Extensive Genetic Diversity within the Dutch Clinical Cryptococcus neoformans Population

Abstract

A set of 300 Dutch Cryptococcus neoformans isolates, obtained from 237 patients during 1977 to 2007, was investigated by determining the mating type, serotype, and AFLP and microsatellite genotype and susceptibility to seven antifungal compounds. Almost half of the studied cases were from HIV-infected patients, followed by a patient group of individuals with other underlying diseases and immunocompetent individuals. The majority of the isolates were mating type α and serotype A, followed by αD isolates and other minor categories. The most frequently observed genotype was AFLP1, distantly followed by AFLP2 and AFLP3. Microsatellite typing revealed a high genetic diversity among serotype A isolates but a lower diversity within the serotype D set of isolates. One patient was infected by multiple AFLP genotypes. Fluconazole and flucytosine had the highest geometric mean MICs of 2.9 and 3.5 μg/ml, respectively, while amphotericin B (0.24 μg/ml), itraconazole (0.08 μg/ml), voriconazole (0.07 μg/ml), posaconazole (0.06 μg/ml), and isavuconazole (0.03 μg/ml) had much lower geometric mean MICs. One isolate had a high flucytosine MIC (>64 μg/ml), while decreased susceptibility (≥16 μg/ml) for flucytosine and fluconazole was found in 9 and 10 C. neoformans isolates, respectively.

INTRODUCTION

The encapsulated basidiomycetous yeast Cryptococcus neoformans, the causative agent of cryptococcosis, can cause life-threatening infections, such as severe lung infections and meningoencephalitis. This fungal disease was rarely seen until the early 1980s, but this changed due to the HIV pandemic (5, 42, 44). Annually nearly one million HIV-infected subjects develop cryptococcosis, mainly in sub-Saharan Africa, where the majority of patients die due to ineffective treatment or a lack of treatment options (35, 44). Besides a high incidence of cryptococcosis among HIV-infected patients, individuals with other underlying diseases might be at risk due to immune disorders or immunosuppressive therapy (e.g., organ transplant recipients and individuals receiving anti-cancer therapy) (5, 35, 44).

According to the current taxonomic classification, the genus Cryptococcus contains more than 100 species (19). However, only C. neoformans and C. gattii are frequent causes of cryptococcal disease in humans and animals. Cryptococcus gattii has been recognized as a primary pathogen, and C. neoformans is mainly an opportunistic infection. The latter is currently divided into two varieties, C. neoformans variety grubii (serotype A) and C. neoformans variety neoformans (serotype D) (5). Cryptococcus neoformans variety gattii (serotype B and C), was raised to a separate species named C. gattii (5, 28).

PCR fingerprinting, restriction fragment length polymorphism analysis of the PLB1 and URA5 loci, amplified fragment length polymorphism (AFLP) fingerprint analysis, and several multilocus sequence typing (MLST) studies divided C. neoformans and C. gattii into 10 distinct genotypes (4, 6, 26, 30, 33). Within C. neoformans variety grubii, three genotypes can be discerned (named AFLP1/VNI, AFLP1A/VNB/VNII, and AFLP1B/VNII), C. neoformans variety neoformans has one genotype (AFLP2/VNIV), and the C. neoformans intervariety serotype AD hybrid has one (AFLP3/VNIII). Cryptococcus gattii can be divided into five genotypes: AFLP4/VGI, AFLP6/VGII, and AFLP10/VGIV with serotype B isolates, and AFLP5/VGIII and AFLP7/VGIV are represented by serotype C isolates (21, 30). Several interspecies hybrids have been described. C. neoformans variety neoformans AFLP2/VNIV × C. gattii AFLP4/VGI is known as AFLP8 and C. neoformans variety grubii AFLP1/VNI × C. gattii AFLP4/VGI has been designated AFLP9 (7, 8). A third interspecies variety has recently been described and was found to be a hybrid between C. neoformans var. grubii AFLP1/VNI and C. gattii AFLP6/VGII (1).

A retrospective survey of HIV-infected patients in the Netherlands identified 268 patients with cryptococcosis during 1986 to 1999 (42). A major increase in the incidence of the disease was observed since 1987, which correlated with the increasing number of HIV/AIDS patients. The introduction of highly active antiretroviral therapy (HAART) in 1996 resulted in a significant decrease of cryptococcosis patients in the Netherlands (42). A clinical epidemiological analysis was made of the patient characteristics, but a genotypic analysis of the involved C. neoformans isolates has not been performed (42). In this study, we investigated Dutch C. neoformans isolates that were collected during a 30-year period (1977 to 2007) to investigate the genetic diversity. AFLP fingerprinting, microsatellite typing, and mating type and serotype analyses were performed by using PCRs to assess the genetic diversity among Dutch clinical Cryptococcus strains. Antifungal susceptibility profiles were determined for the antifungal compounds amphotericin B, flucytosine, fluconazole, itraconazole, and the three novel triazoles, posaconazole, voriconazole, and isavuconazole.

MATERIALS AND METHODS

Patient-related data.

Clinically relevant information was extracted from the database of the Netherlands Reference Laboratory for Bacterial Meningitis (Academic Medical Center, Amsterdam, The Netherlands) and included the source and date of Cryptococcus isolation, date of birth, gender, and place of residence of the patient. Patient data were requested from the contributing clinicians or hospitals in the case that no or limited data were available. Relapses of cryptococcal infections were defined by a period between two positive cultures of more than 90 days. Four patient categories were determined based on the predisposing factors that may have influenced the onset of the Cryptococcus infection, namely, HIV/AIDS-related immunodeficiency, non-HIV/AIDS-related immunodeficiency (e.g., immunosuppressive therapy and organ transplantation), immunocompetent individuals, and a patient category for which the presence or absence of predisposing factors was unknown.

Cryptococcal isolates and media.

Cryptococcal isolates (n = 328; 300 were viable) were revived from the collection of the Netherlands Reference Laboratory for Bacterial Meningitis (held at −80°C; Academic Medical Center, Amsterdam, The Netherlands) or were requested from participating Dutch hospitals. Isolates were cultured on 1% yeast extract, 1% peptone, 2% d-glucose agar (YPGA) medium and incubated at 25°C for 2 days.

Genomic DNA extraction.

Isolates were subcultured for 2 days at 30°C on YPGA media supplemented with 0.5 M NaCl to prevent the formation of polysaccharide capsules. Genomic DNA was extracted as described previously by Hagen et al. (21). The purity and quantity of the genomic DNA solution was measured using a Nanodrop ND-1000 spectrophotometer (Nanodrop, Wilmington, DE), and final work solutions with a concentration of 100 ng/μl were prepared.

Determining mating type and serotype by PCR and AFLP genotyping.

The mating type and serotype determination of the isolates was performed as described previously (2). Reference strains 125.91 (CBS10512; mating type aA; AFLP1), H99 (CBS8710; αA; AFLP1), JEC20 (CBS10511; aD; AFLP2), and JEC21 (CBS10513; αD; AFLP2) were included as controls. Isolates that failed to yield an amplicon subsequently were subjected to a set of two PCRs to amplify the C. gattii mating type STE12a or STE12α allele (7, 21). For these PCRs, the reference strains CBS1930 (aB; AFLP6) and WM276 (αB; AFLP4) were included as controls.

The genotype was determined using AFLP fingerprint analysis as described previously by Boekhout et al. (4). Reference strains for each of the genotypes were included according to Hagen et al. (21).

Microsatellite amplification and analysis.

The genetic relatedness of C. neoformans variety grubii (serotype A) isolates was further investigated using nine short tandem repeat markers (STRs) as described recently (25). The C. neoformans var. grubii genome-sequenced reference strain H99 (CBS8710) was used as a control. Fragment analysis on a MegaBACE 500 capillary electrophoresis platform (GE Healthcare Life Sciences, Diegem, Belgium) was carried out as described by Illnait-Zaragozi et al. (25). Bionumerics version 6.1 (Applied Maths, Sint-Martens-Latem, Belgium) was used to calculate a minimum spanning tree. A multistate categorical similarity coefficient was used, and microsatellite complexes (MCs) were defined by a minimum group of two genotypes that contain at least five isolates and with a maximum neighbor distance of a two-locus difference among the nine loci studied (25).

To characterize the genetic structure of C. neoformans variety neoformans (serotype D) isolates, a microsatellite panel was developed based on the genome sequence of reference strain JEC21 (CBS10513) using the Tandem Repeats Finder software package (3). This panel consists of two dinucleotide repeat loci, four trinucleotide repeat loci, and one tetranucleotide repeat locus (Table 1) that are all specific for isolates harboring serotype D; no cross-specificity was observed when tested with C. neoformans var. grubii or C. gattii isolates (data not provided). For each locus, one of the amplification primers was labeled with a fluorescent dye (FAM, 6-carboxyfluorescein; HEX, hexachlorofluorescein; or TET, tetrachlorofluorescein). The C. neoformans var. grubii genome-sequenced reference strain JEC21 was used as a control. Amplification conditions, the processing of amplicons, and data analysis were identical to the methods and conditions used for the analysis of the C. neoformans variety grubii microsatellite panel.

Table 1.

Primer sequences for microsatellite typing of C. neoformans var. neoformans^a

Name	Sequence	Target
CND2-1 Fwd	FAM-AATCCTGAGACGGTTTGTGG	CND2A
CND2-1 Rvd	GAACATTGTGCCCGACTTTT
CND2-4 Fwd	TET-ATCGAAGGTCTCGTCGTCTG	CND2B
CND2-4 Rvd	GAATGCTCTGGATGGAAGGA
CND3-1 Fwd	FAM-TGCTGAGCTTGTTGAGGTTG	CND3A
CND3-1 Rvd	GAATGGCGCACTAATCTACCC
CND3-2 Fwd	HEX-AGGCAAGACTGACGTTGAGC	CND3B
CND3-2 Rvd	GCAACTTCCTCCCCTCTTTCC
CND3-3 Fwd	GTTGGTCTGTCTCCCTCGAT	CND3C
CND3-3 Rvd	TET-TTTCAAAGATGCTTGATGAGGA
CND3-4 Fwd	GTCGGTAAGGTTTTGGGTTGA	CND3D
CND3-4 Rvd	HEX-AGCACCAAAAGATGGGTACAA
CND4-3 Fwd	GCGCCGCTCTTAGAATGAAGA	CND4A
CND4-3 Rvd	TET-TCTCCGTCTGTCGTCTTTTG

^aThe primer sequences for the seven microsatellite serotype D-specific primer pairs are given. Primer sequences for the nine microsatellite serotype A-specific primer pairs are from Illnait-Zaragozi et al. (25).

Antifungal susceptibility testing.

The MICs of amphotericin B (Bristol Myers Squibb, Woerden, The Netherlands), flucytosine (Valeant Pharmaceuticals, Zoetermeer, Netherlands), fluconazole and voriconazole (Pfizer Central Research, Sandwich, Kent, United Kingdom), itraconazole (Janssen Cilag, Tilburg, The Netherlands), posaconazole (Schering-Plough Corp. [now Merck], Kenilworth, NJ), and isavuconazole (Basilea Pharmaceutica [now Astellas], Basel, Switzerland) were determined using a broth microdilution method in accordance with CLSI document M27-A3 (13). The procedure was performed as described by Hagen et al. (21).

Statistical analysis.

The 50 and 90% minimum inhibitory concentrations (MIC₅₀ and MIC₉₀, respectively) were determined by ordering the MIC values for each antifungal in ascending order and selecting the median and 90th quantile, respectively, of the MIC distribution. Geometric mean MICs were calculated using Office Excel 2007 (Microsoft, Redmond, WA), for which purpose values “<X” were set equal to “0.5X” and “>Y” values were set equal to “2Y”. A two-tailed Mann-Whitney-Wilcoxon test was performed to compare the MIC values between different groups (e.g., patient categories versus AFLP genotypes or microsatellite cluster), and a P value of ≤0.05 was regarded as statistically significant. Significant correlations between Cryptococcus characteristics versus any of the other values were calculated using a chi-square test. Statistical analyses were performed using the SAS software package (SAS, Cary, NC).

The discriminatory power of the microsatellite typing experiments was calculated according to Simpson (37) using the software package Haplotype Analysis v1.05 (18).

RESULTS

Cryptococcal isolates, patients, and patient categories.

Detailed data of the total number of Cryptococcus isolates and the number of patients included, as well as number of isolates per defined patient category, are listed in Table 2. The isolates were isolated from cerebrospinal fluid (CSF) (n = 201; 67%), blood (n = 45; 15%), lung (n = 28; 9.3%), bone (n = 5; 1.7%), spleen, urine (each n = 2; 0.67%), pus, neck gland (each n = 1; 0.33%), and unknown sources (n = 15; 5%).

Table 2.

Cryptococcosis patient data^a

Cryptococcus isolate and patient parameter	Total	HIV/AIDS positive	Other predisposing factors	Immunocompetent	Unknown immune status
Isolates
No. (%) of strainsb	300 (100)	137 (45.7)	68 (22.7)	24 (8)	71 (23.7)
No. (%) of CSF culturesc	201 (67)	105 (76.6)	37 (54.4)	13 (54.2)	46 (64.8)
No. (%) of blood culturesc	44 (14.7)	20 (14.6)	7 (10.3)	4 (16.7)	13 (18.3)
No. (%) of other sourcesc	55 (18.3)	12 (8.8)	24 (35.3)	7 (29.2)	12 (16.9)
Patients
All
No. (%)b	237 (100)	115 (48.5)d,e	50 (21.1)d	18 (7.6)	54 (22.8)f
Male/female ratio	4.2:1	8.4:1	1.8:1	3.5:1	3.5: 1
Age distribution (yr)	14–83	20–63d	17–78d	15–83	14 −69
Avg age (yr)	43.2	38.2d	53.9d	50.8	41.2
Median age (yr)	41	37d	60d	48	38
Male
No. (%)b	188 (100)	101 (53.7)e	31 (16.5)	14 (7.4)	42 (22.3)f
Age distribution (yr)	17–83	20–63	17–75	27–83	19–69
Avg age (yr)	42.7	39.0	52.7	53.1	40.6
Median age (yr)	41	38	59	48	35
Female
No. (%)b	45 (100)	12 (26.7)	17 (37.8)	4 (8.9)	12 (26.7)
Age distribution (yr)	14–78	23–43	30–78	15–73	14–69
Avg age (yr)	45.4	31.0	53.8	43.0	42.9
Median age (yr)	42	32.8	60	42	49

^aThe number of included C. neoformans isolates is listed for the categories HIV/AIDS patients, patients with other predisposing factors, immunocompetent patients, and patients with unknown immune status. Data are divided into four sections, providing the source of isolation of the Cryptococcus isolates, data related to the patient, and patient-related data for male and female patients.

^bNumbers and percentages indicated in these patient categories are the cumulative numbers and percentages indicated in the column Total.

^cNumbers and percentages of isolates per source (CSF, blood, or other source) are the cumulative numbers and percentages of isolates applied to that patient category.

^dIncluding two patients without known gender.

^eIncluding one male patient without known age.

^fIncluding three male patients without known age.

The 300 isolates originated from 237 patients, of whom 45 were female (19.0%), 188 were male (79.3%), and 4 were of unknown gender (1.7%). The male-to-female ratio was 4.2 to 1 with an overall age distribution of 14 to 83 years and male and female age distributions of 17 to 83 and 14 to 78 years, respectively. The average age at which the 237 patients developed cryptococcosis was 43.2 years with a median of 41 years.

Almost half the studied cases of cryptococcosis occurred in HIV-infected patients (n = 115; 48.5%), followed by the group with other underlying diseases (n = 50; 21.1%) and immunocompetent individuals (n = 18; 7.6%). Fifty-four (22.8%) of the episodes occurred in patients for which no clinical data were available. Two or more isolates were available from 42 patients (17.7%), and 2 of these patients had a relapse of cryptococcosis.

Mating type, serotype, and AFLP genotype determinations.

Detailed data on the mating type, serotype, and AFLP genotype distribution among investigated Cryptococcus spp. isolates per patient category are listed in Table 3. The PCR-based determination of mating type and serotype revealed that the majority of the 300 isolates were αA (n = 219; 73.0%). Thirty-eight isolates (12.7%) were serotype D, of which 32 were mating type α and 6 mating type a. The remaining isolates belonged to minor mating type and serotype categories as listed in Table 3.

Table 3.

Genetic background of Cryptococcus neoformans isolates per patient category based on mating type, serotype, and genotype^a

Typing method and strain	Total	HIV/AIDS	Other predisposing factors	Immunocompetent	Unknown immune status
PCR-based mating type and serotype determination
No. (%) of αA strains	219 (73)	95 (69.3)	47 (69.1)	20 (83.3)	57 (80.3)
No. (%) of aD strains	6 (2)	3 (2.2)	2 (2.9)		1 (1.4)
No. (%) of αD strains	32 (10.7)	9 (6.6)	13 (19.1)	1 (4.2)	9 (12.7)
No. (%) of αA-aA strains	21 (7)	14 (10.2)	2 (2.9)	2 (8.3)	3 (4.2)
No. (%) of αA-αD strains	1 (0.3)	1 (0.7)
No. (%) of αA-aD strains	6 (2)	5 (3.6)	1 (1.5)
No. (%) of αD-aA strains	4 (1.3)	4 (2.9)e
No. (%) of C. gattii (α) isolates	2 (0.7)	1 (0.7)	1 (1.5)
No. (%) of unknown isolates	9 (3)	5 (3.6)	2 (2.9)	1 (4.2)	1 (1.4)
AFLP genotyping (no. [%] positive)
AFLP1	245 (81.7)	111 (81)d	51 (75)c	21 (87.5)b	62 (87.3)
AFLP2	36 (12)	13 (9.5)e	13 (19.1)	2 (8.3)	8 (11.3)
AFLP3	14 (4.7)	12 (8.8)	1 (1.5)	1 (4.2)
AFLP4	1 (0.3)	1 (0.7)
AFLP6	1 (0.3)		1 (1.5)
AFLP8	3 (1)		2 (2.9)		1 (1.4)

^aThe numbers and percentages of C. neoformans isolates per patient category are given for the mating type and/or serotyping results and AFLP genotyping. Percentages are cumulative for the PCR-based mating type and serotype determination group and the AFLP genotyping group.

^bIncludes one isolate with genotype AFLP1B.

^cIncludes two isolates with genotype AFLP1B.

^dIncludes four isolates with genotype AFLP1B.

^eOne isolate was found to be αD-aA by conventional PCR mating type and serotype determination, while AFLP genotyping revealed that this isolate was AFLP2.

The mating type and serotype of 11 isolates (3.7%) could not be determined, and these were subsequently subjected to a C. gattii-specific PCR. This resulted in two (0.7%) isolates that were C. gattii mating type α, while the remaining nine (3%) isolates remained untypeable.

AFLP fingerprinting divided the isolates into six AFLP groups. The majority of isolates (n = 245; 81.7%) clustered together with reference strains for genotype AFLP1, which represents C. neoformans var. grubii (serotype A) and includes seven (2.3%) isolates that belong to the minor genotype cluster AFLP1B. Thirty-six isolates clustered together with the reference strain for genotype AFLP2 (n = 36; 12%), representing C. neoformans var. neoformans (serotype D), and 14 clustered together in genotype AFLP3 (n = 14; 4.7%), which represents the serotype AD hybrids. The remaining isolates belonged to minor AFLP genotypes, as listed in Table 3.

Some discrepancies between the conventional methods for determining mating type and serotype versus AFLP fingerprinting were observed. Four isolates (1.2%) were determined by PCRs for mating type and serotype as αA or aD, but AFLP genotyping revealed that they were actually hybrid serotype AD isolates (genotype AFLP3) that lack either the serotype A or D genetic background. Three isolates that were determined by mating type and serotype PCR as aD were identified by AFLP genotyping as interspecies hybrids between C. neoformans var. neoformans and C. gattii that were assigned to AFLP8 (7). A significant correlation between the genotypic AFLP1 and AFLP2 groups versus the immune status of the patients was observed (P = 0.029).

Microsatellite (STR) genotyping of serotype A isolates.

Based on serotype and AFLP fingerprint analysis, a set of 259 C. neoformans isolates was further investigated using a serotype A-specific microsatellite panel. This included 245 serotype A isolates belonging to genotype AFLP1 and 14 serotype AD hybrid isolates belonging to genotype AFLP3 (Table 3).

When all nine serotype A-specific microsatellite markers were combined, 196 different microsatellite genotypes and 11 MCs could be distinguished among 259 isolates (Fig. 1). Using the Simpson's diversity index (D), the discriminatory power for the complete set of nine microsatellite markers was 0.994, and that of the three separate panels was 0.929, 0.953, and 0.985 for CNA2, CNA3, and CNA4, respectively. Among the nine studied microsatellite loci, CNA4A had the highest genotypic diversity with 59 types (D = 0.967), while locus CNA3B had the lowest genotypic diversity with nine types (D = 0.649). However, locus CNA3C showed the lowest resolution, with a D value of 0.578.

Fig 1.

Genotypic diversity of Cryptococcus neoformans variety grubii isolates based on serotype A-specific microsatellite typing. Minimum spanning tree showing 259 C. neoformans var. grubii isolates based on a nine-locus microsatellite typing panel. Each circle corresponds to a unique genotype, and connected shaded circles belong to a specific microsatellite cluster. The size of the circles corresponds to the number of isolates of the same genotype. Connecting lines correspond to the number of differences between genotypes, with a solid thick line connecting genotypes that differ in one locus, a solid thin line connecting genotypes that differ in up to three loci, a dashed line connecting genotypes that differ in four loci, and a dotted line connecting microsatellite genotypes that differ in more than four loci. (A) Microsatellite clusters (MCs) that are numbered according to Illnait-Zaragozi et al. (25). MC13 and MC14 are novel MCs not observed in previous microsatellite typing studies, and yellow-colored circles represent genotypes that do not belong to a known microsatellite cluster. (B) Identical to panel A, except colors represent the AFLP genotype of the isolates: green, AFLP1; dark blue, AFLP1B; red, AFLP3. (C) Identical to panel B, except colors represent the source of isolation: green, CSF; red, blood; dark blue, source other than blood or CSF.

Microsatellite loci CNA3A and CNA4A showed a relatively high degree of negative results for 35 and 6% of the investigated isolates, respectively, whereas the other microsatellite markers showed only the occasional absence of a microsatellite locus. However, the assignment of MCs remained intact when microsatellite loci CNA3A and CNA4A were discarded from the analysis (data not shown). A step-by-step removal of the most discriminatory microsatellite loci showed that the backbone structure of the microsatellite cluster analysis was found to be represented by the microsatellite loci CNA3B, CNA3C, and CNA4C, which all had a low genotypic diversity and low discriminatory power. Statistical analysis revealed no significant differences between the MCs compared to the clinical origin, date of isolation, AFLP genotype, or geographic locality (data not shown).

Microsatellite (STR) genotyping of serotype D isolates.

A set of 53 C. neoformans isolates that included 36 serotype D (genotype AFLP2), 14 serotype AD (genotype AFLP3), and 3 serotype BD (genotype AFLP8) isolates (Table 3) was studied by serotype D-specific microsatellite analysis. When all seven microsatellite CND markers were combined, 32 different microsatellite profiles could be distinguished among 53 isolates (Fig. 2). No microsatellite clusters could be determined due to the number of isolates used for analysis with this novel microsatellite typing panel. The discriminatory power for the complete set of seven microsatellite markers was found to be 0.966. Among the seven studied microsatellite loci, CND2A and CND2B had the highest genotypic diversity, with nine alleles (D = 0.813 and 0.73, respectively), while locus CND3C had the lowest genotypic diversity and the lowest resolution, with three alleles (D = 0.466). There were no cross-reactions observed when the serotype D microsatellite typing was performed on a set of non-serotype D C. neoformans and C. gattii isolates (data not shown). Statistical analysis revealed no significant differences between the MCs compared to the clinical origin, date of isolation, AFLP genotype, or geographic locality.

Fig 2.

Genotypic diversity of Cryptococcus neoformans variety neoformans isolates based on serotype D-specific microsatellite typing. Minimum spanning tree showing 53 C. neoformans var. neoformans isolates based on a novel seven-locus microsatellite typing panel. Each circle corresponds to a unique genotype. The size of the circles corresponds to the number of isolates of the same genotype. Connecting lines correspond to the number of differences between genotypes, with a solid thick line connecting genotypes that differ in one locus, a solid thin line connecting genotypes that differ in up to three loci, a dashed line connecting genotypes that differ in four loci, and a dotted line connecting microsatellite genotypes that differ in more than four loci. (A) The microsatellite genotypes. (B) Identical to panel A, except colors represent the AFLP genotypes of the isolates: green, AFLP2; dark blue, AFLP3; red, AFLP8. (C) Identical to panel B, except colors represent the source of isolation: green, CSF; red, blood; dark blue, source other than blood or CSF.

Mixed C. neoformans infections determined by AFLP and microsatellite typing.

Multiple isolates were available from 38 patients. The majority of these isolates were sampled on the same day but from different clinical specimens. While microsatellite profiles of most of these isolates were found to be identical, a few showed minor differences of one to three repeat units between one and two of the nine microsatellite loci studied.

Some patients were found to be infected with multiple C. neoformans strains. One immunosuppressed patient yielded nine serotype A isolates during a period of 2 weeks, and two showed major differences in three out of the nine microsatellite loci studied. A three-locus difference was also observed between isolates sampled on the same day from CSF and blood of one patient. The two isolates obtained from a patient that experienced a cryptococcosis relapse were found to be different for six loci and were a mix of minor (1 or 2) and major (>10) changes in repeat numbers. This pattern of minor and major differences in repeat numbers was also observed between two isolates sampled on the same day from a patient that was also found to be infected with C. neoformans serotype D, which was isolated 21 days prior and 24 days after the isolation of the two serotype A isolates. These two serotype D isolates were found to belong to two different genotypes of C. neoformans var. neoformans based on microsatellite typing, since they differed for six of the seven microsatellite loci. Two interspecies hybrid isolates of C. neoformans var. neoformans and C. gattii (genotype AFLP8) were cultured with an 88-day interval from an immunocompromised patient and were found to differ for five of the seven serotype D microsatellite loci.

Antifungal susceptibility testing.

MIC ranges, MIC₅₀s, MIC₉₀s, and geometric mean MICs of seven antifungal compounds are presented in Table 4. Susceptibility data for each of the seven antifungal compounds are presented for all 300 Cryptococcus spp. isolates as well as for the three major genotypes AFLP1 (n = 245), AFLP2 (n = 36), and AFLP3 (n = 14). For all four of these groups, the MIC₅₀ and the geometric mean MIC values differed by less than 1 log₂ dilution step, except for fluconazole and itraconazole.

Table 4.

Antifungal susceptibility per C. neoformans AFLP genotype^a

Strain and antifungal agent	MIC (μg/ml)
	Range	MIC50	Geometric mean	MIC90
C. neoformans variety grubii serotype A, AFLP1 (n = 245)
Amphotericin B	0.125–1	0.25	0.26	0.5
Flucytosine	0.125–>64	4	3.3	8
Fluconazole	0.25–64	4	3.1	8
Itraconazole	0.016–0.5	0.125	0.09	0.25
Voriconazole	0.016–1	0.063	0.08	0.125
Posaconazole	0.016–0.5	0.063	0.06	0.125
Isavuconazole	<0.016–0.5	0.031	0.04	0.125
C. neoformans variety neoformans serotype D, AFLP2 (n = 36)
Amphotericin B	0.063–1	0.125	0.18	0.25
Flucytosine	0.5–64	4	5.24	16
Fluconazole	0.25–16	1	1.39	8
Itraconazole	0.016–0.5	0.031	0.04	0.25
Voriconazole	0.016–0.5	0.031	0.04	0.125
Posaconazole	0.016–0.25	0.031	0.04	0.125
Isavuconazole	<0.016–0.25	0.031	0.02	0.125
C. neoformans variety neoformans serotype AD, AFLP3 (n = 14)
Amphotericin B	0.063–1	0.125	0.16	0.25
Flucytosine	2–8	4	3.81	8
Fluconazole	1–32	4	4.2	8
Itraconazole	0.031–0.5	0.063	0.07	0.125
Voriconazole	0.031–0.25	0.063	0.08	0.125
Posaconazole	0.016–0.125	0.063	0.05	0.063
Isavuconazole	0.016–0.25	0.031	0.04	0.063
C. neoformans and C. gattii, all genotypes (n = 300)
Amphotericin B	0.063–1	0.25	0.24	0.5
Flucytosine	0.125–>64	4	3.51	8
Fluconazole	0.25–64	4	2.87	8
Itraconazole	0.016–0.5	0.125	0.08	0.25
Voriconazole	0.016–1	0.063	0.07	0.125
Posaconazole	0.016–0.5	0.063	0.06	0.125
Isavuconazole	<0.016–0.5	0.031	0.03	0.125

^aThe range, MIC₅₀, geometric mean MIC, and MIC₉₀ are listed for the seven tested antifungal compounds for each of the four genotypic C. neoformans groups.

The overall MIC ranges for each of the seven antifungal compounds were 0.063 to 1 μg/ml for amphotericin B, 0.125 to >64 μg/ml for flucytosine, 0.25 to 64 μg/ml for fluconazole, 0.016 to 0.5 μg/ml for itraconazole and posaconazole, 0.016 to 1 μg/ml for voriconazole, and <0.016 to 0.5 μg/ml for isavuconazole. Fluconazole and flucytosine had the highest geometric mean MICs of 2.86 and 3.5 μg/ml, respectively, while amphotericin B (0.24 μg/ml), itraconazole (0.08 μg/ml), voriconazole (0.07 μg/ml), posaconazole (0.06 μg/ml), and isavuconazole (0.03 μg/ml) had much lower geometric mean MIC values. Isolates with MICs outside the normal range were tested on two different occasions and showed the same results. The Cryptococcus isolate with a high flucytosine MIC (>64 μg/ml) was cultured from blood obtained from an HIV-positive patient. However, a second CSF isolate from this patient from the same day had a low MIC (8 μg/ml), while microsatellite typing revealed that both isolates were nearly identical and should be considered microvariants of the same genotype. Nine and 10 C. neoformans isolates were less susceptible (≥16 μg/ml) for flucytosine and fluconazole, respectively.

Patients from whom multiple C. neoformans isolates were cultured, either at the same time from different body sites or at different time points, generally showed the same pattern of MIC values for the seven tested antifungal compounds. However, two HIV-positive patients were infected with serotype A isolates that showed large differences in fluconazole susceptibility (MICs of 4 and 64 μg/ml), while the isolates were genetically nearly all identical, with a minor difference for one microsatellite locus.

Statistical analysis showed that genotype AFLP1 (serotype A) isolates were significantly less susceptible to amphotericin B (0.26 μg/ml) than isolates with genotypes AFLP2 (serotype D) and AFLP3 (serotype AD) (0.18 and 0.16 μg/ml, respectively) (P < 0.0001). AFLP2 isolates were found to be significantly (P = 0.003) less susceptible to flucytosine (5.24 μg/ml) than genotype AFLP1 and AFLP3 isolates (3.30 and 3.81 μg/ml, respectively). Genotype AFLP2 isolates were significantly more susceptible to fluconazole, itraconazole, voriconazole, posaconazole (P < 0.0001 for each), and isavuconazole (P = 0.0022) than AFLP1 and AFLP3 isolates, as shown by their geometric mean MIC values (Table 4). However, based on the geometric mean MIC values, only those of genotype AFLP2 isolates were found to differ by more than 1 log₂ dilution step for fluconazole compared to AFLP1 and AFLP3 isolates, whereas genotype AFLP2 isolates also differed a log₂ dilution step for itraconazole compared to genotype AFLP1 isolates. No significant differences in antifungal susceptibility patterns were observed between the four patient categories.

DISCUSSION

A cohort of Dutch HIV-positive cryptococcosis patients has been investigated previously from a clinical epidemiological point of view, but no data were presented on the Cryptococcus neoformans isolates (42). To obtain detailed insights into the epidemiology of this opportunistic pathogenic yeast in the Netherlands, a set of 300 C. neoformans isolates from 237 patients obtained during 1977 to 2007 was investigated.

Nearly half of the cryptococcosis patients were found to be HIV positive (n = 115; 48.5%). When patients with a known immune status were considered, the percentage of HIV-positive patients was 62.8%, which is similar to data from other European studies. A French study showed that 77% (n = 177) of the patients with cryptococcosis were HIV infected (17); in a cohort of 77 Austrian, German, and Swiss patients this was 68% (n = 52) (40), a Spanish study observed 87% (n = 48) (20), and a 30-month European survey reported 77% (n = 435) of HIV-positive patients (43). In the current study, 18 (7.6%) patients were found to have no underlying disease or any other predisposing factors, such as corticosteroid treatment. When corrected for patients with a known immune status, the percentage of immunocompetent patients was found to be 9.9%. A French study observed nine (4%) immunocompetent patients within the studied cohort (17). Remarkably, several recent reports from far-east Asia noted that large numbers of cryptococcosis patients are immunocompetent, with values ranging from 13 to 92% of the investigated cohort of patients from China, South Korea, Taiwan, and Vietnam (9–11, 14, 29, 34, 45). Interestingly, these immunocompetent patients were found to be infected with C. neoformans var. grubii, which was also the case for the majority (n = 20; 83.3%) of Dutch immunocompetent cryptococcosis patients. Recent studies from South Korea and Vietnam have observed a correlation between the immune status of the patient and the genotype of the isolated C. neoformans var. grubii strain (10, 14).

In contrast to C. neoformans var. grubii, the epidemiology of C. neoformans var. neoformans has been poorly studied. From the few available studies it is known that serotype D isolates are more prevalent in Europe (27, 43). In the current study, only 12% of the clinical isolates were serotype D (Table 3). A higher percentage of isolates (20.5%) was found among 410 French C. neoformans isolates (16). However, in Italy, 71% of the C. neoformans isolates were found to be serotype D (41). A European survey observed that a large proportion of the 311 C. neoformans isolates were serotype D (30%) and serotype AD (19%) (43). A higher proportion of infections caused by C. neoformans var. neoformans was observed in several Mediterranean countries than in the northwestern European area (20, 43). Furthermore, genotyping studies revealed that 33.9% of the isolates from Madrid, Spain, fell into the hybrid genotype cluster AFLP3 (serotype AD) and 19.6% in genotype AFLP2 (serotype D) (20). Other epidemiological surveys from Brazil, China, South Korea, Taiwan, and Vietnam revealed that serotype D isolates are rarely found or are absent (2, 9–11, 29).

Until recently, it was believed that C. neoformans had a predilection to cause disease in immunocompromised patients, while C. gattii was found to preferentially cause disease in immunocompetent individuals (5). However, several studies observed that a substantial number of cryptococcal infections in African HIV-infected patients are caused by C. gattii, thus indicating that the presumed preference for a certain patient category is not valid (32, 38). In the Netherlands, two patients were found to be infected by C. gattii. One case was caused by a travel-related C. gattii AFLP6 infection in an immunocompromised Dutch patient who developed cryptococcosis after corticosteroid treatment (22). The second case was caused by a C. gattii AFLP4 isolate that was cultured from a 54-year-old Dutch male who became HIV infected during his stay in Africa. MLST analysis revealed that the latter isolate fell into a clade with African C. gattii AFLP4 isolates. This particular strain (N114) was further investigated by Ferry Hagen and Teun Boekhout (unpublished data). These cases suggest that C. gattii can be dormant in the human host, and that it can be activated when the immune status is attenuated due to disease or treatment with corticosteroids. Although C. gattii AFLP4 has been isolated from environmental sources in the Netherlands, an autochthonous infection has not yet been observed in the current study (12). Three Cryptococcus isolates from the current study were found to be interspecies hybrids between C. gattii AFLP4 and C. neoformans AFLP2 and caused disease in an apparently healthy and an immunocompromised patient, respectively (7).

Microsatellite typing has recently been applied to C. neoformans var. grubii and was shown to be an excellent tool to discriminate isolates as well as to study their epidemiology (24, 25). This molecular typing tool was first applied using a set of 122 clinical and 68 environmental C. neoformans var. grubii isolates from Cuba and distinguished 104 different genotypes (D_Cuba = 0.993) and 11 MCs. The genetic diversity of the Dutch clinical C. neoformans var. grubii population is slightly higher than that observed in Cuba (D_Netherlands = 0.994) with 196 genotypes among 259 studied isolates, including the two novel clusters MC13 and MC14 (Fig. 1). This slightly higher genetic diversity of the Dutch C. neoformans var. grubii isolates may be due to one or more of the following. First, the time span of this retrospectively study is 30 years, which is longer than the 20-year time frame of the Cuban study. Second, the composition of the Dutch population is characterized by extensive immigration, which includes people from the former overseas colonies of Surinam, Netherlands Antilles, and Indonesia, as well as immigrants from northern Africa and eastern Europe (CBS Statistics Netherlands; www.cbs.nl; population data for 1899 to 2010). It is likely that a proportion of the Dutch cryptococcosis patients are immigrants that acquired a subclinical infection with C. neoformans prior to immigration to the Netherlands, and this may contribute to the observed higher genetic diversity in the studied cohort. Third, it has recently been shown that C. neoformans can produce in vivo diploid offspring from haploid parental isolates, via either cell fusion or endoreplication (15). Thus, a further possibility is that dormant C. neoformans isolates become activated upon immune suppression and that during the course of infection and/or antifungal therapy, C. neoformans cells fuse to form hybrids that are more resistant to the antifungal compounds (14). The recent observation of clinical interspecies hybrids between C. neoformans and C. gattii from clinical sources suggests that these hybrids can be formed in vivo (7, 8).

Antifungal susceptibility testing has frequently been applied to C. neoformans. The development of new antifungal drugs, such as the novel triazoles and the reported increase in antifungal resistance, highlights the importance of monitoring the susceptibility profiles of clinical C. neoformans isolates. The number of resistant and less susceptible isolates observed in the current study remained low. One isolate was found to be flucytosine resistant, and nine were less susceptible for this antifungal compound. High MICs remain exceptional; a few were found, including for the two isolates from CSF and blood from the same patient, with at least a 4 log₂ dilution difference in MIC of flucytosine (8 and >64 μg/ml). In our collection, flucytosine resistance was rare, but there are countries where it is emerging, such as Indonesia (34). Nine isolates were less susceptible for fluconazole, while all other antifungal compounds inhibited the growth of C. neoformans. A global antifungal susceptibility study revealed that the observed resistance against amphotericin B, flucytosine, and fluconazole was less than 1% of the tested isolates (36). Interestingly, these authors found that, during the time span of their study, C. neoformans became more susceptible to flucytosine and fluconazole. This phenomenon, however, has not been observed in the current study. It seems that the number of C. neoformans isolates resistant against the conventional antifungal compounds remains limited. Several recently published antifungal susceptibility studies, including the current one, showed that posaconazole, voriconazole, and isavuconazole are promising candidates to replace the conventional drugs, since the latter have potential toxic side effects (20, 21, 23, 36, 39, and this study). The present study shows that genotype AFLP1 and AFLP3 isolates are less susceptible to fluconazole than AFLP2 isolates. This genotypic difference was only recently observed in a Croatian study that found a similar result for fluconazole, although this difference was not significant between AFLP2 and AFLP3 isolates (31). The current study shows that there is a trend toward lower MIC values of amphotericin B for genotype AFLP2 isolates, similarly to that observed in the Croatian and Spanish studies (20, 31). The Croatian and Spanish studies did not observe a significant difference between any of the tested antifungal compounds versus the AFLP genotypes, except for Spanish AFLP1 isolates that were less susceptible to amphotericin B than Spanish AFLP3 isolates (20, 31). Similarly to our study, the Spanish study did not observe a significant difference between patient categories versus antifungal susceptibility.

In conclusion, C. neoformans var. grubii is the major cause of cryptococcosis among immunocompromised and immunocompetent individuals in the Netherlands. AFLP genotyping and microsatellite typing showed that the Dutch clinical C. neoformans var. grubii population is genetically more diverse than other recently studied populations. In vitro antifungal susceptibility testing showed that resistance and decreased susceptibility are not major issues in the Netherlands, and the novel triazoles are promising candidates for treatment strategies against cryptococcosis.