Increased Resting Intracellular Calcium Modulates NF-κB-dependent Inducible Nitric-oxide Synthase Gene Expression in Dystrophic mdx Skeletal Myotubes

Background: The mechanisms by which NF-κB signaling is up-regulated in dystrophic muscles are unclear.

Results: [Ca²⁺]_rest is elevated in mdx myotubes as a result of both sarcolemmal Ca²⁺ entry and SR release, resulting in NF-κB-induced iNOS expression.

Conclusion: Ca²⁺ alterations at rest modulate NF-κB transcriptional activity and pro-inflammatory gene expression.

Significance: This allows for understanding the mechanism that relates elevated resting calcium and altered gene expression in muscular dystrophy.

Abstract

Duchenne muscular dystrophy (DMD) is a genetic disorder caused by dystrophin mutations, characterized by chronic inflammation and severe muscle wasting. Dystrophic muscles exhibit activated immune cell infiltrates, up-regulated inflammatory gene expression, and increased NF-κB activity, but the contribution of the skeletal muscle cell to this process has been unclear. The aim of this work was to study the pathways that contribute to the increased resting calcium ([Ca²⁺]_rest) observed in mdx myotubes and its possible link with up-regulation of NF-κB and pro-inflammatory gene expression in dystrophic muscle cells. [Ca²⁺]_rest was higher in mdx than in WT myotubes (308 ± 6 versus 113 ± 2 nm, p < 0.001). In mdx myotubes, both the inhibition of Ca²⁺ entry (low Ca²⁺ solution, Ca²⁺-free solution, and Gd³⁺) and blockade of either ryanodine receptors or inositol 1,4,5-trisphosphate receptors reduced [Ca²⁺]_rest. Basal activity of NF-κB was significantly up-regulated in mdx versus WT myotubes. There was an increased transcriptional activity and p65 nuclear localization, which could be reversed when [Ca²⁺]_rest was reduced. Levels of mRNA for TNFα, IL-1β, and IL-6 were similar in WT and mdx myotubes, whereas inducible nitric-oxide synthase (iNOS) expression was increased 5-fold. Reducing [Ca²⁺]_rest using different strategies reduced iNOS gene expression presumably as a result of decreased activation of NF-κB. We propose that NF-κB, modulated by increased [Ca²⁺]_rest, is constitutively active in mdx myotubes, and this mechanism can account for iNOS overexpression and the increase in reactive nitrogen species that promote damage in dystrophic skeletal muscle cells.

Introduction

Duchenne muscular dystrophy (DMD)² is a lethal human X-linked genetic disorder caused by mutations in the dystrophin gene (1). DMD is a progressive muscle-wasting disease characterized by loss of the ability to walk between 6 and 12 years of age and death, caused by respiratory failure and cardiac dysfunction in their twenties (2). Like humans with DMD, mdx mice lack dystrophin due to an X-linked mutation providing an accepted model to study the human disease (1). In normal skeletal muscle, dystrophin is associated with a complex of glycoproteins known as dystrophin-glycoprotein complex, providing a linkage between the extracellular matrix and cytoskeleton (3). Dystrophin has an important role in stabilizing the sarcolemma, so in muscle fibers that lack this protein, membrane damage is recurrent (4, 5). However, although membrane fragility is an important factor, it does not fully explain the onset and progression of DMD.

The microenvironment of dystrophic muscle consists of activated immune cell infiltrates and up-regulated inflammatory gene expression (6). Nuclear factor-κB (NF-κB) consists of a family of transcription factors that play critical roles in inflammation, immunity, cell proliferation, differentiation, and survival (7). The NF-κB transcription factor family in mammals consists of five proteins, p65 (RelA), RelB, c-Rel, p105/p50 (NF-κB1), and p100/52 (NF-κB2), that form homo- and heterodimeric complex (7). NF-κB has been implicated in mdx pathology, because blockade of this pathway through pharmacological or genetic approaches improves muscle histology, reduces pro-inflammatory gene expression, and ameliorates damage (8–12). NF-κB activity is increased in muscles from mdx mice and DMD patients (10, 13–15). The p65/p50 heterodimer is the predominant form of NF-κB in most cells and controls the expression of a wide array of genes critical in the immune response and inflammation (16). IkBα retains the p65/p50 heterodimer in the cytoplasm. Upon stimulation, IkBα is quickly phosphorylated by the IKK complex, ubiquinated, and degraded, thus allowing the translocation to the nucleus of the NF-κB complex (7).

IKKα/β or p65 gene ablation in transgenic animals or by adeno-associated virus improves pathology in mdx mouse muscles (8–12). Acharyya et al. (10) have shown that NF-κB activity can be seen in both muscle and immune cells and that mdx muscle pathology was improved in mdx/p65^+/− but not mdx/p50^+/− mice.

NF-κB gene targets, such as the pro-inflammatory cytokines TNF-α, IL-1β, IL-6, and iNOS are up-regulated in muscles from Duchenne patients and mdx mice (10, 17–20). In mdx mice, injections of the nonspecific NF-κB inhibitor curcumin have been shown to reduce NF-κB activation and TNF-α, IL-1β, and iNOS expression (6, 9).

iNOS or NOS2, originally discovered in cytokine-induced macrophages, is a largely calcium-independent NOS, which is expressed at highest levels in immunologically activated cells and is normally absent in resting cells (21). iNOS expression is increased in muscles from mdx mice and can be reversed by curcumin (9, 22, 23). High levels of nitric oxide (NO) production lead to the formation of peroxynitrite, a highly reactive species contributing to muscle oxidative damage (21, 24). In addition, iNOS expression has been associated with S-nitrosylation of type 1 ryanodine receptor (RyR1), calcium dysregulation, and muscle pathology in mdx mice (22).

Although there are many examples in the literature indicating that resting intracellular free Ca²⁺ concentration ([Ca²⁺]_rest) is higher in skeletal muscle cells from mdx mice and DMD patients compared with normal cells (25–30), others authors have not (31, 32). The mechanism that has been proposed for causing this elevation in [Ca²⁺]_rest assumes recurrent membrane damage due the failure of dystrophin function to stabilize the sarcolemma (5, 33), allowing Ca²⁺ leak into the cell through the damaged membrane. An alternative explanation is an increased Ca²⁺ entry through transient receptor potential channel 1 (TRPC1) and hyperactive store-operated calcium entry (SOCE) in mdx muscle fibers (25, 34–38).

Several studies have shown that NF-κB activity can be modulated by intracellular Ca²⁺ levels (39–42). In skeletal muscle cells, depolarization with high K⁺ or electrical stimulation activates NF-κB through Ca²⁺ signals elicited by the ryanodine (RyR) and inositol 1,4,5-triphosphate (IP₃R) receptors (40).

In dystrophic muscle cells, increased [Ca²⁺]_rest, has been mainly thought to cause necrosis through calpain activation and mitochondrial permeability transition pore (29, 43, 44). Here, we have revisited the issue of elevated [Ca²⁺]_rest in dystrophic mdx skeletal muscle cells showing that it is a complex process that involves sarcolemmal Ca²⁺ entry as well as SR Ca²⁺ leak, both through RyRs and IP₃Rs. In addition, we demonstrate that the level of [Ca²⁺]_rest modulates the transcription factor NF-κB activity and iNOS expression in mdx myotubes.

MATERIALS AND METHODS

Cell Culture

All procedures for animal use were in accordance with guidelines approved by the Bioethical Committee at the Facultad de Medicina, Universidad de Chile. Primary myotubes from wild type C57BL/6 and mdx mice were isolated according to the method of Rando and Blau (45). The myoblasts were grown and differentiated as described previously (46).

Determination of [Ca²⁺]_rest by Ca²⁺-selective Microelectrodes

Double-barreled Ca²⁺-selective microelectrodes were prepared and calibrated as described previously (47). Only those electrodes with a linear relationship between pCa3 and pCa8 (Nernstian response, 28.5 mV per pCa unit at 24 °C) were used experimentally. To better mimic the intracellular ionic conditions, all calibration solutions were supplemented with 1 mm Mg²⁺. All electrodes were then re-calibrated after making measurements of [Ca²⁺]_rest, and if the two calibration curves did not agree within 3 mV from pCa7 to pCa8, the data from that microelectrode was discarded. Myotubes were impaled with the double-barreled microelectrode, and potentials were recorded via high impedance amplifier (WPI Duo-773). The potential from the 3 m KCl barrel (V_m) was subtracted electronically from VCa_E to produce a differential Ca²⁺-specific potential (V_Ca) that represents the [Ca²⁺]_rest. V_m and V_Ca were filtered (30–50 KHz) to improve the signal-to-noise ratio and stored in a computer for further analysis. The experiments were performed in Krebs-Ringer solution (in mm: 125 NaCl, 5 KCl, 2 CaCl₂, 1.2 MgSO₄, 6 glucose, and 25 Hepes/Tris, pH 7.4). The low Ca²⁺ solution was prepared replacing the CaCl₂ with MgCl₂ (≈7 μm Ca²⁺). Ca²⁺-free solution was prepared by omitting Ca²⁺ and adding Mg²⁺ (2 mm) and EGTA (2 mm). We avoided measurements of [Ca²⁺]_rest after long incubations in both solutions (more than 5 min) because, despite the fact that the solution was supplemented with 2 mm Mg²⁺, all myotubes began to show a significant depolarization (>8 mV) after this interval.

In every experiment, we determined the [Ca²⁺]_rest in control conditions in both WT and mdx myotubes, and data were expressed as the total average for basal [Ca²⁺]_rest for WT and mdx myotubes (Fig. 1).

FIGURE 1.

A, resting intracellular Ca²⁺ concentrations ([Ca²⁺]_rest); B, resting membrane potentials (V_m) measured by double-barreled microelectrodes in WT and mdx primary myotubes. Data are expressed as means ± S.E., n = 20 for WT and n = 38 for mdx, indicated inside the bars. ***, p < 0.001 versus WT.

Sarcoplasmic Reticulum Ca²⁺ Content

To estimate the total amount of Ca²⁺ stored in the intracellular compartments, primarily from the SR stores, myotubes were loaded with 5 μm Fluo-4-AM or Fluo-5N-AM for 30 min at 37 °C. Cells were placed on the stage of an inverted microscope equipped with epifluorescence illumination (XCite® Series 120 or Lambda DG4) equipped with a CCD cooled camera (Retiga 2000R or Stanford Photonics 12 bit digital). The cell-containing coverslips or μ-clear 96-well/plates (Greiner Bio-one) were placed in the microscope for fluorescence measurements after excitation with a 488-nm wavelength filter system (Lambda 10–2 or DG4, Sutter Instruments). The emission signal was acquired at a frequency of 10 frames/s. The amount of SR Ca²⁺ was estimated by taking the area under the curve of the signal induced by 5 μm ionomycin in Ca²⁺-free solution to minimize Ca²⁺ entry. Fluorescence data (F) was analyzed by normalizing with respect to basal fluorescence (F₀) and expressed as (F − F₀)/F₀.

Resting Ca²⁺ Entry

Myotubes were loaded with Fura2-AM (5 μm) for 30 min at 37 °C and the cells were perfused with low Ca²⁺ solution for 1 min; then the perfusion system was switched to Mn²⁺-containing solution (in mm: 125 NaCl, 5 KCl, 0.5 MnCl₂, 2.7 MgSO₄, 6 glucose, and 25 Hepes/Tris, pH 7.4) for 1 min. During the quench, the perfusion system was switched to Mn²⁺ containing solution with gadolinium tri-chloride for an additional 1 min (Gd³⁺, 20 μm), to study the effect of the later on Ca²⁺ entry. To calculate the fluorescence quench rate, the stable part of the signal was fitted to a linear regression. The derived slope was expressed as fluorescence arbitrary units/s. The excitation wavelength used to measure Mn²⁺ quench of Fura-2 was monitored using a 357/7-nm excitation and 510/80-nm emission filter.

Immunofluorescence and Confocal Microscopy

For immunofluorescence localization of the NF-κB p65 subunit, differentiated myotubes were fixed in 4% paraformaldehyde for 10 min at RT. Cells were rinsed with PBS, then blocked with PBS, 1% BSA for 1 h at room temperature, and incubated overnight with p65 antibody at a 1:200 dilution at 4 °C. Cells were washed and then incubated for 1 h with Alexa Fluor-488 anti-rabbit antibody (Invitrogen). Hoechst was used for nuclear visualization. Immunofluorescence was observed in a confocal microscope (Carl Zeiss, Axiovert 200, LSM 5-Pascal) and images were deconvolved using Iterative Deconvolution software of ImageJ. To determine the nuclear localization of the NF-κB p65 subunit, the fluorescence intensity of nuclear and cytosolic region of interest was calculated for at least 10 different myotubes in three different experiments and averaged to calculate the ratio of nuclear over cytoplasmic intensity using the ImageJ program. z-stack images were reconstructed using the Interactive 3D Surface Plot ImageJ plugin (rsb.info.nih.gov) that translates the luminance of an image as height for the plot. DAF-FM diacetate (Molecular Probes) fluorescence was detected according to the manufacturer's instructions by confocal microscopy with an excitation 488 nm wavelength argon laser.

Western Blot

Total protein lysates were prepared from differentiated myotubes by homogenizing them in a lysis buffer containing 20 mm Tris-HCl, pH 7.5, 1% Triton X-100, 1 mm EDTA, 1 mm EGTA, 20 mm NaF, 1 mm Na₂P₂O₇, 10% glycerol, 150 mm NaCl, 10 mm Na₃VO₄, 1 mm PMSF, and protease inhibitors (Complete^TM, Roche Applied Science). Proteins were separated using SDS-PAGE and transferred to PVDF membranes. The following primary antibodies and their dilutions were used: NF-κB p65 subunit (1:1000; Cell Signaling); iNOS (1:2000; Santa Cruz Biotechnology); GAPDH (1:2000, Santa Cruz Biotechnology); and β-actin (1:10,000, Sigma). The protein bands in the blots were visualized using an ECL detection kit (Pierce), and the intensity of the bands was determined with ImageJ densitometric analysis.

siRNA Transfection

NF-κB p65 and scramble siRNA were purchased from Santa Cruz Biotechnology. NF-κB p65 siRNA is a pool of four target-specific double-stranded siRNAs. Myoblasts at 50–70% confluence were transfected with both siRNAs (50 nm) with DharmaFECT Duo (Dharmacon) for 3 h at 37 °C and 5% CO₂ in 35-mm culture plates in Opti-MEM (Invitrogen). Following transfection, myoblasts were differentiated for 48 h and lysed for protein detection by Western blot.

NF-κB Luciferase Reporter Activity Determinations

A plasmid containing five tandems repeats of NF-κB-binding sites cloned upstream of a luciferase reporter gene (pNF-κB-Luc) was obtained from Agilent Technologies and subcloned in a lentiviral vector with neomycin resistance, and lentiviral particles were produced by transient transfection of HEK 293T cells as described (48). Supernatants were collected, and myoblast cultures were transduced immediately after isolation at a multiplicity of infection of 1:500 in the presence of 6 μg/ml protamine sulfate for 3 h. Cells were allowed to recover for 48 h and then selected with neomycin (400 μg/ml) for 9 days. After infection and selection, myoblasts were completely normal and differentiated into myotubes similarly to uninfected cells. To minimize clonal variations, we pooled together more than 100 G418-resistant clones from each transduction to perform the experiments. Luciferase activity was determined using a Dual-Luciferase reporter assay system (Promega) according to the manufacturer's instructions, and light detection was carried out in a Berthold F12 luminometer. Results were normalized with total protein, and the relation “luciferase mg⁻¹ protein” was shown. We studied the response to lipopolysaccharide (LPS), a strong activator of NF-κB as a control (data not shown).

Real Time PCR

Total RNA from myotubes cultures was obtained using TRIzol reagent (Invitrogen) according to the manufacturer's protocol. cDNA was prepared by reverse transcription of 1 μg of total RNA, using SuperScript II (Invitrogen). Real time PCR was performed using a Stratagene Mx3000P as follows. Primers were used at a final concentration of 400 nm. Briefly, 1–4 μl of cDNA reaction together with the appropriate primers was added to 10 μl of Brilliant III UltraFast SYBR Green QPCR master mix (Agilent Technologies) to a total volume of 20 μl. No-template control reactions were also prepared for each gene. The cycling parameters for all genes were as follows: 95 °C for 3 min, then 50 cycles of 95 °C for 20 s, and 60 °C for 20 s. Expression values were normalized to GAPDH and are reported in units of 2^−ΔΔCt ± S.E (49). PCR products were verified by melting-curve analysis, resolved by electrophoresis on 2% agarose gel, and stained with ethidium bromide.

The TNF-α, IL-1β, IL-6, iNOS, and GAPDH mRNA transcripts were quantified using oligonucleotide primers designed based on sequences published in NCBI GenBank^TM with the open-source PerlPrimer software (50). The forward and reverse primers sequences used in this study are shown in Table 1.

TABLE 1.

Oligonucleotides used for detection of mRNA levels by real time PCR in myotubes derived from WT and mdx mice primary culture

mRNA	Accession no.	Forward primer (5′ → 3′)	Reverse primer (5′ →3 ′)	Amplicon	Source or Ref.
				bp
GAPDH	NM_008084.2	CTCATGACCACAGTCCATGC	TTCAGCTCTGGGATGACCTT	155	This study
iNOS	NM_010927.3	CAGCTCAAGAGCCAGAAACG	TTACTCAGTGCCAGAAGCTG	141	This study
IL-1β	NM_008361.3	CTTTGAAGAAGAGCCCATCC	TTTGTCGTTGCTTGGTTCTC	229	This study
IL-6	NM_031168.1	CCAATTTCCAATGCTCTCCT	ACCACAGTGAGGAATGTCCA	182	(83)
TNF-α	NM_013693.2	TCACACTCAGATCATCTTCTC	ATGAGATAGCAAATCGGCTG	261	This study

Statistics

All values are expressed as mean ± S.E. from at least three different determinations. Results of luciferase activity, p65 immunofluorescence, DAF-FM fluorescence, and Western blot were transformed with the WT basal average (y = y′/(WT basal average)) to normalize to 1 with S.E. Statistical analysis was performed using an unpaired two-tailed t test or analysis of variance-Bonferroni to determine significance (p < 0.05).

RESULTS

[Ca²⁺]_rest Is Increased in Dystrophic mdx Myotubes

Resting membrane potentials (V_m) and [Ca²⁺]_rest were measured in differentiated WT and mdx myotubes with Ca²⁺-selective microelectrodes. The [Ca²⁺]_rest observed in mdx myotubes was significantly higher than that observed in WT myotubes (308 ± 6 nm, n = 38 versus 113 ± 2 nm, n = 20, p < 0.001) (Fig. 1A). V_m was significantly increased in mdx myotubes compared with the WT counterpart (−50 ± 0.2 mV, n = 38 versus −62 ± 0.2 mV, n = 20, p < 0.001) (Fig. 1B).

Blockade of Ca²⁺ Entry in mdx Myotubes Reduced but Did Not Normalize [Ca²⁺]_rest

Several studies have suggested that [Ca²⁺]_rest is increased in mdx skeletal muscle cells, due to an increased Ca²⁺ entry from extracellular space through TRPC1 and/or SOCE channels (25, 34–38). To explore the contribution of extracellular Ca²⁺ to [Ca²⁺]_rest in WT and mdx myotubes, we used four different strategies as follows: low Ca²⁺ solution, Ca²⁺-free solution, Krebs-Ringer solution supplemented with gadolinium trichloride (Gd³⁺, 20 μm), and Ca²⁺-free solution with Gd³⁺(see under “Materials and Methods”). Cells were incubated for 2 min before [Ca²⁺]_rest determinations were made. We observed a nonsignificant reduction in [Ca²⁺]_rest in WT myotubes after the addition of low Ca²⁺ solution, Ca²⁺-free solution, and Gd³⁺ solution (92.9 ± 1 nm, n = 20, 91.0 ± 1 nm, n = 15, and 86.3 ± 1 nm, n = 20, all p > 0.05 compared with the WT basal value) (Fig. 2A). In mdx myotubes, there was a significant decrease in [Ca²⁺]_rest in all conditions (184 ± 8 nm, n = 12, with low Ca²⁺, 148 ± 6 nm in Ca²⁺ free solution, n = 10, 147 ± 1 nm, n = 11, after Gd³⁺, all of them p < 0.001 compared with the mdx basal value) (Fig. 2A). The addition of Gd³⁺ to the Ca²⁺-free solution did not cause a further reduction of [Ca²⁺]_rest, suggesting that Gd³⁺ by itself was able to block the active Ca²⁺-entry pathway. In addition, we estimated Ca²⁺ entry by Mn²⁺ quench of Fura-2 fluorescence. Rates of Mn²⁺ quench were significantly higher in mdx myotubes (Fig. 2, B and C), and this was completely blocked by the addition of Gd³⁺ (20 μm). Although inhibition of Ca²⁺ entry by either Gd³⁺ or removal of extracellular Ca²⁺ reduced [Ca²⁺]_rest in mdx myotubes, it did not return it to WT levels, suggesting an additional mechanism(s) causing [Ca²⁺]_rest dysregulation in mdx myotubes.

FIGURE 2.

Ca²⁺ entry contribution to [Ca²⁺]_rest measured in WT and mdx myotubes. A, effects of removal of extracellular Ca²⁺ (low Ca²⁺ solution and Ca²⁺-free solution) and Gd³⁺ treatment on [Ca²⁺]_rest. B and C, measurements of resting Ca²⁺ entry using Mn²⁺ quench in WT and mdx myotubes. B, representative traces of Fura-2 fluorescence quench by Mn²⁺ measured under resting conditions. C, quantification of the rate of Mn²⁺ quench, between WT and mdx myotubes. Gd³⁺ (20 μm) was added during the experimental determination of Mn²⁺ quench as shown in figure. Data are expressed as mean ± S.E. ***, p < 0.001 versus WT basal value; †††, p < 0.001 versus mdx basal value. §§§, p < 0.001 is indicated in the figure. f.a.u./s, fluorescence arbitrary units/s.

Inhibition of RyRs and IP₃Rs Reduced [Ca²⁺]_rest in mdx Myotubes

We have previously reported that [Ca²⁺]_rest depends largely on a Ry-insensitive leak by RyR1 (“RyR1 leak”) and was unaffected by Ry treatment (47). Bastadin 5 (B5), a brominated macrocyclic derivative of dityrosine, isolated from the marine sponge Icanthellabasta (51), interacts with RyR1, modulating RyR1 gating behavior in an FKBP12-dependent manner. B5 can be used as a pharmacological tool to convert RyR1 from its leak conformation into a gating conformation, restoring the Ry sensitivity (47). We studied the contribution of RyR1 to the [Ca²⁺]_rest in mdx myotubes (Fig. 3A). Ry treatment alone did not modify [Ca²⁺]_rest in WT myotubes but did cause a significant reduction of [Ca²⁺]_rest in mdx myotubes (99 ± 3 nm, n = 15, p > 0.05, 213 ± 5 nm, n = 19, p < 0.001 compared with WT and mdx basal values, respectively). Addition of B5 in the presence of Ry significantly diminished [Ca²⁺]_rest in both WT and mdx myotubes (80 ± 1 nm, n = 9, p < 0.05, 166 ± 9 nm, n = 9, p < 0.001 compared with WT and mdx basal values, respectively) but also did not reduce mdx basal values to those seen in WT.

FIGURE 3.

RyR and IP₃R participation in [Ca²⁺]_rest in WT and mdx myotubes. A, effect of Ry (30 μm), Ry + B5 (Ry, 30 μm, and B5, 10 μm), U-73343 (5 μm), U-73122 (5 μm), and XeC (5 μm) on [Ca²⁺]_rest (treatments for 3 h). B, representative traces of Fluo-4 fluorescence signals after the addition of 5 μm ionomycin, in the absence of extracellular Ca²⁺ (Ca²⁺-free solution) in WT, mdx, and Ry- and XeC-treated mdx myotubes. C, average area under the curve of the ionomycin-induced Ca²⁺ transients. Data are expressed as means ± S.E. ***, p < 0.001; **, p < 0.01; *, p < 0.05 versus WT basal value, †, p < 0.05; †††, p < 0.001 versus mdx basal value. §§§, p < 0.001 is indicated in the figure.

We have previously demonstrated that the expression of IP₃Rs, as well as the total mass of inositol 1,4,5-trisphosphate, is increased in both mdx and human DMD-derived cell lines compared with normal cells (52). U-73122 (a PLC inhibitor) and Xestospongin C (an IP₃R blocker) significantly reduced the [Ca²⁺]_rest only in mdx myotubes (241 ± 7 nm, n = 24, and 232 ± 6 nm, n = 20, respectively, both p < 0.001 compared with the mdx basal value), without any significant effect in WT myotubes (113 ± 2 nm, n = 21, and 97 ± 2 nm, n = 16, respectively, p > 0.05 compared with WT basal values) (Fig. 3A), whereas U-73343 (an inactive PLC inhibitor) did not modify [Ca²⁺]_rest in either WT or mdx myotubes.

To quantify the level of the SR Ca²⁺ store, we exposed WT and mdx myotubes loaded with Fluo-4-AM to 5 μm ionomycin in Ca²⁺-free solution. Under these conditions, the total Ca²⁺ released was significantly smaller in mdx myotubes compared with WT myotubes (area under curve = 23.7 ± 2.4 versus 40.4 ± 4.2, p < 0.01) (Fig. 3, B and C, and representative fluorescence images in supplemental Fig. S1). Similar results were obtained in Fluo-5N-loaded myotubes (supplemental Fig. S2). Moreover, treatment (3 h) with either Ry (30 μm) or XeC (5 μm), partially restored the SR Ca²⁺ content in mdx myotubes (Fig. 3C), suggesting that the reduction in the SR Ca²⁺ levels is due to a Ca²⁺ leak from the SR through both RyRs and IP₃Rs that modulates [Ca²⁺]_rest.

NF-κB Activity Is Up-regulated in Dystrophic Myotubes and Can Be Reversed with Inhibitors That Reduce [Ca²⁺]_rest

We studied the subcellular distribution of the p65 subunit of NF-κB. Fig. 4A shows an increased nuclear localization of p65 in mdx myotubes compared with WT myotubes, measured by immunofluorescence and confocal microscopy. Three-dimensional reconstruction of z-stack images shows that p65 is located primarily in the cytosol, but in mdx myotubes, the distribution is diffuse with both cytoplasmic and nuclear localization. Basal fluorescence ratio of p65 between nucleus and cytosol was increased about 50% in dystrophic myotubes compared with normal myotubes (Fig. 4B). We assessed the transcriptional activity of NF-κB using a reporter that contains five tandems repeats of NF-κB-binding sites cloned upstream of a luciferase gene (see “Materials and Methods”). Luciferase activity was increased 2.5-fold in mdx myotubes compared with WT myotubes (Fig. 4C). To establish a correlation between [Ca²⁺]_rest and NF-κB transcriptional activity_, we treated myotubes for 6 h with Gd³⁺, Ry, and XeB (53, 54) as described previously at the same concentrations. None of these drugs caused a significant change in the luciferase reporter activity in WT myotubes (p > 0.05) (Fig. 4C). However, blockade of sarcolemmal Ca²⁺ entry with Gd³⁺ reduced the luciferase reporter activity by 19% (p > 0.05), and pretreatment with Ry or XeB reduced it by 58 and 38%, in mdx myotubes, respectively (p < 0.001 and p < 0.01, respectively, compared with the mdx basal value). Furthermore, 1,2-bis(2-aminophenoxy)ethane-N,N,N′,N′-tetraacetic acid tetrakis(acetoxymethyl ester) (BAPTA AM, 50 μm) treatment reduced NF-κB transcriptional activity in mdx myotubes by 43% (p < 0.05) without any significant effect in WT myotubes. To confirm the contribution of Ca²⁺ released by SR, we measured the subcellular distribution of p65 in the presence of Ry or XeB. Both inhibitors reduced nuclear/cytosol p65 fluorescence by mdx myotubes (Fig. 4B).

FIGURE 4.

NF-κB activity in WT and mdx myotubes. A, left panel, representative z-stack immunofluorescence images obtained by confocal microscopy; right panel, three-dimensional reconstructions made with the ImageJ (National Institutes of Health) plugin Interactive 3D Surface Plot. B, effect of SR Ca²⁺ release inhibition in p65 subcellular distribution. C, NF-κB luciferase reporter activity in WT and mdx myotubes treated with Ca²⁺ inhibitors. Myotubes were incubated for 6 h and then lysed for luciferase activity determination. Data are expressed as mean ± S.E. from at least three different determinations, ***, p < 0.001 versus WT basal value, †††, p < 0.001; ††, p < 0.01 and †, p < 0.05 versus mdx basal value.

TNF-α, IL-1β, and IL-6 Gene Expression Was Similar in WT and mdx Myotubes

To identify gene targets that can be modulated by [Ca²⁺]_rest-dependent NF-κB up-regulation, we studied the levels of mRNA for TNF-α, IL-1β, and IL-6 in both myotube models. We did not observe any significant difference in the mRNA levels of these cytokines between WT and mdx myotubes under resting conditions (supplemental Fig. S3).

iNOS Is Overexpressed in mdx Myotubes and Is Dependent on [Ca²⁺]_rest and NF-κB Activity

We observed increased iNOS mRNA levels and protein expression in mdx myotubes (p < 0.001 and p < 0.01, respectively, compared with WT myotubes) (Fig. 5, A and B). Moreover, nitric oxide (NO) production, assessed by DAF-FM fluorescence, was ≈20% higher in mdx compared with WT myotubes (Fig. 5C). In myotubes transfected with p65 siRNA, the expression of p65 protein, after 48 h, was reduced by 89 and 82% in WT and mdx myotubes, respectively (Fig. 5D). p65 knockdown in mdx myotubes normalized iNOS protein levels to WT values showing that the latter is regulated by the activity level of the former (Fig. 5D). Moreover, treatment with compounds that lower [Ca²⁺]_rest for 6 h significantly reduced iNOS mRNA levels in mdx myotubes (75% Gd³⁺, 86% Ry, and 66% XeB), but it had no significant effect in WT myotubes (Fig. 5A).

FIGURE 5.

iNOS expression in WT and mdx myotubes. A, iNOS mRNA levels assessed by real time PCR showing effects of [Ca²⁺]_rest reduction on iNOS mRNA expression. B, iNOS protein expression determined by Western blot. C, levels of nitric oxide (NO) was determined with DAF-FM fluorescence probe with confocal microscopy. D, effects of p65 knockdown by siRNA in the levels of p65 and iNOS proteins expression determined by Western blot. Myoblasts were transfected and then differentiated to myotubes for 48 h before the protein determination. Data are expressed as means ± S.E. from at least three different determinations. ***, p < 0.001; **, p < 0.01 and *, p < 0.05 versus WT basal value, ††, p < 0.01 and †, p < 0.05 versus mdx basal value.

p38 MAPK Is Involved in NF-κB Up-regulation in mdx Myotubes

Several Ca²⁺-sensitive pathways can modulate the activity of the NF-κB signaling pathway (41, 55). To determine the signal transduction pathways involved in the [Ca²⁺]_rest-dependent NF-κB up-regulation, we used specific pharmacological blockers for ERK1/2, JNK, p38 MAPKs, Ca²⁺/calmodulin-dependent kinase II, calcineurin A, and protein kinase C (PKC) (Fig. 6). Only p38 MAPK inhibition with SB-203580 (10 μm) significantly reduced the NF-κB luciferase reporter activity in both WT and mdx myotubes by 82 and 73%, respectively (p < 0.001).

FIGURE 6.

NF-κB transcriptional activity is modulated by p38 MAPK activity in both WT and mdx myotubes. Myotubes were treated with PD-98059 (PD) (ERK1/2 inhibitor, 10 μm), SB-203580 (SB) (p38 inhibitor, 10 μm), SP-600125 (SP) (JNK inhibitor, 10 μm), KN-93 (KN) Ca²⁺/calmodulin-dependent kinase II (CaMKII, 10 μm), cyclosporin A (CsA) (10 μm), bisindolylmaleimide I (BIM-I) (PKC inhibitor, 2.5 μm), and Gö-6976 (Gö) ( specific inhibitor of calcium-responsive PKCs, 10 μm) for 6 h and then lysed for luciferase activity determination. Data are expressed as mean ± S.E. from at least three different determinations ***, p < 0.001.

DISCUSSION

In dystrophic skeletal muscle cells, increased [Ca²⁺]_rest has been mainly related with calpain activation and mitochondrial permeability transition pore aperture as factors that induce death in skeletal muscle fibers. Here, we show the first evidence that elevated [Ca²⁺]_rest in dystrophic myotubes causes altered function of the transcription factor NF-κB leading to iNOS expression. In addition, our data show that the increased [Ca²⁺]_rest in mdx myotubes is multifactorial, involving both Ca²⁺ entry and Ca²⁺ SR leak, through RyRs and IP₃Rs.

We have previously shown that the [Ca²⁺]_rest in DMD muscle fibers was ∼370 nm, although in normal muscle fibers it was ∼100 nm (27). Other authors have shown similar calcium concentrations in adult mdx fibers compared with the WT fibers (25, 28). A possible explanation to why some authors did not find elevated [Ca²⁺]_rest in dystrophic muscle cells may be due, in part, to methodological differences in fluorescent dye calibration, the previous contractile activity, and age of the fibers. Moreover, fluorescent dyes, as 1,2-bis(2-aminophenoxy)ethane-N,N,N′,N′-tetraacetic acid derivatives, are Ca²⁺ chelators and can artificially reduce [Ca²⁺]_rest. Thus in most cases, the [Ca²⁺]_rest values that have been reported in muscle cells using this method are significantly lower (range 20–80 nm) than those reported using Ca²⁺-selective microelectrodes (100–120 nm).

TRPC1-dependent Ca²⁺ entry is increased in mdx muscle fibers (25, 34, 36). Both GsMTx4 and streptomycin reduced [Ca²⁺]_rest and prevented the rise of the [Ca²⁺]_rest following eccentric contractions improving the muscle function and increasing myofiber regeneration in mdx mice (25, 28, 36). In addition to stretch channel activation, SOCE has emerged as another contributor in increased resting Ca²⁺ entry in mdx fibers (35, 37, 38). We have found that Gd³⁺, an unspecific blocker of Ca²⁺-entry through SOCE and transient receptor potential channels (56), reduced [Ca²⁺]_rest by 52% in mdx myotubes and that long term treatment with Gd³⁺ was associated with a reduction in NF-κB activity and iNOS expression. However, blocking Ca²⁺ entry did not completely normalize [Ca²⁺]_rest, suggesting a possible intracellular contribution.

In primary mdx myotubes, treatment with Ry reduced the [Ca²⁺]_rest by 31% and adding B5 decreased it further to 46%. We have previously shown that [Ca²⁺]_rest depends largely on Ry-insensitive leak of RyR1 channels (RyR1 leak) that can be blocked by Ry + B5 treatment in normal myotubes (47). Bellinger et al. (22) have shown that RyR1 isolated from mdx skeletal muscle shows an age-dependent increase in S-nitrosylation coincident with muscle pathology, which depleted the channel complex of FKBP12, resulting in “leaky channels.” Depletion of FKBP12 from RyR1 channel to nitrosative stress may render it sensitive to Ca²⁺-mediated activation (22).

Both IP₃R blockade with XeC (IP₃R blocker) and U-73122 (PLC inhibitor) treatment resulted in 25 and 22% reduction in the [Ca²⁺]_rest in mdx myotubes, respectively. These combined data strongly demonstrate that the SR plays an important role in the dysregulation [Ca²⁺]_rest observed in dystrophic myotubes.

There is a controversy concerning the SR Ca²⁺ levels in mdx skeletal muscle cells. Robert et al. (57) demonstrated an increased SR Ca²⁺ loading capacity after depletion in mdx compared with WT. However, other authors have shown a reduced expression of calsequestrin-like proteins, lower SR Ca²⁺ loading (58), and reduced sarco/endoplasmic reticulum Ca²⁺-ATPase activity in mdx muscles (59). Recently, Robin et al. (60) demonstrated an elevated passive SR Ca²⁺ leak in mdx fibers, using fibers voltage-clamped at −80 mV and exposed to cyclopiazonic acid. Our results have shown that Ry- or XeC-treated mdx myotubes have an increase in SR Ca²⁺ store content suggesting that SR leak occurs through these Ca²⁺ channels. SERCA1a overexpression in mdx diaphragm muscle by adeno-associated virus gene transfer resulted in a reduction of centrally located nuclei and reduced susceptibility to eccentric contraction-induced damage (61). More recently, δ-sarcoglycan-null and mdx mice animals that overexpress SERCA1 through transgenesis show an improvement in muscle damage and excitation-contraction coupling and restore the [Ca²⁺]_rest and [Ca²⁺]_SR in both dystrophic models (62). Together, this suggests that the filling state of the SR contributes significantly to the dysregulation [Ca²⁺]_rest observed in mdx muscles.

Several reports indicate that resting membrane potentials are more positive in mdx muscles fibers than WT (27, 63–65). We have found that mdx myotubes showed a partial membrane depolarization compared with WT. None of the drugs used in this study, all of which have a major effect on [Ca²⁺]_rest, induced a significant repolarization in the mdx myotubes. These are not surprising results because none of them have any effect on ion permeability or ion-translocating enzymes involved in maintaining the resting membrane potential value.

Numerous facts indicate that the dystrophic skeletal muscle cells have impaired excitation-contraction coupling. Comparisons of the cytosolic Ca²⁺ transients evoked by a single action potential have shown that the Ca²⁺ transients are reduced in mdx and mdx;utr^−/− fibers compared with WT fibers (66–68). Muscle weakness observed in isolated fibers from mdx mice and DMD patients has not been fully explained. The reduction in the Ca²⁺ transient evoked by single action potential, increased V_m, increased [Ca²⁺]_rest, and a reduced Ca²⁺ loading capacity of the SR could provide a mechanism for contractile dysfunction and impaired force production in DMD patients.

Several studies have shown that NF-κB activity is increased in mdx skeletal muscles (8–15), but the mechanisms causing this abnormality have not been previously unveiled. Acharyya et al. (10) reported an increased NF-κB DNA binding activity and IKK activation, without any change in IκBα expression and phosphorylation and normal levels of p65 with an increased phosphorylation. The authors proposed direct p65 activation by IKKβ (10). On the contrary, Singh et al. (15) have found an increase in the expression of both p65 and IκBα and increased IκBα phosphorylation, indicating that NF-κB activation in mdx muscles is due to a complex mechanism and not only IKK activation. Both examined activation of NF-κB in whole muscle extracts. Because dystrophic muscles are associated with a large amount of activated immune cell infiltrates, which have increased NF-κB activity (7, 10), it is possible that this increase was not due to changes in muscle cells. Here, we used the myotube model to determine whether NF-κB can be activated in dystrophic skeletal muscle cells without contribution from the immune system. We observed that NF-κB transcriptional activity, measured by a luciferase reporter, was increased in mdx myotubes, and we observed a significant increase in p65 nucleus/cytosol fluorescence. Both luciferase activity and p65 nuclear localization could be reduced by agents that modulate [Ca²⁺]_rest in mdx myotubes but were not changed by these drugs in WT myotubes.

We do not know the exact mechanism that accounts for [Ca²⁺]_rest-dependent activation of NF-κB in muscle cells. Several Ca²⁺-sensitive pathways can modulate the activity of NF-κB (41). We have previously shown that membrane depolarization activates NF-κB through increases in intracellular Ca²⁺ through RyR and IP₃R. This Ca²⁺-dependent modulation has been attributed to calcineurin A, PKC, and ERK1/2 pathway activation in normal myotubes (40). We have not found any significant effect in the luciferase activity when we preincubated with specific blockers of these signaling pathways in WT and mdx myotubes. Similar results were obtained with Ca²⁺/calmodulin-dependent kinase II and JNK inhibitors. Surprisingly, p38 inhibition by SB-203580 dramatically reduced the luciferase activity of the NF-κB reporter. The p38 MAPK is activated by various stimuli, including exercise, contraction, insulin, environmental stress, and pro-inflammatory cytokines (69). SB-203580 is a specific blocker of the p38 MAPK that inhibits the catalytic activity of this protein (70).

Badger et al. (71) has shown that SB-203580 blocks IL-1-induced p38 kinase activity, NO production, and iNOS expression in chondrocytes. In addition, in C6 glioma cells, the stimulation with LPS increases iNOS mRNA expression, NO production, phosphorylation of p38, and the activation of NF-κB. Treatment with SB-203580 reduced iNOS expression and NO production; however, it did not modify the NF-κB DNA binding activity (72).

Nakamura et al. (73) have shown that calcineurin A, JNK1, and p38 signaling pathways were constantly activated in dystrophic mdx;utr^−/− hearts, associated with an increased p38 phosphorylation. However, in skeletal muscle, a reduction in p38 phosphorylation has been shown but was accompanied by an increase in p38 protein expression in whole lysates from mdx tibialis anterior muscles (74). Several reports have shown that calcium activates p38 MAPK, but the mechanisms by which it does so are poorly understood. In cerebellar granular cells, glutamate stimulates the activity of p38 through Ca²⁺ entry from extracellular space and Rho GTPase activation (75, 76). In myotubes, caffeine increases p38 phosphorylation via Ca²⁺/calmodulin-dependent kinase II activation and participates in the expression of PGC-1α and mitochondrial biogenesis (77). Further studies will be required to clarify this issue in mdx skeletal muscle cells and the precise mechanism involved in the NF-κB activation.

Finally, we observed that iNOS expression could also be modulated by [Ca²⁺]_rest through NF-κB under resting conditions. p65 knockdown normalized the iNOS protein levels in mdx myotubes to WT levels, similar to the effect of the agents that lowered [Ca²⁺]_rest had on iNOS mRNA expression; iNOS overexpression by this mechanism could be responsible for the oxidative and nitrosative stress observed in mdx muscles (26) and can provide a positive loop for Ca²⁺ deregulation in dystrophic skeletal muscle cells.

Overexpression of TRPC3 (skeletal muscle-specific transgenic mice) and the associated increase in calcium influx resulted in a phenotype of muscular dystrophy (78). The authors have shown an increase in central nucleation of fibers, increased numbers of smaller myofibers, fibrosis, and infiltration of inflammatory cells. Moreover, sarco/endoplasmic reticulum Ca²⁺-ATPase overexpression in Sgcg^−/−, mdx, and in TRPC3 transgenic mice mitigated biochemical and histological features of muscular dystrophy improving the altered intracellular Ca²⁺ handling (62). As described above, S-nitrosylation of RyR induces Ca²⁺ alterations related with an augmented spontaneous Ca²⁺ spark frequency (22). In addition, transient receptor potential channels elicited robust elevation of Ca²⁺ in response to the NO donor S-nitroso-N-acetyl-dl-penicillamine, especially TRPC5 (79). TRPC5, TRPA1, and TRPM1 channels were increased in mdx skeletal muscle at certain stages (80). These modifications induced by NO could exacerbate the pathology in mdx muscles.

We did not find any difference in cytokine expression in mdx myotubes (supplemental Fig. S3). Because macrophages and lymphocytes are specialized immune cells (infiltrated in dystrophic muscle), we think that they may be responsible for the secretion of these cytokines. This hypothesis is reinforced by IKKβ (upstream activator of NF-κB) deletion in myeloid cells from mdx mice, a procedure that reduced inflammation and concomitantly TNF-α and IL-1β expression (10). In addition, production of pro-inflammatory cytokines is probably a complex process that requires simultaneous activation of pathways other than NF-κB. iNOS promoter has two bona fide NF-κB-binding sites (reviewed in Ref. 81). TNF-α is often described as one of the classical NF-κB-dependent cytokines. However, there are numerous contradictory data for a role for NF-κB as a classic activator of TNF-α, and it seems that expression of this cytokine requires nuclear factor of activated T-cells activation, as well as other co-activators (reviewed in Ref. 82).

In summary, we have found that increased [Ca²⁺]_rest is modulated by Ca²⁺ entry as a result of SR unloading caused by Ca²⁺ leak through RyR and IP₃R in dystrophic myotubes and that this alteration increases NF-κB activity and iNOS expression, likely through p38 activation. These mechanisms can provide several potential therapy targets to improve muscle degeneration observed in DMD patients and explain the progressive damage observed in this pathology (Fig. 7).

FIGURE 7.

Proposed model for [Ca²⁺]_rest deregulation, NF-κB up-regulation, and iNOS expression in mdx myotubes. In addition to the Ca²⁺ entry through reported TRPC1 and SOCE (Gd³⁺ sensitive), [Ca²⁺]_rest deregulation in mdx myotubes is a complex event that involves Ca²⁺ entry and SR Ca²⁺ leak through RyR ad IP₃R. The data collected in this work suggest that increased [Ca²⁺]_rest, increases NF-κB and iNOS expression in dystrophic myotubes. PLC, phospholipase C.