Abstract
We report two episodes of recurrent candidemia caused by echinocandin-resistant Candida glabrata in a 69-year-old patient who underwent repeated abdominal surgery. In the first episode of candidemia, an echinocandin-susceptible Candida glabrata strain was isolated, and the patient was treated with caspofungin. The isolates from the later episodes showed resistance to echinocandins. Analysis of the HS1 region of the FKS2 gene showed the amino acid substitution S663P. Microsatellite analysis demonstrated a strong genetic relationship between the isolates.
TEXT
Candida glabrata represents an important cause of candidemia in Spain (13, 19, 20). Echinocandins, which include anidulafungin (ANF), caspofungin (CSF), and micafungin (MCF), are first-line antifungal therapy for invasive candidiasis by C. glabrata (1, 14). They inhibit the 1,3-β-d-glucan synthase (GS) complex, which is encoded by FKS genes. Mutations in hot spots 1 and/or 2 (HS1 and HS2) linked with reduced echinocandin susceptibility have been identified in FKS1 of Candida albicans, Candida krusei, and Candida tropicalis and in FKS1 and FKS2 of C. glabrata (15). Some reports show a relationship between echinocandin therapy and treatment failure in C. glabrata infections (4, 6, 8, 10, 24). Breakthrough mycoses, particularly by non-C. albicans species with reduced susceptibility, have been reported for immunocompromised patients after prolonged exposure to echinocandins, with C. glabrata and C. tropicalis being involved more frequently (22). However, despite the increase in the use of echinocandins, resistance remains uncommon in Candida spp. (16).
In 2011, the Clinical and Laboratory Standards Institute (CLSI) revisited the clinical breakpoints (CBP) of anidulafungin, caspofungin, and micafungin for major Candida species. These species-specific CBPs can better detect strains with FKS mutations and predict the risk of clinical failure (17). The European Committee on Antimicrobial Susceptibility Testing (EUCAST) has established CBPs for anidulafungin as follows: for C. albicans, susceptible (S), ≤0.03 μg/ml, and resistant (R), >0.03 μg/ml, and for C. glabrata, C. tropicalis, and C. krusei, S, ≤0.06 μg/ml, and R, >0.06 μg/ml (2).
On 16 June 2009, a 69-year-old man developed candidemia caused by C. glabrata (CNM-CL-7368) after two successive surgeries, abdominal and biliary. Fluconazole was administered (June 19), but the fever and candidemia persisted after 5 days, so the central venous catheter (CVC) was removed (June 21) and fluconazole was changed (June 26) to caspofungin (70-mg loading dose, followed by 50 mg/day). The anidulafungin and caspofungin MICs determined by Etest were 0.01 and 0.12 μg/ml, respectively. The fever resolved, and blood cultures became negative. Caspofungin was maintained for 30 days, because the patient developed sepsis of abdominal origin and was admitted to the intensive care unit (ICU) on July 13. He underwent two abdominal surgeries due to superior mesenteric vein thrombosis, although no surgical resection was performed because no necrotic bowel segments were found, and broad-spectrum antibiotics were administered. Surveillance cultures showed gastric colonization by C. glabrata. On August 28, the patient presented with fever and candidemia. C. glabrata (CNM-CL-7369) was isolated from both the blood and the CVC tip which had been removed. The anidulafungin and caspofungin MICs determined by Etest were 2 and 0.5 μg/ml. Since no CBPs for echinocandins and Etest were defined at that time, we used the CBPs suggested by CLSI (S ≤ 2 μg/ml), and the isolate was considered susceptible, although we were well aware that CBPs are method specific and results should be interpreted with caution. Another course of caspofungin was administered for 3 weeks. The fever stopped, and the blood cultures after 4 days of antifungal treatment were negative. On October 21, he presented with fever and sepsis. An abdominal computer tomography revealed chronic ischemia. C. glabrata (CNM-CL-7370) was isolated from both the blood and the CVC tip which had been removed. On October 22, he was admitted to the ICU; anidulafungin (200-mg loading dose, followed by 100 mg/day) was started, and the patient underwent a small bowel surgical resection that resolved the ischemic foci. However, fever persisted and blood cultures remained positive for C. glabrata after 4 days of treatment with anidulafungin. The MICs of anidulafungin and caspofungin determined by Etest were 2 and 1 μg/ml, respectively, which were significantly higher than those for the first isolate. Anidulafungin was changed to liposomal amphotericin B (5 mg/kg/day), and the episode resolved after 17 days of treatment.
Etest susceptibility profiles (Table 1) were confirmed using the EUCAST microdilution method (21), and strains were classified as S or R according to EUCAST anidulafungin CBPs for C. glabrata (2). C. glabrata ATCC 90030 was used as the control. The results confirmed that the susceptibility of the strains recovered after the caspofungin treatment was lower than that of the strain recovered before the treatment.
Table 1.
Antifungal MICs for C. glabrata isolates by Etest (48 h) and EUCAST
| Isolate | Method | MIC (μg/ml) |
||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| ANF | CSF | MCFa | AMB | 5FC | FLC | ITC | PSC | VRC | ||
| ATCC 90030 | Etest | 0.01 | 0.25 | 0.01 | 0.12 | 0.01 | 8 | >32 | 4 | 0.25 |
| EUCAST | 0.03 | 0.5 | 0.03 | 0.12 | 0.12 | 8 | 0.5 | 0.06 | 0.25 | |
| CL7368 | Etest | 0.01 | 0.12 | 0.01 | 0.12 | 0.01 | 8 | >32 | 4 | 0.5 |
| EUCAST | 0.03 | 0.25 | 0.03 | 0.25 | 0.12 | 4 | 0.12 | 0.12 | 0.12 | |
| CL7369 | Etest | 2 | 0.5 | 2 | 0.25 | 0.01 | 8 | >32 | 4 | 0.25 |
| EUCAST | 0.12 | 1 | 0.06 | 0.25 | 0.12 | 4 | 0.12 | 0.12 | 0.12 | |
| CL7370 | Etest | 2 | 1 | 4 | 0.25 | 0.01 | 8 | >32 | 4 | 0.25 |
| EUCAST | 0.25 | 1 | 0.12 | 0.25 | 0.12 | 4 | 0.12 | 0.12 | 0.12 | |
The MCF Etest was performed later because it was not available at the time when we evaluated the ANF and CSF Etests.
Although C. glabrata has three FKS genes, the mutations that confer resistance have been found in HS1 of FKS1 and, in particular, of FKS2 genes (11), so HS1 from both genes was amplified using the following oligonucleotides: for HS1 from FKS1, CGFKS1-HS1-fw (TTCTCAGTCATGCCATTGG) and CGFKS1-HS1-rv (ACAATGTACCACAGATAGG); for HS1 from FKS2, CGFKS2-HS1-fw (AAGATATGTTGCTTCTCAGAC) and CGFKS2-HS1-rv (AAGGAGTTAAGATGGAAATACC). Genomic DNA was extracted using the phenol-chloroform protocol (23). PCR conditions for amplifying the HS1 from FKS1 were 95°C for 10 min, 30 amplification cycles (95°C for 15 s, 50°C for 15 s, and 72°C for 30 s), and 5 min at 72°C. To amplify the HS1 from FKS2, PCR cycles were the same, but the annealing temperature was 53°C. The DNA products were sequenced using the Sanger method and an ABI3730XL sequencer. The DNA sequences were analyzed with DNAStar Lasergene 8.0.2 software (DNAStar Inc., Madison, WI). Multiple-sequence alignment was performed using ClustalW2 from the EMBL-EBI (Cambridge, United Kingdom) and Jalview 2.3 (5). In the two resistant strains, there was a mutation (T to C) at nucleotide 1987, which is located in HS1 from FKS2, which produced the S663P change in the protein. This mutation causes resistance to echinocandins (8, 10). No changes were found in the region from nucleotides 1516 to 1871 (which contains the HS1) from the FKS1 gene (data not shown).
To investigate if the mutation appeared during treatment in the strain that was already present or if resistance was due to a different strain acquired during treatment, we performed a microsatellite analysis of the RPM2, MTI, and ERG3 genes (9) with the following modifications: the MT1 sense primer was labeled with NED fluorochrome, and the PCR mixture contained 5 mM MgCl2 and 1 U of AmpliTaq polymerase (Applied Biosystems). For fragment size determination, 1 μl of the PCR products was added to 9 μl of Hi-Di formamide (Applied Biosystems) and 1 μl of the internal size standard ROX 500 (Applied Biosystems, Spain). Capillary electrophoresis was performed in an ABI 3730 XL sequencer (Applied Biosystems). Reactions were analyzed in duplicate. Fragment sizes were calculated with Peak Scanner software version 1.0 (Applied Biosystems). The discrimination power of the analysis was calculated according to reference 12. We included the 3 strains described above plus 14 others available from the collection of the Spanish Mycology Reference Laboratory. For each marker, only one peak was observed in each isolate. Fifteen genotypes were identified using a combination of the markers (Table 2). The strains from this study showed the same microsatellite profile for the three markers (discrimination power, 0.98), indicating that these strains are genetically related and suggesting that resistance was acquired by mutation of the FKS2 gene in the first isolate.
Table 2.
Genotypes of the isolates tested
| Straina | Fragment size (bp) |
||
|---|---|---|---|
| RPM 2 | ERG 3 | MTI | |
| CNM-CL 7523* | 134 | 235 | 241 |
| CNM-CL 7561* | 135 | 0 | 244 |
| CNM-CL 7580* | 209 | 205 | 243 |
| CNM-CL 7590* | 134 | 204 | 234 |
| CNM-CL 6155* | 133 | 204 | 244 |
| CNM-CL 6221* | 133 | 204 | 243 |
| CNM-CL 6226* | 141 | 231 | 243 |
| CNM-CL 6395* | 132 | 233 | 241 |
| CNM-CL 6449* | 141 | 229 | 242 |
| CNM-CL 6894* | 134 | 205 | 244 |
| CNM-CL 7051* | 132 | 204 | 239 |
| CNM-CL 7083* | 134 | 204 | 242 |
| CNM-CL 7313* | 133 | 204 | 241 |
| CNM-CL 7515* | 134 | 204 | 164 |
| CNM-CL 7368 | 136 | 217 | 244 |
| CNM-CL 7369 | 136 | 217 | 244 |
| CNM-CL 7370 | 136 | 217 | 244 |
CNM-CL, Yeast Collection of the Spanish National Center for Microbiology. Asterisks indicate the 14 independent clinical isolates used as the control population.
In a recent population-based surveillance study (25), 3.3% of the C. glabrata strains isolated from candidemic patients had elevated MICs for echinocandins (CLSI). Most of them had the S663P substitution, which was associated with the highest echinocandin MICs. No mutations were found in the isolates with MICs of ≤0.125 μg/ml.
The previous CLSI CBP of ≤2 μg/ml for echinocandins (7) can classify strains with mutations in the HSs as susceptible (3). Evaluations of CLSI, EUCAST, and Etest methods that apply epidemiological cutoff values to a collection of Candida isolates characterized for the presence or absence of mutations in HS regions show that all three methods distinguish mutant from wild-type strains, providing evidence that the three methods can be used in resistance surveillance studies (3, 18).
When the EUCAST CBPs for ANF and the revisited CLSI CBPs for ANF and CSF (S ≤ 0.12 μg/ml, R ≥ 0.5 μg/ml) and those for MCF (S ≤ 0.06 μg/ml, R ≥ 0.25 μg/ml) for C. glabrata were used to interpret MICs obtained by Etest, all of them distinguished the two resistant strains.
Etest is easy to perform in the clinical practice and can predict echinocandin therapy failure, but species-specific breakpoints to define Candida strains as resistant by this method are lacking.
ACKNOWLEDGMENTS
M.C.-E. is funded by grant PI09/1791 from the Spanish Ministry of Science and Innovation, and O.Z. is funded by grants SAF2008-03761 and SAF2011-25140 from the same Ministry. S.G. is supported by a research fellowship from the Spanish Ministry of Science and Innovation FI10/00464).
We thank Ana Barrionuevo for technical help.
In the past 5 years, M.C.-E. has received grant support from Astellas Pharma, bioMérieux, Gilead Sciences, Merck Sharp and Dohme, Pfizer, Schering Plough, Soria Melguizo SA, the European Union, the ALBAN program, the Spanish Agency for International Cooperation, the Spanish Ministry of Culture and Education, the Spanish Health Research Fund, the Instituto de Salud Carlos III, the Ramon Areces Foundation, the Mutua Madrileña Foundation. He has been an advisor/consultant to the Panamerican Health Organization, Gilead Sciences, Merck Sharp and Dohme, Pfizer, and Schering Plough. He has been paid for talks on behalf of Gilead Sciences, Merck Sharp and Dohme, Pfizer, and Schering Plough. The other authors have no conflicts of interest.
Footnotes
Published ahead of print 5 March 2012
REFERENCES
- 1. Aguado JM, et al. 2011. Recomendaciones sobre el tratamiento de la candidiasis invasiva y otras infecciones por levaduras de la Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica (SEIMC). Actualización 2011. Enferm. Infecc. Microbiol. Clin. 29:345–361 [DOI] [PubMed] [Google Scholar]
- 2. Arendrup MC, et al. 2011. EUCAST technical note on anidulafungin. Clin. Microbiol. Infect. 17:E18–E20 [DOI] [PubMed] [Google Scholar]
- 3. Arendrup MC, et al. 2010. Echinocandin susceptibility testing of Candida species: comparison of EUCAST EDef 7.1, CLSI M27-A3, Etest, disk diffusion, and agar dilution methods with RPMI and IsoSensitest media. Antimicrob. Agents Chemother. 54:426–439 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Chapeland-Leclerc F, et al. 2010. Acquisition of flucytosine, azole, and caspofungin resistance in Candida glabrata bloodstream isolates serially obtained from a hematopoietic stem cell transplant recipient. Antimicrob. Agents Chemother. 54:1360–1362 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Clamp M, Cuff J, Searle SM, Barton GJ. 2004. The Jalview Java alignment editor. Bioinformatics 20:426–427 [DOI] [PubMed] [Google Scholar]
- 6. Cleary JD, García-Effron G, Chapman SW, Perlin DS. 2008. Reduced Candida glabrata susceptibility secondary to an FKS1 mutation developed during candidemia treatment. Antimicrob. Agents Chemother. 52:2263–2265 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Clinical and Laboratory Standards Institute (CLSI) 2008. Reference method for broth dilution antifungal susceptibility testing of yeasts, 3rd ed Approved standard M27–A3. CLSI, Wayne, PA [Google Scholar]
- 8. Costa-de-Oliveira S, et al. 2011. FKS2 mutations associated with decreased echinocandin susceptibility of Candida glabrata following anidulafungin therapy. Antimicrob. Agents Chemother. 55:1312–1314 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Foulet F, et al. 2005, Microsatellite marker analysis as a typing system for Candida glabrata. J. Clin. Microbiol. 43:4574–4579 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. García-Effron G, et al. 2010. Novel FKS mutations associated with echinocandin resistance in Candida species. Antimicrob. Agents Chemother. 54:2225–2227 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. García-Effron G, Lee S, Park S, Cleary JD, Perlin DS. 2009. Effect of Candida glabrata FKS1 and FKS2 mutations on echinocandin sensitivity and kinetics of 1,3-β-d-glucan synthase: implication for the existing susceptibility breakpoint. Antimicrob. Agents Chemother. 53:3690–3699 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Hunter PR, Gaston MA. 1988. Numerical index of the discriminatory ability of typing systems: an application of Simpson's index of diversity. J. Clin. Microbiol. 26:2465–2466 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Ortega M, et al. 2011. Candida species bloodstream infection: epidemiology and outcome in a single institution from 1991 to 2008. J. Hosp. Infect. 77:157–161 [DOI] [PubMed] [Google Scholar]
- 14. Pappas PG, et al. 2009. Clinical practice guidelines for the management of candidiasis: 2009 update by the Infectious Diseases Society of America. Clin. Infect. Dis. 48:503–535 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Perlin DS. 2007. Resistance to echinocandin-class antifungal drugs. Drug Resist. Updat. 10:121–130 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Pfaller M, et al. 2011. Use of epidemiological cutoff values to examine 9-year trends in susceptibility of Candida species to anidulafungin, caspofungin, and micafungin. J. Clin. Microbiol. 49:624–629 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Pfaller MA, et al. 2011. Clinical breakpoints for the echinocandins and Candida revisited: Integration of molecular, clinical, and microbiological data to arrive at species-specific interpretative criteria. Drug Resist. Updat. 14:164–176 [DOI] [PubMed] [Google Scholar]
- 18. Pfaller MA, et al. 2010. Comparison of European Committee on Antimicrobial Susceptibility Testing (EUCAST) and Etest methods with the CLSI broth microdilution method for echinocandin susceptibility testing of Candida species. J. Clin. Microbiol. 48:1592–1599 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Rodríguez D, et al. 2010. Predictors of candidaemia caused by non-albicans Candida species: results of a population-based surveillance in Barcelona, Spain. Clin. Microbiol. Infect. 16:1676–1682 [DOI] [PubMed] [Google Scholar]
- 20. Rodríguez-Hernández MJ, et al. 2011. Candidemias: análisis multicéntrico en 16 hospitales andaluces. Enferm. Infecc. Microbiol. Clin. 29:328–333 [DOI] [PubMed] [Google Scholar]
- 21. Rodriguez-Tudela JL, et al. 2008. EUCAST definitive document EDef 7.1: method for the determination of broth dilution MICs of antifungal agents for fermentative yeasts. Clin. Microbiol. Infect. 14:398–405 [DOI] [PubMed] [Google Scholar]
- 22. Sun H-Y, Singh N. 2010. Characterisation of breakthrough invasive mycoses in echinocandin recipients: an evidence-based review. Int. J. Antimicrob. Agents. 353:211–218 [DOI] [PubMed] [Google Scholar]
- 23. Tang CM, Cohen J, Holden DW. 1992. An Aspergillus fumigatus alkaline protease mutant constructed by gene disruption is deficient in extracellular elastase activity. Mol. Microbiol. 6:1663–1671 [DOI] [PubMed] [Google Scholar]
- 24. Thompson GR, et al. 2008. Development of caspofungin resistance following prolonged therapy for invasive candidiasis secondary to Candida glabrata infection. Antimicrob. Agents Chemother. 52:3783–3785 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Zimbeck AJ, et al. 2010. FKS mutations and elevated echinocandin MIC values among Candida glabrata isolates from U.S. population-based surveillance. Antimicrob. Agents Chemother. 54:5042–5047 [DOI] [PMC free article] [PubMed] [Google Scholar]
