiquitin binding proteins involved in NF-kappaB signaling using protein arrays. Biochim Biophys Acta. 2009;1794:1010–6. doi: 10.1016/j.bbapap.2009.02.013. [DOI] [PubMed] [Google Scholar]
  • 50.Park BC, Shen X, Samaraweera M, Yue BY. Studies of optineurin, a glaucoma gene: Golgi fragmentation and cell death from overexpression of wild-type and mutant optineurin in two ocular cell types. Am J Pathol. 2006;169:1976–89. doi: 10.2353/ajpath.2006.060400. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Park BC, Tibudan M, Samaraweera M, Shen X, Yue BY. Interaction between two glaucoma genes, optineurin and myocilin. Genes to Cells: Devoted to Molecular & Cellular Mechanisms. 2007;12:969–79. doi: 10.1111/j.1365-2443.2007.01102.x. [DOI] [PubMed] [Google Scholar]
  • 52.Anborgh PH, Godin C, Pampillo M, Dhami GK, Dale LB, Cregan SP, Truant R, Ferguson SS. Inhibition of metabotropic glutamate receptor signaling by the huntingtin-binding protein optineurin. J Biol Chem. 2005;280:34840–8. doi: 10.1074/jbc.M504508200. [DOI] [PubMed] [Google Scholar]

Articles from Molecular Vision are provided here courtesy of Emory University and the Zhongshan Ophthalmic Center, Sun Yat-sen University, P.R. China

RESOURCES