Abstract
qnr, aac(6′)-Ib-cr, qepA, and oqxAB genes were detected in 5.7%, 4.9%, 2.6%, and 20.2% of 1,022 Escherichia coli isolates from humans, animals, and the environment, respectively, collected between 1993 and 2010 in China. The prevalence of oqxAB in porcine isolates (51.0%) was significantly higher than that in other isolates. This is the first report of oqxAB-positive isolates from ducks and geese and as early as 1994 from chickens.
TEXT
Quinolone resistance was thought to be acquired only by chromosomal mutations, until plasmid-mediated quinolone resistance (PMQR) was described in 1998 (9). Since then, five major groups of Qnr determinants (QnrA, QnrB, QnrC, QnrD, and QnrS) have been identified (14, 16). Two additional PMQR determinants, Aac(6′)-Ib-cr (13) and quinolone extrusion by QepA or OqxAB (14, 16), have been also described. OqxAB, conferring resistance to quinoxaline-di-N-oxide olaquindox (a quinoxaline derivative used as a veterinary growth promoter) was originally identified in an Escherichia coli isolate from swine manure (6, 15). PMQR genes are increasingly being identified worldwide in clinical isolates of Enterobacteriaceae. However, OqxAB was not recognized as a PMQR determinant until recently. Thus, data on the prevalence and epidemiology of oqxAB are limited compared with data on other PMQR genes (16). Here, we report on the prevalence of PMQR genes, including oqxAB, in a collection of E. coli isolates from humans, animals, and the environment in China.
In total, 1,022 E. coli isolates were collected from China between 1993 and 2010. A total of 307 isolates were obtained from feces and urine samples from healthy volunteers or patients, 671 isolates were obtained from heart, liver, spleen, blood, or feces samples of diseased or healthy animals (specifically, 384 chickens, 32 cattle, 6 dogs, 11 ducks, 40 geese, and 198 pigs), and 44 isolates were randomly collected from the environment on different farms, including surface soil, sewage, drinking water, and pond water. Each isolate was from a separate specimen.
All isolates were screened for oqxA and other PMQR genes [i.e., qnrA, qnrB, qnrC, qnrD, qnrS, aac(6′)-Ib-cr, and qepA] by PCR (Table 1). All oqxA-positive isolates were also screened for oqxB (8). Both strands of the purified PCR products were sequenced, and qnr alleles were assigned by referring to the qnr gene nomenclature (7). All isolates PCR positive for aac(6′)-Ib were further analyzed by digestion with FokI and/or direct sequencing to identify aac(6′)-Ib-cr.
Table 1.
PCR primers used to detect plasmid-mediated quinolone resistance genes
| Primer | Sequence (5′–3′) | Target | Tm (°C)a | Size of product (bp) | Reference or source |
|---|---|---|---|---|---|
| qnrA-F | AGAGGATTTCTCACGCCAGG | qnrA | 57 | 619 | This study |
| qnrA-R | GCAGCACTATKACTCCCAAGG | ||||
| qnrB-F | GGMATHGAAATTCGCCACTG | qnrB | 57 | 264 | Cattoir et al. (2) |
| qnrB-R | TTTGCYGYYCGCCAGTCGAA | ||||
| qnrC-F | GGGTTGTACATTTATTGAATC | qnrC | 57 | 447 | Wang et al. (18) |
| qnrC-R | TCCACTTTACGAGGTTCT | ||||
| qnrD-F | CGAGATCAATTTACGGGGAATA | qnrD | 57 | 582 | Cavaco et al. (3) |
| qnrD-R | AACAAGCTGAAGCGCCTG | ||||
| qnrS-F | GCAAGTTCATTGAACAGGCT | qnrS | 57 | 428 | Cattoir et al. (2) |
| qnrS-R | TCTAAACCGTCGAGTTCGGCG | ||||
| qepA-F | CTGCAGGTACTGCGTCATG | qepA | 60 | 403 | Cattior et al. (1) |
| qepA-R | CGTGTTGCTGGAGTTCTTC | ||||
| oqxA-F | GACAGCGTCGCACAGAATG | oqxA | 62 | 339 | This study |
| oqxA-R | GGAGACGAGGTTGGTATGGA | ||||
| oqxB-F | CGAAGAAAGACCTCCCTACCC | oqxB | 62 | 240 | This study |
| oqxB-R | CGCCGCCAATGAGATACA | ||||
| aac-F | TTGCGATGCTCTATGAGTGGCTA | aac(6′)-Ib | 57 | 482 | Park et al. (12) |
| aac-R | CTCGAATGCCTGGCGTGTTT |
Melting temperature.
Among the 1,022 E. coli isolates, PMQR genes were present in 281 (27.5%) isolates; qnr, aac(6′)-Ib-cr, qepA, and oqxAB were detected alone or in combination in 58 (5.7%), 50 (4.9%), 27 (2.6%), and 206 (20.2%) isolates, respectively. None of the isolates carried qnrC or qnrD. The detected qnr genes included 1 qnrA1, 3 qnrA3, 1 qnrB2, 1 qnrB4, 7 qnrB9, 2 qnrB10, 35 qnrS1, and 8 qnrS2 genes. PMQR genes were detected in isolates from chickens (23.7%), ducks (27.3%), geese (15.0%), pigs (59.6%), humans (14.3%), dogs (50.0%), and the environment (36.4%). In this study, oqxAB was the most common PMQR gene and was found as early as 1994 from chickens, whereas qnrA, qnrB, qnrS, aac(6′)-Ib-cr, and qepA emerged in 2004 from pigs, in 2007 from humans, in 2003 from pigs, in 2003 from pigs, and in 2003 from chickens, respectively. Notably, 42 isolates in this study were positive for two PMQR genes, while 9 isolates were positive for three PMQR genes. Isolates with more than one PMQR gene were commonly isolated from the environment (25.0%; 11/44).
The prevalence of PMQR genes in animal intestinal isolates was 45.6% (129/283), which was significantly higher than those in the animal extraintestinal isolates (23.7%) and human isolates (14.3%) (P < 0.005). The prevalence of oqxAB in animal isolates was 27.0% (181/671), which was significantly higher than that in human isolates (5.2%) (P < 0.005). A surprisingly high prevalence of oqxAB (39.0%) was recently detected in E. coli isolates from animals, farmworkers, and the environment in Guangdong province during 2002 (19). The prevalence of oqxAB in China was significantly higher than those previously reported for Denmark, Sweden (1.8%), and South Korea (0.4%) (14). In this study, the prevalence of oqxAB in pigs (51.0%; 101/198) was significantly higher than those in chickens (19.8%; 76/384) and other animals (4.5%; 4/89) (P < 0.005) (Table 2). Olaquindox was commonly used as a therapeutic and preventive antibiotic in swine in China and was allowed at a concentration of 50 ppm in feed for pigs below 35 kg. However, olaquindox was forbidden in poultry and aquaculture since 2001 (10), which may explain the relatively low prevalence of oqxAB in chickens, ducks, geese, cattle, and dogs.
Table 2.
Distribution of PMQR genes in 1,022 E. coli isolates of human, animal, and environmental origins
| Source | No. of isolates | % of PMQR genes (no. of isolates) |
||||||
|---|---|---|---|---|---|---|---|---|
| qnrA | qnrB | qnrS | aac(6′)-Ib-cr | qepA | oqxAB | PMQR | ||
| Humans | ||||||||
| Commensal isolates | 52 | 3.8 (2) | 3.8 (2) | 7.7 (4) | ||||
| Diarrheal isolates | 42 | 7.1 (3) | 4.8 (2) | 9.5 (4) | 19.0 (8) | |||
| Extraintestinal isolates | 213 | 0.5 (1) | 1.4 (3) | 5.2 (11) | 4.2 (9) | 4.7 (10) | 15.0 (32) | |
| Total | 307 | 0.3 (1) | 2.6 (8) | 3.6 (11) | 3.6 (11) | 5.2 (16) | 14.3 (44) | |
| Chickens | ||||||||
| Commensal isolates | 16 | 12.5 (2) | 18.8 (3) | 43.8 (7) | 18.8 (3) | 68.8 (11) | ||
| Diarrheal isolates | 7 | 57.1 (4) | 28.6 (2) | 57.1 (4) | ||||
| Extraintestinal isolates | 361 | 0.8 (3) | 0.6 (2) | 1.4 (5) | 0.3 (1) | 19.7 (71) | 21.1 (76) | |
| Total | 384 | 1.3 (5) | 1.3 (5) | 3.1 (12) | 1.3 (5) | 19.8 (76) | 23.7 (91) | |
| Pigs | ||||||||
| Commensal isolates | 10 | 40.0 (4) | 10.0 (1) | 50.0 (5) | 70.0 (7) | |||
| Diarrheal isolates | 173 | 2.3 (4) | 7.5 (13) | 6.9 (12) | 5.2 (9) | 47.4 (82) | 56.1 (97) | |
| Extraintestinal isolates | 15 | 93.3 (14) | 93.3 (14) | |||||
| Total | 198 | 2.0 (4) | 8.6 (17) | 6.6 (13) | 4.5 (9) | 51.0 (101) | 59.6 (118) | |
| Other animalsa | ||||||||
| Commensal isolates | 69 | 2.9 (2) | 4.3 (3) | 5.8 (4) | 2.9 (2) | 10.1 (7) | ||
| Diarrheal isolates | 8 | 12.5 (1) | 25.0 (2) | 37.5 (3) | ||||
| Extraintestinal isolates | 12 | 16.7 (2) | 16.7 (2) | |||||
| Total | 89 | 2.2 (2) | 4.5 (4) | 4.5 (4) | 2.2 (2) | 4.5 (4) | 13.5 (12) | |
| Environment | 44 | 6.8 (3) | 20.5 (9) | 22.7 (10) | 20.5 (9) | 36.4 (16) | ||
| Total | 1,022 | 0.4 (4) | 1.1 (11) | 4.2 (43) | 4.9 (50) | 2.6 (27) | 20.2 (206) | 27.5 (281) |
Other animals include cattle (32 isolates), dogs (6 isolates), ducks (11 isolates), and geese (40 isolates).
In these 281 PMQR-positive isolates, 89 isolates with distinct PMQR genes or sources (specifically, 27 humans, 24 chickens, 24 pigs, 9 environmental sources, and 5 other animals) were selected for conjugation experiments using J53 Azr (i.e., azide resistant) as the recipient strain (17). Transconjugants were selected on tryptic soy agar plates containing sodium azide (100 μg/ml) and tetracycline (20 μg/ml), chloramphenicol (50 μg/ml), gentamicin (8 μg/ml), or amoxicillin (100 μg/ml). A total of 41 transconjugants were successfully obtained at a frequency of 10−7 to 10−3 cells per recipient. Nine (22.5%) transconjugants carrying oqxAB were successfully obtained from 40 OqxAB-producing isolates. Cotransfer of resistance to ampicillin, tetracycline, trimethoprim-sulfamethoxazole, and chloramphenicol was observed in 36 (87.8%), 30 (73.2%), 26 (63.4%), and 20 (48.8%) of the 41 transconjugants, respectively. MICs of 41 E. coli isolates (including 15 oqxAB-positive and 26 oqxAB-negative isolates) were determined by the broth microdilution method according to CLSI guidelines (4, 5). The isolates with oqxAB had olaquindox MICs of ≥64 μg/ml. Transconjugants carrying oqxAB showed 4- to 32-fold increases in olaquindox MICs compared with those of the recipient. This is consistent with the oqxAB genotype, suggesting that oqxAB has a role in olaquindox resistance, as reported by other studies (6, 19). Transfer of the qnr gene can elevate ciprofloxacin MICs by 16- to 64-fold relative to those of the recipient, which is greater than the effects of qepA and aac(6′)-Ib-cr (Table 3).
Table 3.
Results on conjugative transfer experiments and QRDR statusd
| Strain | PMQR determinant(s) | Specimen | MIC (μg/ml)a |
MDR phenotypeb | QRDRc mutation(s) in: |
||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| NAL | OLA | CIP | NOR | OFX | LVX | gyrA | parC | ||||
| U027 | aac(6′)-Ib-cr | Human urine | 512 | 8 | 0.25 | 1 | 0.5 | 0.25 | AMP, TET, SXT, CHL, GEN, CEF, AMK | S83L | WT |
| T-U027 | aac(6′)-Ib-cr | 4 | 8 | 0.016 | 0.06 | 0.03 | 0.03 | AMP, TET, SXT, CHL, GEN | |||
| U054 | aac(6′)-Ib-cr | Human urine | >1024 | 4 | 64 | 256 | 32 | 16 | AMP, TET, SXT, CHL, GEN, CEF, CAZ, ATM | S83L, D87N | S80I |
| T-U054 | aac(6′)-Ib-cr | 4 | 8 | 0.016 | 0.06 | 0.03 | 0.03 | AMP | |||
| U072 | aac(6′)-Ib-cr | Human urine | >1024 | 4 | 1 | 8 | 2 | 0.5 | AMP, TET, SXT, GEN, STR, CEF | S83L | S80I |
| T-U072 | aac(6′)-Ib-cr | 8 | 4 | 0.016 | 0.06 | 0.03 | 0.03 | AMP, TET, SXT, STR, CEF | |||
| U175 | aac(6′)-Ib-cr | Human urine | >1024 | 16 | 128 | 256 | 32 | 32 | AMP, TET, SXT, CHL, STR, CEF, CAZ, ATM, AMK | S83L, D87N | S80I |
| T-U175 | aac(6′)-Ib-cr | 4 | 4 | 0.008 | 0.06 | 0.03 | 0.03 | AMP, TET, SXT, CHL, STR, CEF | |||
| U220 | aac(6′)-Ib-cr | Human urine | >1024 | 8 | 256 | 256 | 32 | 16 | AMP, TET, SXT, GEN, STR, CEF, CAZ | S83L, D87N | S80I |
| T-U220 | aac(6′)-Ib-cr | 4 | 8 | 0.016 | 0.06 | 0.03 | 0.03 | AMP, TET, SXT, STR, CEF | |||
| U242 | aac(6′)-Ib-cr | Human urine | >1024 | 16 | 128 | 256 | 32 | 16 | AMP, TET, CEF | S83L, D87N | S80I |
| T-U242 | aac(6′)-Ib-cr | 4 | 8 | 0.016 | 0.06 | 0.06 | 0.03 | AMP, TET | |||
| U015 | qepA | Human urine | >1024 | 16 | 128 | >256 | 32 | 16 | AMP, TET, SXT, GEN, STR, CEF, CAZ, CTX, ATM, AMK | S83L, D87N | S80I |
| T-U015 | qepA | 4 | 8 | 0.03 | 0.25 | 0.03 | 0.016 | AMP, TET, SXT, GEN, CEF, CTX, ATM, AMK | |||
| U155 | qepA | Human urine | >1024 | 4 | 128 | 256 | 16 | 16 | AMP, TET, SXT, CHL, GEN, STR, CEF, CAZ, CTX, ATM | S83L, D87N | S80I |
| T-U155 | qepA | 4 | 8 | 0.06 | 0.25 | 0.06 | 0.03 | AMP, GEN, CEF, CAZ, CTX, ATM | |||
| U222 | qepA | Human urine | >1024 | 8 | >256 | >256 | 64 | 32 | AMP, TET, SXT, CHL, GEN, STR, PIP, CEF, CTX, AMK | S80L, D87N | S80I |
| T-U222 | qepA | 4 | 8 | 0.016 | 0.125 | 0.03 | 0.016 | AMP, SXT, CHL, GEN, PIP, CEF, AMK | |||
| C023 | qnrA1, oqxAB, aac(6′)-Ib-cr | Pig feces | >1024 | 128 | 8 | 32 | 16 | 8 | AMP, TET, SXT, GEN, STR | S83L | S80I |
| T-C023 | qnrA1, aac(6′)-Ib-cr | 16 | 8 | 0.25 | 1 | 0.5 | 0.25 | AMP, GEN | |||
| C040 | qnrA3, aac(6′)-Ib-cr | Pig feces | 32 | 2 | ≤0.125 | 0.5 | 0.25 | 0.25 | AMP, TET, SXT, GEN, STR | WT | WT |
| T-C040 | qnrA3, aac(6′)-Ib-cr | 16 | 4 | 0.125 | 0.5 | 0.25 | 0.125 | AMP, TET, SXT | |||
| C041 | qnrA3, aac(6′)-Ib-cr | Pig feces | 16 | 2 | ≤0.125 | 0.5 | 0.25 | 0.25 | AMP, TET, SXT, GEN, STR | WT | WT |
| T-C041 | qnrA3, aac(6′)-Ib-cr | 16 | 4 | 0.25 | 0.5 | 0.25 | 0.125 | AMP, TET, SXT | |||
| C042 | qnrA3, aac(6′)-Ib-cr | Pig feces | 16 | 2 | ≤0.125 | 0.5 | 0.5 | 0.25 | AMP, TET, SXT, GEN, STR | WT | WT |
| T-C042 | qnrA3, aac(6′)-Ib-cr | 16 | 4 | 0.125 | 0.5 | 0.25 | 0.125 | AMP, TET, SXT | |||
| C053 | qnrS1 | Pig feces | 8 | 8 | ≤0.125 | 0.25 | 0.5 | 0.25 | AMP, CHL | WT | WT |
| T-C053 | qnrS1 | 32 | 4 | 0.25 | 0.5 | 1 | 0.5 | AMP, CHL | |||
| C058 | qnrS1 | Pig feces | 16 | 32 | ≤0.125 | 0.25 | 0.5 | 0.25 | AMP, TET, SXT | WT | WT |
| T-C058 | qnrS1 | 32 | 4 | 0.25 | 0.5 | 1 | 0.5 | AMP | |||
| C111 | qnrS1 | Pig feces | 256 | 8 | 0.5 | 1 | 4 | 2 | AMP, TET, SXT, CHL, STR, PIP | S83L | WT |
| T-C111 | qnrS1 | 32 | 4 | 0.25 | 0.5 | 1 | 0.5 | AMP, TET, SXT, CHL, PIP | |||
| C112 | qnrS1 | Pig feces | 256 | 8 | 0.5 | 1 | 8 | 2 | AMP, TET, SXT, CHL, STR, PIP | S83L | WT |
| T-C112 | qnrS1 | 32 | 4 | 0.25 | 0.5 | 1 | 0.5 | AMP, TET, SXT, CHL, PIP | |||
| C113 | qnrS1 | Pig feces | 256 | 16 | 0.5 | 1 | 4 | 4 | AMP, TET, SXT, CHL, STR, PIP | S83L | WT |
| T-C113 | qnrS1 | 32 | 4 | 0.25 | 0.5 | 1 | 0.5 | AMP, TET, SXT, CHL, PIP | |||
| C194 | qnrS1 | Pig feces | 16 | 32 | ≤0.125 | 0.25 | 0.5 | 0.25 | AMP, TET, GEN, STR, FOF | WT | A56T |
| T-C194 | qnrS1 | 32 | 4 | 0.125 | 0.5 | 1 | 0.5 | AMP | |||
| C261 | qnrS1 | Human feces | 32 | 4 | ≤0.125 | 0.25 | 0.5 | 0.25 | AMP, TET, SXT | WT | WT |
| T-C261 | qnrS1 | 32 | 4 | 0.25 | 0.5 | 1 | 0.5 | TET, SXT | |||
| C263 | qnrS1 | Dog feces | 16 | 8 | ≤0.125 | 0.5 | 0.5 | 0.5 | AMP, TET, SXT, GEN, STR, PIP | WT | WT |
| T-C263 | qnrS1 | 16 | 4 | 0.125 | 0.5 | 1 | 0.5 | AMP | |||
| C389 | qnrS1 | Chicken feces | 32 | 8 | ≤0.125 | 0.25 | 0.5 | 0.5 | AMP, TET, SXT, FOF | WT | WT |
| T-C389 | qnrS1 | 32 | 4 | 0.25 | 0.5 | 1 | 0.5 | TET, SXT | |||
| U033 | qnrS1 | Human urine | >1024 | 4 | 16 | 128 | 64 | 32 | AMP, TET, GEN, PIP | S83L, D87N | S80I |
| T-U033 | qnrS1 | 16 | 8 | 0.5 | 1 | 1 | 0.5 | AMP, TET, GEN, PIP | |||
| U116 | qnrS1 | Human urine | >1024 | 16 | 32 | 128 | 64 | 64 | AMP, TET, GEN, PIP | S83L, D87N | S80I |
| T-U116 | qnrS1 | 32 | 8 | 0.25 | 0.5 | 1 | 0.5 | AMP, TET, GEN, PIP | |||
| U145 | qnrS1 | Human urine | >1024 | 32 | 64 | 256 | 128 | 64 | AMP, TET, GEN, CEF | S83L, D87N | S80I |
| T-U145 | qnrS1 | 32 | 4 | 0.25 | 0.5 | 1 | 0.5 | AMP, TET | |||
| C193 | qnrS1, oqxAB | Pig feces | 64 | 64 | 0.25 | 0.5 | 2 | 1 | AMP, TET, SXT, GEN, STR, FOF | WT | A56T |
| T-C193 | qnrS1 | 32 | 4 | 0.25 | 0.5 | 1 | 0.5 | AMP, TET, SXT | |||
| C544 | qnrS1, oqxAB | Chicken feces | 64 | 128 | 0.25 | 1 | 2 | 0.5 | AMP, TET, SXT, CHL, GEN, STR, PIP, CEF, CTX, AMK, FOF | WT | WT |
| T-C544 | qnrS1 | 32 | 4 | 0.125 | 0.5 | 1 | 0.5 | AMP, TET, SXT, CHL, STR | |||
| C052 | qnrS1, oqxAB | Pig feces | 32 | 128 | 0.25 | 0.5 | 1 | 0.5 | AMP, TET, SXT, CHL, GEN, STR, PIP | WT | WT |
| T-C052 | qnrS1 | 32 | 4 | 0.125 | 0.5 | 1 | 0.5 | AMP, CHL | |||
| C054 | qnrS1, oqxAB | Pig feces | 32 | 64 | 0.25 | 0.5 | 1 | 0.5 | AMP, TET, SXT, CHL, GEN, STR | WT | WT |
| T-C054 | qnrS1 | 32 | 8 | 0.125 | 0.5 | 1 | 0.5 | AMP, CHL | |||
| C055 | qnrS1, oqxAB | Pig feces | 32 | 64 | ≤0.125 | 0.5 | 1 | 0.5 | AMP, TET, SXT, CHL, GEN, STR | WT | WT |
| T-C055 | qnrS1 | 16 | 4 | 0.125 | 0.5 | 1 | 0.5 | AMP, CHL | |||
| C594 | qnrS1, oqxAB | Dust | 32 | 128 | ≤0.125 | 0.5 | 1 | 0.5 | TET, SXT, CHL | WT | WT |
| T-C594 | qnrS1, oqxAB | 64 | 32 | 0.25 | 1 | 1 | 0.5 | TET, SXT, CHL | |||
| C709 | qnrS1, oqxAB | Dust | 32 | 128 | 0.25 | 0.5 | 1 | 0.5 | AMP, TET, AMK, SXT, CHL | WT | WT |
| T-C709 | qnrS1, oqxAB | 64 | 32 | 0.25 | 1 | 2 | 0.5 | TET, SXT, CHL | |||
| C056 | qnrS1, oqxAB, aac(6′)-Ib-cr | Pig feces | 128 | 128 | 1 | 2 | 2 | 0.5 | AMP, TET, SXT, CHL, GEN, STR, FOF | WT | WT |
| T-C056 | oqxAB, aac(6′)-Ib-cr | 32 | 256 | 0.03 | 0.125 | 0.06 | 0.03 | AMP, TET, SXT, CHL, GEN | |||
| C578 | qnrS1, aac(6′)-Ib-cr | Duck feces | 32 | 32 | 0.5 | 1 | 1 | 0.5 | AMP, TET, SXT | WT | WT |
| T-C578 | qnrS1, aac(6′)-Ib-cr | 32 | 8 | 0.5 | 1 | 1 | 0.5 | AMP, TET, SXT | |||
| C197 | qnrS2, aac(6′)-Ib-cr | Pig feces | 32 | 4 | 0.25 | 1 | 0.5 | 0.25 | AMP, TET, SXT, STR | WT | WT |
| T-C197 | qnrS2, aac(6′)-Ib-cr | 32 | 4 | 0.5 | 1 | 1 | 0.5 | AMP, TET, SXT | |||
| C265 | oqxAB, aac(6′)-Ib-cr | Chicken liver | >1024 | 128 | 8 | 32 | 8 | 4 | AMP, TET, SXT, CHL, GEN, CEF | S83L, D87N | S80R |
| T-C265 | oqxAB, aac(6′)-Ib-cr | 32 | 64 | 0.03 | 0.125 | 0.06 | 0.03 | AMP, TET, SXT, CHL | |||
| C324 | oqxAB, aac(6′)-Ib-cr | Chicken liver | >1024 | 256 | 32 | 64 | 16 | 8 | AMP, TET, SXT, CHL, GEN, CEF, CAZ | S83L, D87N | S80I |
| T-C324 | oqxAB, aac(6′)-Ib-cr | 16 | 128 | 0.016 | 0.125 | 0.06 | 0.03 | AMP, TET, SXT, CHL | |||
| C327 | oqxAB, aac(6′)-Ib-cr | Chicken liver | >1024 | 512 | 64 | 128 | 32 | 16 | AMP, TET, SXT, CHL, GEN, CEF, ATM, AMK, FOF, NIT | S83L, D87G | S80I |
| T-C327 | oqxAB, aac(6′)-Ib-cr | 16 | 128 | 0.016 | 0.125 | 0.06 | 0.03 | AMP, TET, SXT, CHL | |||
| C034 | oqxAB | Pig feces | >1024 | 128 | 8 | 32 | 16 | 8 | AMP, TET, SXT, PIP, GEN, STR | S83L, D87Y | S80I |
| T-C034 | oqxAB | 32 | 64 | 0.016 | 0.125 | 0.06 | 0.03 | TET, GEN | |||
| C671 | oqxAB | Chicken feces | >1024 | 128 | 16 | 32 | 16 | 8 | AMP, TET, SXT, CHL, STR, CEF | S83L, D87N | S80I |
| T-C671 | oqxAB | 32 | 64 | 0.03 | 0.125 | 0.06 | 0.03 | AMP, TET, SXT, PIP, CEF | |||
| U080 | oqxAB | Human urine | >1024 | 256 | 64 | 128 | 32 | 16 | AMP, TET, SXT, CHL, STR | S83L, D87N | S80I |
| T-U080 | oqxAB | 32 | 64 | 0.03 | 0.125 | 0.06 | 0.03 | AMP, TET, SXT, CHL | |||
| J53 Azr | 4 | 8 | 0.008 | 0.016 | 0.03 | 0.016 | |||||
CIP, ciprofloxacin; LVX, levofloxacin; NAL, nalidixic acid; NOR, norfloxacin; OFX, ofloxacin; OLA, olaquindox.
Multidrug resistance (MDR) phenotype abbreviations are as follows: AMK, amikacin; AMP, ampicillin; ATM, aztreonam; CAZ, ceftazidime; CEF, cephalothin; CHL, chloramphenicol; CTX, cefotaxime; FOF, fosfomycin; GEN, gentamicin; NIT, nitrofurantoin; PIP, piperacillin; STR, streptomycin; SXT, trimethoprim-sulfamethoxazole; TET, tetracycline.
QRDR, quinolone resistance-determining region; S83L, mutation of the amino acid at codon 83 from S to L (etc.); WT, wild type (i.e., no mutation).
The “T-” prefix indicates a transconjugant.
The quinolone resistance-determining regions (QRDRs) of the gyrA and parC genes in PMQR-positive isolates were sequenced to confirm the mutations as previously described (11). Of the 41 E. coli isolates, 17 (41.5%) had wild-type gyrA and parC genes, and these isolates had ciprofloxacin MICs ranging from ≤0.125 to 1 μg/ml. Mutations in both gyrA (S83 and D87) and parC (S80) were detected in 16 (39.0%) isolates, with ciprofloxacin MICs of 8 to >256 μg/ml. In the absence of oqxAB, olaquindox MICs in the isolates without QRDRs mutations were similar to those of isolates with up to three mutations (4 to 32 μg/ml), suggesting that the QRDR mutations do not affect olaquindox susceptibility (Table 3).
In conclusion, oqxAB was prevalent and widespread in E. coli isolates from humans, animals, and the environment in China. This study is the first report on the occurrence of oqxAB in isolates from ducks and geese and as early as 1994 from chickens.
Nucleotide sequence accession numbers.
The sequences of the qnr genes found in this study were deposited in GenBank under accession numbers JF773308 to JF773350.
ACKNOWLEDGMENTS
We are grateful to M. Wang for kindly providing E. coli strain J53 Azr and qnrC-positive plasmid, to Y. Jiang for kindly donating the control strains positive for qnrA, qnrB, qnrS, and aac(6′)-Ib-cr, to K. Yamane for the gift of the qepA-positive control strain, and to L. Cavaco for providing the qnrD-positive plasmid.
This work was supported in part by grant 31001079 from NSFC, grants 09KJB230002 and 2009KJA230001 from NSF of Jiangsu Higher Education Institutions, grant KZCX2-EW-QN411 from the Knowledge Innovation Program of CAS, grant IRT0978 from the Program for Changjiang Scholars and Innovative Research Team in University, and the project funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions.
Footnotes
Published ahead of print 5 March 2012
REFERENCES
- 1. Cattoir V, Poirel L, Nordmann P. 2008. Plasmid-mediated quinolone resistance pump QepA2 in an Escherichia coli isolate from France. Antimicrob. Agents Chemother. 52:3801–3804 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Cattoir V, Poirel L, Rotimi V, Soussy CJ, Nordmann P. 2007. Multiplex PCR for detection of plasmid-mediated quinolone resistance qnr genes in ESBL-producing enterobacterial isolates. J. Antimicrob. Chemother. 60:394–397 [DOI] [PubMed] [Google Scholar]
- 3. Cavaco LM, Hasman H, Xia S, Aarestrup FM. 2009. qnrD, a novel gene conferring transferable quinolone resistance in Salmonella enterica serovars Kentucky and Bovismorbificans of human origin. Antimicrob. Agents Chemother. 53:603–608 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Clinical and Laboratory Standards Institute 2008. Performance standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals; approved standard, 3rd ed, document M31–A3. CLSI, Wayne, PA [Google Scholar]
- 5. Clinical and Laboratory Standards Institute 2012. Performance standards for antimicrobial susceptibility testing; 22nd informational supplement (M100–S22). CLSI, Wayne, PA [Google Scholar]
- 6. Hansen LH, Johannesen E, Burmolle M, Sørensen AH, Sørensen SJ. 2004. Plasmid-encoded multidrug efflux pump conferring resistance to olaquindox in Escherichia coli. Antimicrob. Agents Chemother. 48:3332–3337 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Jacoby G, et al. 2008. qnr gene nomenclature. Antimicrob. Agents Chemother. 52:2297–2299 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Kim HB, et al. 2009. oqxAB encoding a multidrug efflux pump in human clinical isolates of Enterobacteriaceae. Antimicrob. Agents Chemother. 53:3582–3584 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Martínez-Martínez L, Pascual A, Jacoby GA. 1998. Quinolone resistance from a transferable plasmid. Lancet 351:797–799 [DOI] [PubMed] [Google Scholar]
- 10. Ministry of Agriculture of the People's Republic of China 2001. Feed drug additives safe use specification. Announcement no. 168 of the Ministry of Agriculture of the People's Republic of China. Ministry of Agriculture, Beijing, China [Google Scholar]
- 11. Morgan-Linnell SK, Becnel Boyd L, Steffen D, Zechiedrich L. 2009. Mechanisms accounting for fluoroquinolone resistance in Escherichia coli clinical isolates. Antimicrob. Agents Chemother. 53:235–241 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Park CH, Robicsek A, Jacoby GA, Sahm D, Hooper DC. 2006. Prevalence in the United States of aac(6′)-Ib-cr encoding a ciprofloxacin-modifying enzyme. Antimicrob. Agents Chemother. 50:3953–3955 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Robicsek A, et al. 2006. Fluoroquinolone modifying enzyme: a novel adaptation of a common aminoglycoside acetyltransferase. Nat. Med. 12:83–88 [DOI] [PubMed] [Google Scholar]
- 14. Rodríguez-Martínez JM, Cano ME, Velasco C, Martínez-Martínez L, Pascual A. 2011. Plasmid-mediated quinolone resistance: an update. J. Infect. Chemother. 17:149–182 [DOI] [PubMed] [Google Scholar]
- 15. Sørensen AH, Hansen LH, Johannesen E, Sørensen SJ. 2003. Conjugative plasmid conferring resistance to olaquindox. Antimicrob. Agents Chemother. 47:798–799 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Strahilevitz J, Jacoby GA, Hooper DC, Robicsek A. 2009. Plasmid-mediated quinolone resistance: a multifaceted threat. Clin. Microbiol. Rev. 22:664–689 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Wang M, et al. 2003. Plasmid-mediated quinolone resistance in clinical isolates of Escherichia coli from Shanghai, China. Antimicrob. Agents Chemother. 47:2242–2248 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Wang M, et al. 2009. New plasmid-mediated quinolone resistance gene, qnrC, found in a clinical isolate of Proteus mirabilis. Antimicrob. Agents Chemother. 53:1892–1897 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Zhao JJ, et al. 2010. Prevalence and dissemination of oqxAB in Escherichia coli isolates from animals, farmworkers, and the environment. Antimicrob. Agents Chemother. 54:4219–4224 [DOI] [PMC free article] [PubMed] [Google Scholar]