Skip to main content
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
. 2012 Jun;56(6):3444–3447. doi: 10.1128/AAC.00316-12

Multiplex Real-Time PCR for Detection of an Epidemic KPC-Producing Klebsiella pneumoniae ST258 Clone

Liang Chen a, Kalyan D Chavda a, José R Mediavilla a, Yanan Zhao a, Henry S Fraimow b, Stephen G Jenkins c, Michael H Levi d, Tao Hong e, Albert D Rojtman f, Christine C Ginocchio g, Robert A Bonomo h, Barry N Kreiswirth a,✉
PMCID: PMC3370784  PMID: 22450983

Abstract

We describe a multiplex real-time PCR assay capable of identifying both the epidemic Klebsiella pneumoniae ST258 clone and blaKPC carbapenemase genes in a single reaction. The assay displayed excellent sensitivity (100%) and specificity (100%) for identification of ST258 clone and blaKPC in a collection of 75 K. pneumoniae isolates comprising 41 sequence types. Our results suggest that this assay is an effective tool for surveillance of this clone among carbapenem-resistant K. pneumoniae clinical isolates.

TEXT

Carbapenem-resistant members of the Enterobacteriaceae (CRE) are rapidly emerging as a significant international public health problem (12). The most common mechanism of carbapenem resistance among Enterobacteriaceae in the United States is production of Klebsiella pneumoniae carbapenemases (KPC). Since their initial identification in 1996 (15), KPC producers have spread globally, becoming endemic in the eastern United States, Puerto Rico, Colombia, Greece, Israel, and eastern China (11, 12). Although KPCs have been found in numerous K. pneumoniae clones as well as in other species, most cases have been associated with a single K. pneumoniae clone, multilocus sequence type 258 (ST258) (1, 2, 5, 9, 12). Accordingly, rapid identification of this clone is of great importance for tracking further dissemination of KPCs, as well as informing infection prevention measures directed against this emerging public health threat. Here, we describe a multiplex real-time PCR assay which can identify both blaKPC (the genetic determinant of KPC) and K. pneumoniae ST258 in a single reaction.

Multilocus sequence typing (MLST) of K. pneumoniae involves sequencing of defined regions in seven housekeeping genes, namely, gapA, infB, mdh, pgi, phoE, rpoB, and tonB (6). Analysis of the K. pneumoniae MLST database (www.pasteur.fr/recherche/genopole/PF8/mlst/Kpneumoniae.html) revealed that strains typed as ST258 harbor a unique tonB allele (tonB79), which thus far is found only in ST258, along with various single-locus (ST379, ST418, ST512, ST554, and ST744) and double-locus (ST650, ST683, and ST745) variants of ST258. In this study, the group of genetically related strains possessing a tonB79 allele are tentatively referred to as the ST258-tonB79 cluster. The specificity of the tonB79 allele provides a unique opportunity for developing a rapid molecular assay to identify and distinguish this emerging clonal type on the basis of two single-nucleotide polymorphisms (SNPs). The design was based on tonB allele sequences available on the Institut Pasteur MLST website, including all STs available prior to 2012 (851 STs in total). At nucleotide (nt) 118 of tonB79, there is a cytosine (C)-to-thymine (T) substitution which is present in only three tonB alleles (tonB79, tonB16, and tonB138) (Table 1). Similarly, there is an adenine (A)-to-cytosine (C) substitution at nt 297, which is shared by 76 of 180 tonB alleles but not the aforementioned alleles tonB16 and tonB138 (Table 1). Among all K. pneumoniae STs, only members of the ST258-tonB79 cluster (ST258, -379, -418, -512, -554, -744, -650, -683, and -745) possess both SNPs.

Table 1.

Oligonucleotide primers and molecular beacon probes used in this study

Primer or probea Sequence (5′–3′)b Length (bp) Targetsc
tonB79-118T-F GAGCCGGAGCCAGAGGTAG 77 tonB79, tonB16, and tonB138
tonB79-118T-R TTCGGCTTAGGTTCCGGTTT
tonB-118T-MB 5′- FAM-cgcgatAAGAGGCGTCGGTGGTGAatcgcg-BHQ-1-3′
tonB79-297C-F1 CTCGCCGTTTGAAAACAACA 87 tonB79, tonB2, tonB4, tonB6, tonB10, etc., but not tonB16 or tonB138
tonB79-297C-R1 GGAGCAGTAACGGTGGGTTT
tonB-297C-MB 5′- CAL Fluor Red 610-cgcgaACCTCGACCGCAGCGtcgcg- BHQ-2-3′
gapA-F CGAAACCGCTCGTAAACACA 140 All K. pneumoniae gapA alleles
gapA-R AGGAAGCGTTGGAAACGATG
gapA-MB 5′-HEX-cgcgatGTTCTGACTGGCCCGTCCAAAGAatcgcg-BHQ-1-3′
KPC-F684 GGCAGTCGGAGACAAAACC 177 blaKPC-2 to blaKPC-13
KPC-R860 CCCTCGAGCGCGAGTCTA
KPC-MB 5′- QUASAR 670-cgcgatCCTATTGTGTTGGCCGTCTAatcgcg-BHQ-2-3′
a

Primers KPC-F684 and KPC-R860 were published previously (4).

b

Molecular beacon hairpin sequences are shown in lowercase letters; single nucleotide polymorphism target positions are underlined. FAM, fluorescein; HEX, hexachlorofluorescein; BHQ, black hole quencher.

c

Probe tonB-297C-MB targets 76 of 180 tonB alleles in the K. pneumoniae MLST database (www.pasteur.fr), including alleles 2, 4, 6, 10, 11, 12, 14, 17, 18, 19, 21, 23, 25, 27, 28, 30, 32, 34, 35, 36, 37, 39, 41, 42, 43, 46, 54, 56, 57, 59, 60, 61, 62, 64, 66, 68, 69, 70, 76, 77, 79, 81, 83, 86, 87, 88, 89, 92, 100, 107, 109, 110, 111, 112, 113, 116, 117, 120, 123, 127, 129, 135, 136, 137, 139, 140, 141, 143, 144, 157, 160, 161, 168, 170, 174, and 177.

Two molecular-beacon probes targeting the C118T and A297C substitutions were designed (Table 1) in order to test whether the combination of these probes (tonB-118T-MB and tonB-297C-MB) could specifically identify STs in the ST258-tonB79 cluster. Concurrently, a separate set of primers and probes was developed in order to simultaneously detect all known blaKPC gene variants (blaKPC-2 to blaKPC-13). An internal positive-control probe was incorporated into the assay in order to confirm DNA template quality and PCR efficiency, using a conserved region from another MLST gene (gapA) as a target (Table 1).

Molecular-beacon design and DNA template isolation were performed using a method described elsewhere (4). Real-time PCR amplification was performed using the Stratagene Mx3005P multiplex quantitative PCR system (Agilent Technologies, Santa Clara, CA). PCR was performed with 10-μl reaction mixtures consisting of 0.5 U of AmpliTaq Gold DNA polymerase (Applied Biosystems, Foster City, CA), 3 mM MgCl2, a 250 μM concentration of each deoxynucleoside triphosphate (dNTP), and a 0.5 μM concentration of each primer in 1× PCR buffer (Applied Biosystems). Molecular-beacon probe concentrations were 0.4 μM for tonB-118T-MB and tonB-297C-MB and 0.2 μM for gapA-MB and KPC-MB. Optimal cycling conditions included an initial denaturation step of 95°C for 10 min, followed by 40 cycles of 95°C for 20 s (denaturation) and 64°C for 45 s (annealing and extension). The entire MB-PCR can be performed in less than 1.5 h on the Mx3005P platform.

Analytical sensitivity was evaluated using synthetic blaKPC (blaKPC-2 to blaKPC-11) targets and bacterial dilutions, as described in a previous study (4). Lower limits of detection based on DNA copy number were reliably detected within 40 cycles as follows: 20 copies per PCR for probes gapA-MB and KPC-MB and 40 copies for tonB-118T-MB and tonB-297C-MB. Limits of detection based on bacterial CFU were also estimated using DNA isolated from serial dilutions of bacterial cultures. The multiplex assay was capable of reproducibly detecting 2 CFU per PCR for gapA-MB and KPC-MB and 4 CFU per PCR for tonB-118T-MB and tonB-297C-MB. The overall detection limit of the MB-PCR assay was therefore approximately 4 CFU per reaction, close to the limits previously described (1 to 2 CFU) for various real-time PCR blaKPC assays (7, 8, 13), thereby suggesting good analytical sensitivity.

The multiplex real-time PCR assay was initially validated using 75 K. pneumoniae clinical isolates comprising a wide variety of STs, selected from our strain collection at the Public Health Research Institute (PHRI) Tuberculosis Center (Table 2). The STs of all 75 isolates were determined using the protocol described on the Institut Pasteur website (6) and were found to comprise 41 distinct STs (Table 2), 20 of which were ST258. All ST258 isolates were positive for both the tonB-118T-MB and tonB-297C-MB targets by multiplex PCR, while non-ST258 isolates were either positive for a single tonB79 target or negative for both (Table 2), demonstrating that the assay can specifically identify ST258 tonB79 cluster members. Within the 75 isolates tested, blaKPC was detected in 39 isolates from 15 different STs (Table 2), showing that KPC is not restricted to a single clone, as has been suggested previously (3). All of the blaKPC genes detected in this study were confirmed using a previously described multiplex real-time PCR (4) as well as a conventional PCR method (14), with results showing 100% concordance. All of the isolates were positive for the gapA-MB internal control target. Overall, our assay demonstrated excellent sensitivity (100%) and specificity (100%) for the identification of both blaKPC genes and the ST258-tonB79 cluster in a collection of 75 K. pneumoniae isolates with different genetic backgrounds.

Table 2.

Multiplex real-time PCR results for 75 K. pneumoniae isolates with different sequence types

ST Allelic profilea n PCR result with:
No. of KPC-MB-positive isolatesb
tonB-118T-MB tonB-297C-MB gapA-MB
258 3-3-1-1-1-1-79 20 + + + 17
37 2-9-2-1-13-1-16 2 + − + 1
556 2-1-1-26-12-15-138 1 + − + 0
8 4-1-1-1-1-5-6 1 − + + 0
13 2-3-1-1-10-1-19 1 − + + 0
16 2-1-2-1-4-4-4 5 − + + 5
17 2-1-1-1-4-4-4 3 − + + 2
20 2-3-1-1-4-4-4 2 − + + 0
23 2-1-1-1-9-4-12 1 − + + 0
29 2-3-2-2-6-4-4 2 − + + 0
39 2-1-2-4-9-1-14 1 − + + 1
45 2-1-1-6-7-1-12 1 − + + 0
54 2-1-1-13-16-15-4 2 − + + 0
70 2-6-17-1-20-10-25 1 − + + 0
86 9-4-2-1-1-1-27 1 − + + 0
101 2-6-1-5-4-1-6 1 − + + 1
111 2-1-5-1-17-4-42 1 − + + 0
133 12-1-1-2-5-1-36 1 − + + 0
134 3-1-2-1-1-1-4 1 − + + 0
193 2-3-2-2-48-4-4 1 − + + 1
268 2-1-2-1-7-1-81 1 − + + 0
309 2-9-2-1-13-1-10 1 − + + 0
326 1-1-1-1-1-1-64 1 − + + 0
327 2-1-1-1-10-1-19 1 − + + 0
340 3-3-1-1-1-1-18 1 − + + 0
359 10-1-2-1-9-27-6 1 − + + 0
380 2-1-1-1-1-4-19 1 − + + 0
422 2-3-1-1-4-4-111 1 − + + 0
429 2-1-2-1-9-1-116 1 − + + 1
515 2-1-1-1-1-1-4 1 − + + 0
517 10-1-2-1-9-1-4 1 − + + 1
678 2-3-1-1-109-56-18 1 − + + 0
14 1-6-1-1-1-1-1 1 − − + 1
15 1-1-1-1-1-1-1 2 − − + 1
42 2-6-1-3-8-1-15 1 − − + 1
65 2-1-2-1-10-4-13 1 − − + 0
234 2-1-2-1-7-1-24 4 − − + 3
299 2-10-1-1-56-24-31 2 − − + 2
307 4-1-2-52-1-1-7 1 − − + 0
378 2-1-1-1-7-4-65 1 − − + 0
454 16-24-21-27-29-22-105 1 − − + 1
a

The tonB allele in each ST is underlined.

b

Number of KPC-positive isolates found within each sequence type.

Following validation of the multiplex PCR assay, an additional 248 carbapenem-resistant clinical isolates from 5 hospitals in New York and New Jersey were also screened for blaKPC and ST258-tonB79 cluster inclusion (Table 3). As part of an ongoing surveillance project, a number of hospitals in our region routinely submit carbapenem-resistant Enterobacteriaceae to the PHRI Tuberculosis Center laboratory. During 2010-2011, a total of 248 unique carbapenem-resistant K. pneumoniae isolates were submitted by the clinical microbiology laboratories from the 5 hospitals. All of the isolates were resistant to at least one carbapenem, based on automated susceptibility testing (Vitek 2 or MicroScan) or Etest (bioMérieux). Data from this study indicated that 85% of these isolates belonged to the ST258-tonB79 cluster (n = 212), while 94% harbored blaKPC genes (n = 234). Twenty-two of the ST258-tonB79 cluster isolates (10%) were randomly selected and typed by MLST. The results confirmed that all 22 isolates were ST258, in agreement with the real-time PCR results; no other ST258-tonB79 cluster members were identified. Among KPC-producing isolates, 88% belonged to the ST258-tonB79 cluster (n = 206). Overall, KPC-producing ST258-related strains accounted for 83% of this collection of carbapenem-resistant K. pneumoniae clinical isolates. These results suggest that although KPC has spread throughout different lineages, ST258 remains the predominant KPC-producing K. pneumoniae clone in the New York–New Jersey region. The distribution of ST258 among such a large hospitalized population from a sizeable population base has significant implications for the containment and therapy of this clone, especially regarding the potential to develop resistance to other antimicrobial agents, such as colistin (10).

Table 3.

Distribution of KPC-producing ST258-tonB79 cluster strains in 248 clinical K. pneumoniae isolates

Hospital Locationa No. No. (%) of isolates positive for:
ST258-tonB79 cluster KPC ST258-tonB79 and KPC
A Northern NJ 43 34 (79.1) 42 (97.7) 34 (79.1)
B Central NJ 33 28 (84.8) 31 (93.9) 26 (76.5)
C NYC 80 66 (82.5) 73 (91.3) 63 (78.8)
D NYC 31 24 (77.4) 27 (87.1) 23 (74.2)
E NY 61 60 (98.4) 61 (100.0) 60 (98.4)
a

NJ, New Jersey; NYC, New York City; NY, New York.

In summary, we have described a novel multiplex real-time PCR assay that can rapidly identify the ST258-tonB79 cluster while simultaneously detecting blaKPC genes in K. pneumoniae isolates. The assay is rapid and simple to perform, with significant sensitivity and specificity, and provides a useful tool for screening of K. pneumoniae isolates and surveillance of the epidemic ST258 clone in both community and health care settings.

ACKNOWLEDGMENTS

This study was supported by a grant (to B.N.K.) from the National Institutes of Health (1R01AI090155-01A1). R.A.B. is supported by the Merit Review Program of the Veterans Health Administration, VISN 10 GRECC, and by the National Institutes of Health.

Footnotes

Published ahead of print 26 March 2012

REFERENCES

  • 1. Andrade LN, et al. 2011. Dissemination of blaKPC-2 by the spread of Klebsiella pneumoniae clonal complex 258 clones (ST258, ST11, ST437) and plasmids (IncFII, IncN, IncL/M) among Enterobacteriaceae species in Brazil. Antimicrob. Agents Chemother. 55:3579–3583 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Baraniak A, et al. 2011. Molecular characteristics of KPC-producing Enterobacteriaceae at the early stage of their dissemination in Poland, 2008–2009. Antimicrob. Agents Chemother. 55:5493–5499 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Bush K. 2010. Alarming β-lactamase-mediated resistance in multidrug-resistant Enterobacteriaceae. Curr. Opin. Microbiol. 13:558–564 [DOI] [PubMed] [Google Scholar]
  • 4. Chen L, et al. 2011. Multiplex real-time PCR assay for detection and classification of Klebsiella pneumoniae carbapenemase gene (blaKPC) variants. J. Clin. Microbiol. 49:579–585 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Cuzon G, et al. 2010. Worldwide diversity of Klebsiella pneumoniae that produce β-lactamase blaKPC-2 gene. Emerg. Infect. Dis. 16:1349–1356 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Diancourt L, Passet V, Verhoef J, Grimont PA, Brisse S. 2005. Multilocus sequence typing of Klebsiella pneumoniae nosocomial isolates. J. Clin. Microbiol. 43:4178–4182 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Hindiyeh M, et al. 2011. Rapid detection of blaKPC carbapenemase genes by internally controlled real-time PCR assay using Bactec blood culture bottles. J. Clin. Microbiol. 49:2480–2484 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Hindiyeh M, et al. 2008. Rapid detection of blaKPC carbapenemase genes by real-time PCR. J. Clin. Microbiol. 46:2879–2883 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Kitchel B, et al. 2009. Molecular epidemiology of KPC-producing Klebsiella pneumoniae isolates in the United States: clonal expansion of multilocus sequence type 258. Antimicrob. Agents Chemother. 53:3365–3370 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Marchaim D, et al. 2011. Outbreak of colistin-resistant, carbapenem-resistant Klebsiella pneumoniae in metropolitan Detroit, Michigan. Antimicrob. Agents Chemother. 55:593–599 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Nordmann P, Cuzon G, Naas T. 2009. The real threat of Klebsiella pneumoniae carbapenemase-producing bacteria. Lancet Infect. Dis. 9:228–236 [DOI] [PubMed] [Google Scholar]
  • 12. Nordmann P, Naas T, Poirel L. 2011. Global spread of carbapenemase-producing Enterobacteriaceae. Emerg. Infect. Dis. 17:1791–1798 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Richter SN, et al. 2012. Ultrarapid detection of blaKPC1/2–12 from perirectal and nasal swabs by use of real-time PCR. J. Clin. Microbiol. 50:1718–1720 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Schechner V, et al. 2009. Evaluation of PCR-based testing for surveillance of KPC-producing carbapenem-resistant members of the Enterobacteriaceae family. J. Clin. Microbiol. 47:3261–3265 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Yigit H, et al. 2001. Novel carbapenem-hydrolyzing beta-lactamase, KPC-1, from a carbapenem-resistant strain of Klebsiella pneumoniae. Antimicrob. Agents Chemother. 45:1151–1161 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES