Abstract
T-type calcium channels operate within tightly regulated biophysical constraints for supporting rhythmic firing in the brain, heart and secretory organs of invertebrates and vertebrates. The snail T-type gene, LCav3 from Lymnaea stagnalis, possesses alternative, tandem donor splice sites enabling a choice of a large exon 8b (201 aa) or a short exon 25c (9 aa) in cytoplasmic linkers, similar to mammalian homologs. Inclusion of optional 25c exons in the III–IV linker of T-type channels speeds up kinetics and causes hyperpolarizing shifts in both activation and steady-state inactivation of macroscopic currents. The abundant variant lacking exon 25c is the workhorse of embryonic Cav3 channels, whose high density and right-shifted activation and availability curves are expected to increase pace-making and allow the channels to contribute more significantly to cellular excitation in prenatal tissue. Presence of brain-enriched, optional exon 8b conserved with mammalian Cav3.1 and encompassing the proximal half of the I–II linker, imparts a ∼50% reduction in total and surface-expressed LCav3 channel protein, which accounts for reduced whole-cell calcium currents of +8b variants in HEK cells. Evolutionarily conserved optional exons in cytoplasmic linkers of Cav3 channels regulate expression (exon 8b) and a battery of biophysical properties (exon 25c) for tuning specialized firing patterns in different tissues and throughout development.
Introduction
Cav3 channels are known for gating “transient” currents at low voltages near the resting membrane potential, and often depolarize cells to threshold in a cyclical manner to promote rhythmic firing (for reviews see Senatore et al., 2012 [1] and [2]). Animals with Cav3 channels appear in relatives of extant multicellular organisms without tissues or organs (e.g. Trichoplax), and within Cnidarians, the simplest phlyum to harbor a nervous system (e.g. sea anemone Nematostella; Figure 1 A ). Soft-bodied invertebrates, precursors to various animal phyla including molluscs, likely first appeared in the Late Vendian Period (650 to 543 mya), prior to the divergence of the single ancestral Cav3 channel gene into three mammalian genes CACNA1G (Cav3.1 or α1G), CACNA1H (Cav3.2 or α1H) and CACNA1I (Cav3.3 or α1I) [1]. Recently, we have cloned and expressed the first non-vertebrate Cav3 channel in vitro, LCav3, from the pond snail Lymnaea stagnalis [3]. Here, we describe two optional exons in the I–II and III–IV cytoplasmic linkers of LCav3 that are evolutionarily conserved with vertebrate Cav3 channels and likely play critical roles in regulating membrane expression and an array of biophysical properties during development. The evolutionarily distant LCav3 channel highlights key and fundamental features for T-type channels, providing an important perspective for understanding Cav3 channel regulation.
Results
Structural conservation in Cav3 channels
Comparisons between Cav3 channels reveal that mammalian genes cluster more closely in overall sequence similarity amongst themselves than to the more evolutionarily distant and solitary Cav3 gene in snails ( Figure 1 A , Figure 1 B ). Much of the divergence from the snail sequence lies in the tethered, cytoplasmic loops between transmembrane domains, which also bear surprisingly conserved islands of conservation ( Figure 1 C ). A signature helix-loop-helix in the proximal I–II cytoplasmic linker forms a “gating brake” that is unique to all Cav3 channels, which when deleted augments characteristic features by shifting low-voltages of activation to even more hyperpolarized potentials, and increases kinetics of channel opening and closure [4], [5]. Downstream of the gating brake in vertebrate Cav3.1 and invertebrate Cav3 channels is a region that contains a large cluster of histidine residues, followed by an isolated and conserved “APRASPExxD/E” motif that is surrounded by unconserved sequences ( Figure 1 D ).
Conserved splicing of exons 8b and 25c
Interestingly, the “APRASPE” motif is contained within an optional portion of exon 8 that normally spans from Domain I segment 6 across ∼70% of the cytoplasmic I–II linker. The optional portion of exon 8 (termed exon 8b), is similarly spliced out in snail and mammalian [6] Cav3 channel genes by use of alternative, upstream, intron donor splice sites within exon 8 that truncate the I–II linker coding sequences of LCav3 and Cav3.1 by 603 and 402 bp, respectively (Figure S1). Exon 8b occurs downstream of the gating brake, and its omission shortens the I–II linker of LCav3 channels by 201 aa (∼50%) and Cav3.1 by 134 aa (∼39%; Figure 2 A ). A second conserved region of alternative splicing corresponds precisely with the middle of the III–IV cytoplasmic linker ( Figure 2 B ), which is similarly short in closely related Nav and Cav channels (54+/−1 aa; Figure 2 C ). Splicing at alternative and more upstream, phase 1 intron donor splice sites shortens the III–IV linker by between 7 and 11 aa in different snail Cav3 and mammalian Cav3.1 and Cav3.2 channels ( Figure 2 B , Figure S2Figure S3). Cav3.1 and Cav3.2 genes also possess downstream, similarly short optional cassette exons, termed exon 26, that code for between 6 and 19 aa, and that may be included in lieu of exon 25c or appear in tandem with it ( Figures 2 B and Figure S4). A consensus amino sequence or a number of positively or negatively charged residues is not a consistent feature of 25c exons. The only consistent feature is the first residue coding serine (coded by AGT) that completes the consensus kinase phosphorylation site (KKRKS for LCav3), which also contributes to the consensus upstream 5′ donor splice site (GTRAGT; Figures 2 B and Figure S4).
A simple evolutionary pattern has many invertebrate and mammalian Cav3.3 channel genes having “ΔΔ” isoforms lacking exons 25c or 26. Snail LCav3 possesses exon 25c besides ΔΔ, but analyses of over 48 independent RT-PCR products from snail embryonic and adult RNA did not uncover an optional cassette exon 26 for LCav3 (Figure S5). Vertebrate Cav3.1 and Cav3.2 possess both exons 25c and 26, and have correspondingly larger intron sizes spanning these regions than genes lacking either exon 26 (e.g. snail Cav3), or both exons 25 and exons 26 (e.g. Cav3.3; Figure 2 D ). Larger intron sizes suggest more extensive regulation of alternative splicing for these short exons.
LCav3 channel expression patterns are consistent with those in mammals
mRNA transcript levels measured by quantitative RT-PCR suggest that LCav3 channels are most abundant in the brain, with intermediate expression in the heart and secretory glands (albumen and prostate), and almost non-detectable levels in skeletal-type muscle (buccal and foot musculature) of adult snails ( Figure 3 A ). The overall profile of expression closely matches that of the Cav3.1, which is more abundant in the CNS, but not exclusively expressed in the adult brain (i.e. Cav3.3), nor is it expressed more widely outside the brain (i.e. Cav3.2) [7].
A general precipitous decline in mRNA transcript levels of LCav3 occurs from mid-embryo stage (50–75% embryonic development) to near hatching (100% embryonic development) to juvenile snails ( Figure 3 B and Figure 3 D ), corresponding to a similar decline of mammalian Cav3 calcium channel gene expression during development (reviewed in Senatore et al., 2012 [1]). There is a continued, slight decline in Cav3 channel expression from juvenile to adult animals except for a spike in expression in the albumen gland, likely associated with sexual maturation, and a dramatic decline in the heart, that also parallels the precipitous fall in LCav3 expression during mammalian heart development ( Figure 3 C ) [8].
Conserved regulation of exon 8b and 25c splicing
LCav3 transcripts with and without 8b exons are of approximately equal abundance in the central nervous system and secretory glands (such as albumen gland; Figure 3 A ), which approximates the findings in rat brain where there is significant mRNA expression of Cav3.1 with and without 8b exons [6]. We observe that the +8b isoform is less associated with the snail heart (16%) and buccal/foot musculature, compared to the higher levels in the brain and secretory glands ( Figure 3 A ). Exon 25c has a more striking developmentally-regulated pattern, with a precipitous decline in LCav3 transcripts lacking exon 25c from embryo to adults ( Figure 3 B and Figure 3 D ), especially in the heart ( Figure 3 C ). The continued down-regulation of Cav3 channels lacking exon 25c from juveniles to adults gives the appearance of a switch with an increasing relative expression of the plus exon 25c isoform in the adult brain and secretory albumen and prostate glands ( Figure 3 C ). Exon 25c-containing isoforms of LCav3 predominate in the adult heart (79%; Figure 3 A ) and enhance in expression in most adult snail tissues ( Figure 3 C ). The relative absence of exon 25c before and at birth and its predominance in adults is consistent between snail LCav3 and mammalian Cav3.1 [9]–[11] and Cav3.2 [12], [13] ( Figure 3 E ). Correlative analysis of normalized qPCR data for plus and minus 8b and 25c variants, across all juvenile and adult tissues tested, reveals that +8b and −25c variants share similar variability in expression between the different tissues (correlation coefficient R2 = 0.885), and that −8b and +25c also share similar expression patterns (R2 = 0.898), while +8b/+25c and −8b/−25c have much lower correlation coefficients (Figure S6).
Exon 25c selectively alters biophysical properties of LCav3
Using whole cell patch clamp technique we examined the biophysical consequences of the absence or presence of exons 8b and 25c in cloned LCav3 variants heterologously expressed in HEK-293T cells, and performed one-way analysis of variance to asses statistical significance ( Table 1 ). Surprisingly, the absence or presence of the large I–II linker 8b exon has comparatively little influence on the biophysical properties of LCav3 ( Figures 4 and Figure 5 ) when compared to the small 25c insert. The peaks of the rapidly-activating and inactivating calcium currents were measured in response to 5 mV steps in the presence of 2 mM extracellular calcium ( Figure 4 A and Figure 4 B ). Inclusion of exon 25c induces statistically significant −3.7 mV (+8b) and −3.8 mV (−8b) hyperpolarizing shifts in the half-maximal activation (V0.5) of LCav3 calcium currents, extrapolated from the fitted Boltzmann of the plot of the fraction of maximal conductance at each voltage step ( Figure 4 C and Table 1 ). Exon 25c also causes parallel −3.9 and −6.9 mV hyperpolarizing shifts in half-maximal inactivation for +/− exon 8b LCav3 variants, respectively ( Figure 4 C and Table 1 ). Boltzmann-fitted inactivation curves were generated by measuring residual peak currents at −35 mV following a series of inactivating, pre-pulse voltage steps ( Figure 4 C ). Similar hyperpolarizing shifts in the half maximal values for activation and inactivation curves are apparent for exon 25c inserts, regardless of the difference in their sequence or gene isoform type for snail LCav3, or mammalian Cav3.1 [10], [14] or Cav3.2 channels [12], [13], [15] ( Figure 4 D and Table 1 ). The effect of exon 25c on the hyperpolarizing shift is greater than the differences in voltage-sensitivities between different T-type channels ( Figure 4 E ). Optional exon 26 also causes shifts in the voltage-sensitivities of activation and inactivation for Cav3.1and Cav3.2 ( Figure 4 D ), although generally the differences are much less dramatic than those imposed by exon 25c.
Table 1. Summary of biophysical parameters of LCav3 channel variants containing exons 8b and 25c expressed in HEK-293T cells, with one-way analysis of variance to assess statistical significance.
LCav3 | LCav3 | LCav3 | LCav3 | Significance | ||||||
+8b −25c | −8b −25c | +8b +25c | −8b +25c | A vs. B | A vs. C | A vs. D | B vs. C | B vs. D | C vs. D | |
(A) | (B) | (C) | (D) | |||||||
Activation | ||||||||||
V0.5 (mV) | −53.48±0.34 (13) | −53.36±1.22 (6) | −57.13±0.35 (18) | −57.15±0.54 (14) | n.s | *** | *** | *** | ** | n.s. |
Slope (mv) | 5.46±0.14 (13) | 5.45±0.20 (6) | 4.34±0.09 (18) | 4.60±0.14 (14) | n.s. | *** | *** | *** | ** | n.s. |
Inactivation | ||||||||||
V0.5 (mV) | −70.89±0.49 (16) | −69.91±0.5 (14) | −74.80±0.28 (16) | −76.78±0.29 (15) | n.s. | *** | *** | *** | *** | *** |
Slope (mV) | 2.93±0.08 (16) | 3.11±0.10 (14) | 3.12±0.05 (16) | 3.14±0.04 (15) | n.s. | * | * | n.s. | n.s. | n.s. |
Activation kinetics | ||||||||||
Rise −55 mV (ms) | 12.62±0.70 (16) | 13.87±0.96 (7) | 10.09±0.44 (18) | 12.25±0.86 (14) | n.s. | ** | n.s. | *** | n.s. | * |
Rise −10 mV (ms) | 2.35±0.12 (16) | 2.58±0.23 (7) | 1.75±0.09 (18) | 2.32±0.26 (14) | n.s. | *** | n.s. | *** | n.s. | * |
Inactivation kinetics | ||||||||||
τ −55 mV (ms) | 40.07±2.56 (16) | 39.20±3.46 (7) | 23.64±0.87 (n18) | 28.46±1.51 (14) | n.s. | *** | *** | *** | ** | ** |
τ −10 mV (ms) | 15.67±0.56 (16) | 16.81±0.74 (7) | 15.10±0.43 (18) | 18.51±0.79 (14) | n.s. | n.s. | ** | * | n.s. | *** |
Deactivation kinetics | ||||||||||
τ −100 mV (ms) | 1.37±0.05 (19) | 1.22±0.04 (11) | 1.60±0.05 (18) | 1.72±0.06 (14) | * | *** | *** | *** | *** | n.s. |
τ −60 mV (ms) | 5.45±0.52 (19) | 6.89±0.52 (11) | 7.31±0.41 (18) | 8.95±0.36 (14) | n.s. | ** | *** | n.s. | ** | ** |
Inactivation Recovery | ||||||||||
% recovery at 50ms | 4.98±0.46 (14) | 4.62±0.50 (12) | 2.82±0.19 (16) | 2.26±0.13 (23) | n.s. | *** | *** | *** | *** | * |
% recovery at 2000ms | 81.82±0.93 (14) | 84.69±1.33 (12) | 88.67±0.63 (16) | 86.87±0.61 (23) | n.s. | *** | *** | ** | n.s. | * |
T0.5 (ms) | 908.04±27.05 (14) | 822.04±32.92 (12) | 817.90±27.03 (16) | 949.48±34.77 (23) | * | * | n.s. | n.s. | * | * |
Channel Expression | ||||||||||
Current density (pA/pF) | 135.70±18.22 (13) | 244.49±22.53 (13) | 123.77±18.98 (13) | 251.56±33.72 (13) | *** | n.s. | ** | *** | n.s. | ** |
n.s. not significant;
p<0.05;
p<0.005;
p<0.001.
Exon 25c also promotes a significant speeding up of channel kinetics, most apparent in currents elicited by small voltage steps (−60 or −55 mV; Figure 5 A and Table 1 ). Activation kinetics are significantly faster in the presence of exon 25c, especially when exon 8b is also present, as measured as the delay to time to peak current ( Figure 5 B ), as are inactivation kinetics, as measured by single exponential tau curve fits ( Figure 5 C ). A role of exon 25c in promoting faster channel activation and inactivation is common to both snail and mammalian Cav3 channels ( Figure 5 D ). Deactivation kinetics are slowed by exon 25c, which corresponds to a slower rate of closure of Cav3 channels from the open state, especially those currents elicited from voltage steps down to negative voltages such as resting membrane potential or more hyperpolarized than rest (−100 to −65 mV; Figure 5 E ). A slowing of deactivation kinetics in the presence of exon 25c is also a shared feature of snail and mammalian [14], [15] Cav3 channels ( Figure 5 F ). Exon 25c also promotes a slowing of the recovery rate from inactivation at the earliest time points of recovery (<0.2 seconds; Figure 5 G , inset and Table 1 ), reminiscent to the slowing of inactivation promoted by exon 25c in mammalian Cav3 channels [14]. It should be noted that LCav3 is relatively slow to recover from inactivation compared to mammalian Cav3 channels, even in the absence of exon 25c ( Figure 5 G ). Exon 8b can fine tune the biophysical changes imparted by exon 25c, such as influencing kinetics at depolarized potentials (i.e. above −45 mV; Figure 5 B , Figure 5 C , Table 1 ), or speeding up deactivation, more pronounced in the presence of exon 25c, near resting membrane potential (i.e. −60 to −70 mV; Figure 5 E and Table 1 ). In summary, snails and mammals possess highly variable short 25c exons that exert near identical biophysical changes to Cav3 channels during development.
Exon 8b selectively alters LCav3 expression
The large optional exon 8b has a major role likely associated with controlling the expression of Cav3 channels, since transfection of equal molar quantities of cloned LCav3 vectors into HEK-293T cells produces approximately 2-fold increases in current density recordings when variants lack 8b ( Figure 6 A , Table 1 ). In contrast, current density does not change in the absence or presence of exon 25c. Increased currents were also reported for mammalian Cav3.1 lacking exon 8b [6], suggesting that analogous regulatory mechanisms might act on snail and mammalian 8b exons to control membrane expression. The only obvious similarity between exon 8b amino acid sequences of LCav3 and Cav3.1 is an APRASPE motif ( Figure 1 D ), which, when deleted, surprisingly has no effect on LCav3 channel current density ( Figure 6 A ).
The doubling of current densities in the absence of exon 8b, attributable to an increase in the number of channels present at the membrane, could arise from increases in total protein expression or strictly increased trafficking to the membrane [6]. A possible change in membrane trafficking of LCav3 associated with exon 8b was assessed by separating and quantifying biotinylated, membrane-delimited channel variants expressed in HEK-293T cells, relative to channels present in whole cell fractions on immunoblots labeled with polyclonal LCav3 antibodies [16]. Antigen specificity of the polyclonal antibodies for these experiments was confirmed by immunolabeling of HEK cells transfected with either the T-type channel cDNA (+8b −25c), or that of snail LCav1 calcium channel ( Figure 6 D ), and further tested on Western blots using expressed and purified LCav3 I–II linker peptides (Figure S7). Biotinylation experiments revealed dramatic increases in both total and membrane-expressed fractions of transfected LCav3 variants lacking exon 8b ( Figure 6 B and Figure 6 C ), indicating that the doubling of current densities is likely due to an increase in protein expression, and not specifically increased membrane trafficking. We also inserted hemagglutinin (HA)-epitope tags in the extracellular Domain I s5–s6 loop of LCav3 variants, to quantify the chemiluminescent signals of labeled, membrane-delimited epitope by luminometry [6]. Surprisingly, luminometry experiments were inconclusive, since there was a doubling of signal in permeabilized transfected cells compared to non-permeabilized conditions, regardless of the treatment, including cells transfected with untagged LCav3 (i.e. +8b +25c) (Figure S8). In addition, all HA-tagged channels, regardless of their insert, produced <20-fold smaller recordable currents than their wild type channel counterparts (Figure S9).
Discussion
Evolution and development of Cav3 channels
Invertebrates possess only a single Cav3 channel gene which provides a reference point for evaluating fundamental features of T-type channels. We illustrate here two highly conserved and developmentally regulated optional exons in cytoplasmic linkers shared between invertebrates and mammals, that provide insights into the fundamental roles that alternative splicing has played in the early evolution of Cav3 channels.
Cav3 channels likely first appeared in early multicellular organisms, since single-celled animals, such as the coanoflagellates, have a single calcium channel homolog, an L-type (Cav1), but no Cav3 channel [1]. Likely, gene duplication of the L-type calcium channel gene generated a synaptic Cav2, “N-type like” channel gene and a Cav3 channel gene, in a close ancestor of primitive multi-cellular organisms (i.e. Trichoplax) or within an animal phylum with the most primitive nervous system, the Cnidarians, which both possess a full complement of single Cav1, Cav2 and Cav3 channel genes ( Figure 1 A ; [17]). The snail homolog from Lymnaea stagnalis closely matches the mammalian Cav3.1 and Cav3.2 channels in the quintessential features of Cav3 channels, which appear optimized for generating rhythmic firing patterns, with a low voltage range of gating and rapid kinetics to drive membrane depolarization from resting membrane potential to threshold quickly, and a property of slow deactivation kinetics, which keeps Cav3 channels open to maximize their effectiveness, if they are not in a refractory, inactivated state [1]. Conserved features in invertebrates also extend to their developmental expression profile. Cav3 channel mRNA levels fall precipitously (80%) from embryo to juvenile snails in comparison to a more gradual decline of related channels, such as Cav2 and NALCN (∼20%) or L-type calcium channels (60%) ( Figure 3 D ). This decline in Cav3 channel transcripts continues from juvenile to adults in most tissues and is most dramatic in the heart compared to the brain. The higher density of Cav3 expression correlates well with the faster embryonic heart rate, and drops sharply with the slower heart rate after the rapid phase of growth (embryo/neonate to juvenile animals). Cav3 channel expression is also highest in animals of smaller sizes [8], which have faster heart and metabolic rates associated with allometric scaling. A prominent Cav3 current remains in adult snails [18], but this is diminished in the pace-making cells of increasingly large mammals, to a level that may be imperceptible in the adult human heart [8]. In the tissues we studied, only albumen and prostate glands, which grow dramatically in size from juvenile to adult snails, exhibit increases in Cav3 channel expression, consistent with organ maturation and emergent properties for Cav3 channels in secretory roles of sexually-mature animals.
A high embryonic level of Cav3 channel expression is associated with expanded roles in the early proliferative states such as myoblast fusion [19], and recapitulated to high levels in disease states such as cancer [20] and ventricular hypertrophy [8]. Extracellular calcium contributes to contraction in immature muscle, which lacks the elaborate calcium delivery system in adult muscle involving transverse tubules signalling to intracellular calcium release units via coupling to membranal L-type calcium channels [21]. Adult invertebrate muscle is also primitive, lacking tetradic organization and striations [21], where Cav3 channels can serve as the only calcium source for muscle contraction (Polyorchis jellyfish muscle) [22], are a major contributor to muscle action potentials (nematode) [23], provide an alternative to sodium spikes in giant motor neurons (Aglantha jellyfish) [24] or are a prominent source of calcium for the adult heart [18].
Evolution of cytoplasmic linkers
The fall in mRNA expression from embryo to adult snails is almost exclusively with Cav3 channels that lack exon 25c in the cytoplasmic III–IV linker ( Figure 3B ), leading to a change in mode of T-type channel activity in the transition from embryo to adult. Remarkably, III–IV linkers have been restricted to a discrete size of 54+/−1 aa in all human calcium and sodium channels, whereas the other cytoplasmic linkers substantially vary in size ranging from ∼100 to >500 aa ( Figure 2 C ). The shortness constrains the III–IV linker so that it is tightly coupled to the cytoplasmic end of the pore, preventing it from protruding too deeply into it. The III–IV linker is a primary agent for fast inactivation of Nav channels, serving as a manhole cover with a hydrophobic latch (IFM) flanked by an alpha helix on either side that pivots on a flexible hinge to occlude the cytoplasmic pore [25]. The “inactivation particle” of the III–IV linker of Nav channels is conserved down to single-celled coanoflagellates, is absent in all Cav channels [17], but a parallel role is likely played by the similar sized III–IV linker of Cav3 channels. Evolution of an alternative 5′ donor splice site expands the middle of the III–IV linker to retain intron sequence as a 7 to 11 aa coded exon, extending exon 25 (dubbed exon 25c) in molluscs and vertebrate Cav3.1 and Cav3.2 channels beyond the tightly-regulated size of 54+/1 aa. Corresponding with III–IV linker exon variants, there is an added complexity of the regulation of alternative splicing, with a dramatic increase in intron size from non-molluscan invertebrates and vertebrate Cav3.3 channel genes that lack optional exons in the III–IV linker, to the molluscan Cav3 channel with an exon 25c, to vertebrate Cav3.1 and Cav3.2 channels which contain two differentially-regulated optional exons 25c and 26 ( Figure 2 D ). Splicing factors in spliceosomes have varying compositions in different developmental stages and cell types, to generate unique mRNAs from heteronuclear pre-mRNA with the guidance of specific nucleotide sequences within introns and adjacent exons [26]. Larger intron sizes suggest extensive regulation of alternative splicing for these short exons in different tissues [26]. Interestingly, +8b and −25c variants have a significantly correlated expression pattern amongst the juvenile and adult tissues tested by qPCR (correlation coefficient R2 = 0.885), as do −8b and +25c (R2 = 0.898), while +8b/+25c and −8b/−25c have lower R2 values (Figure S6). This suggests that there is a co-ordinated splicing of LCav3 isoforms containing either +8b with −25c, or −8b with +25c in different tissues, and that these are the most physiologically relevant isoforms in juvenile and adult snails. However, alternative splicing can be somewhat stochastic [27], [28], and given the presence of all four splice variants together in many different tissues ( Figure 3 ), it is probable that all four possible configurations are present in the animal, at least to some degree.
Biophysical consequences of 25c and 26
Modeling studies suggest that there are general truisms associated with Cav3 channel splicing, although Cav3 channel behavior will vary considerably with background cellular context such as other ionic conductance and the resting membrane potential, as well as with subcellular localization [29]. Exon 25c imparts a hyperpolarizing shift in the activation and inactivation curves of Cav3 channels (by a few to 10 mV), that restricts their activity because they are unavailable and inactivated at rest. If the membrane potential does not change significantly throughout development, enrichment of exon 25c in adults would serve to dampen the contribution of these channels to excitability. These variants would be more adept at driving post-inhibitory rebound excitation after strong hyperpolarizing input, which together with the faster activation and inactivation kinetics reported for plus exon 25c variants, would generate calcium spikes with a faster onset and faster attenuation after hypepolarization, reminiscent of low threshold spikes (LTS) in thalamocortical neurons [30]. Within action potential bursts that sometimes ride over LTS, the depolarizing contribution of Cav3 calcium currents during action potential repolarization is maximized by the long delay of channel closure from the open state (slower deactivation kinetics) imparted by exon 25c [14], [31]. Exon 25c, the more prominent isoform in adults, promotes inactivation to limit excitability, and also slows the recovery from complete inactivation at the earliest time point of recovery. Given that Cav3 channels play important roles in setting the rhythmicity of oscillatory firing, the above features suggest that the enrichment of exon 25c in adults, along with the developmental down-regulation of Cav3 channel expression, serve to slow down oscillatory firing or diminish the contribution of Cav3 channels to excitability in general.
Embryonic Cav3 channels lacking exon 25c have properties more similar to Cav3.3, with slower activation and inactivation kinetics, as well as right-shifted activation and steady-state inactivation curves [31]. ΔΔ variants conduct less calcium into the cell during a single burst, and are better suited for prolonged spiking at higher frequencies (e.g. burst firing in nRT neurons [26], [32]) due to a lower propensity for cumulative inactivation during high frequency firing. Rather than dampen, Cav3.3 channel currents actually facilitate through the first few spikes in a train. Since ΔΔ variants are the predominant isoform in the embryo of both snails and mammals, the default state is likely one which favours a contribution of Cav3 channels to more rapid firing patterns in embryonic cells relative to adult ones. In addition, Cav3 channels without exon 25c are less inactivated at rest, with a more positive-shifted activation and inactivation curves, and are more readily available to open in response to depolarization, rather than relying on hyperpolarizing input. Cav3.3 channels generally have a brain-specific, somato-dendritic localization where they extend further into the dendritic arbour than Cav3.1 and Cav3.2 [33]. Dendritic T-type channels are implicated in synaptic integration, where they serve to amplify post-synaptic inputs to the soma [34], and the slower activation and inactivation kinetics of Cav3.3 might facilitate this role by allowing the channels to overcome the high input resistance of dendrites. Interestingly, modelling suggests that dendritic T-type channels are subject to a hyperpolarizing shift in their activation during somatic depolarization [29], which for Cav3.3 channels would approximate their depolarized activation curves to match those of the more hyperpolarized and somatic Cav3.1 and Cav3.2.
Exon 25c sets the framework for the major biophysical differences between Cav3 channels. Snail LCav3 and mammalian Cav3.1 and Cav3.2 utilize exon 25c to differentiate themselves from Cav3.3, with shifted activation and inactivation gating to significantly more hyperpolarized potentials, not achievable by merely switching to the expression of a different mammalian channel gene (i.e. Cav3.1, Cav3.2 or Cav3.3; Figure 4 E ). Indeed, systematic replacement of different trans-membrane and cytoplasmic regions of Cav3.1 into Cav3.3 creates chimeric channels that resemble Cav3.1 only when an exon 25c-containing III–IV linker is inserted into Cav3.3 [35]. These changes (measured in Xenopus oocytes) include dramatically shifted activation and inactivated curves in the hyperpolarizing direction (−9.5 mV and −8.6 mV, respectively), and increases in the kinetics of activation and inactivation [35].
Structure of exon 25c and exon 26
Sequence comparisons do not elucidate a consistent picture for the structural requirements of exon 25c, since the number of charged residues can vary even amongst closely related species (e.g. freshwater and sea snail Cav3 channels; Lymnaea SEGPKASSSE vs. Lottia SEGISTKKAG), size can vary considerably (e.g. between frog and human Cav3.2 channels; SKALPVAVAVAE vs. SKALYMSE respectively) and a requirement for the first position being a serine residue to completing a consensus phosphorylation site is lacking when comparing human exon 25c and 26 inserts (SKEKQMA vs NLMLDDVIASGSSASAASE respectively; Figure 2 B ). An effective, threshold size of 8 aa may be required for III–IV inserts, since the slightly shorter exon 26 insert of Cav3.2 channels (STFPSPE), imparts only small biophysical changes such as a shift in the curve for steady-state inactivation ( Figure 4 D ), an no significant changes in kinetics of activation and inactivation ( Figure 5 D ). A role for residue charge would be consistent with Nav channels, where clusters of charged residues in the III–IV linker differentially regulate the kinetics of fast inactivation [36].
Role of exon 25c in gating
Dynamic clamp simulations suggest that minimal changes in the biophysical properties of the Cav3 channel currents, especially in the voltage range corresponding to the base of the current-voltage curve, drastically alter the contribution of Cav3 channels to calcium spikes [30], such as the low threshold calcium spikes in the thalamus characterized in states such as physiological sleep or pathological states such as epilepsy. LTS are often crowned with sodium channel-dependent action potential spike trains, whose frequency and longevity highly depends on the shape of the underlying calcium spike and thus Cav3 channel activity [2]. While the suite of biophysical changes associated with inclusion of exon 25c provides Cav3.1 and Cav3.2 channels for fast post-inhibitory depolarizing responses with calcium spikes crowned by relatively fast but short lived spike trains (e.g. thalamocortical LTS), omission of exon 25c (and 26) creates variants better suited for LTS with a more delayed onset, less dependent on hyperpolarization, and crowned by longer lasting sodium channel spike trains (e.g. nRT LTS) [31]. Clearly even subtle differences may drastically influence the contribution played by Cav3 channels under different conditions. These include differences in the channel genes (e.g. recovery from inactivation of Cav3.1 vs Cav3.2), other splice variants that modulate gating and trafficking (such as exons 8b and 38b for Cav3.1, exon 35a for Cav3.2, and exon 14 for Cav3.1/Cav3.2) [10], [12], [14], G protein modulation and phosphorylation (largely a capacity of Cav3.2 channels [37]), potentiation by glutamate receptors (Cav3.1 channels in cerebellar Purkinje fibers) [38], association with K+ channels [39], as well as being influenced by the shape of the trigger (e.g. synaptic input) [30].
Role of exon 8b in expression
Exon 8b has only a minor influence on biophysical properties, while its omission dramatically increases the membrane expression of snail LCav3 and mammalian Cav3.1 (by ∼2-fold) in transfected human cells ( Figure 6 A ). A conserved APRASPE motif is an obvious, shared feature of exon 8b in invertebrate and Cav3.1 channels, but its absence has little effect on the current densities of snail LCav3 in mammalian cell lines. It may indicate that the APRASPE motif is not critical for protein and/or membrane expression, or that its function depends on tissue-specific factors not present in HEK-293T cells. Exon 8b is abundant in the snail brain and secretory organs and mostly lacking in the heart. It is contained in the largest cytoplasmic linker of Cav3 and Nav channels ( Figure 2 C ), which is also the primary domain for regulating expression of all Cav and Nav channels. Expression of closely related high voltage-activated (HVA) Cav1 and Cav2 channels is promoted by assembly with an accessory β subunit binding to the proximate I–II linker (in the homologous position of the gating brake of Cav3 channels) [40]. Increases in the expression of HVA channels have recently been shown to depend on the β subunit interaction that protects the channels from targeted degradation via the endoplasmic reticulum-associated protein degradation (ERAD) pathway [40]. It has been proposed that misfolding in the I–II linker of Cav2.1 is responsible for pathological ER retention and ERAD of mutant channels associated with episodic ataxia [41].
Subunit assembly with accessory subunits is not a likely control mechanism for Cav3 channel expression or protein stability, but the I–II linker of snail and mammalian Cav3 channels is a key region for its regulation. Large deletions in the I–II linker (downstream of the gating brake) for snail LCav3 and mammalian Cav3.1, Cav3.2 and Cav3.3 moderately enhances, moderately enhances, dramatically enhances, and depresses membrane expression respectively [42]. Lower current densities observed in the presence of exon 8b could be attributed to regulation of channel trafficking to the cell membrane, or the depression of total protein expression of Cav3 channels, or a combination of these factors. Our results indicate that inclusion of exon 8b, regardless of the presence or absence of exon 25c, causes dramatic decreases in both total protein and membrane expression of LCav3 channels ( Figure 6 B and Figure 6 C ).
Conclusions from snail work
Work with snails provides a unique perspective for defining the fundamental features of Cav3 channels. We show that the snail and mammalian channels operate within tightly regulated biophysical constraints for supporting rhythmic firing in the brain, heart and secretory organs, and that there are many remarkable parallels in expression patterns between respective Cav3 channels and exon 8b and 25c splice isoforms. The presence of exon 25c in the III–IV linker, a region whose length is highly invariable in sodium and calcium channels of the 4-domain superfamily, suggests that this locus was exploited during T-type channel evolution to provide splice variants with markedly different biophysical properties. We suggest that the snail channel is more akin to Cav3.1 because of the common regulation of membrane expression with exon 8b, which is enriched in the brain of both snails and mammals. If indeed Cav3.1 is more reminiscent of the ancestral channel type, then Cav3.2 deviated from Cav3.1 less in biophysical terms, but rather in its greater capacity for modulation. Cav3.3 became the most divergent of all T-type channels with a restricted tissue expression profile in the brain, and lacking an exon 25c. In the embryo, T-type channels are highly abundant and lack exon 25c, which supports accelerated rhythmic firing, and high channel density might also serve expanded roles such as the calcium delivery for contraction of immature muscle. In adults, there is an upregulation of T-type channels in secretory glands, coinciding with sexual maturation and active secretion of vesicular components into reproductive tracts. Further insights into T-type channels are facilitated in snails which have only a single Cav3 channel gene, and a highly tractable and accessible preparation for studying its associated functions in brain, heart and secretory organs.
Materials and Methods
Expanded materials and methods are provided as a supplement (Methods S1).
Source of animals
Giant pond snails, Lymnaea stagnalis were raised in-house in a snail vivarium and breeding facility in B1-177, Department of Biology, University of Waterloo.
Identification of splice variants
During the initial sequencing and cloning of LCav3 [3], multiple variable sequences were identified, including conserved optional exons 8b in the I–II linker and 25c in the III–IV linker. PCR-screening attempts with Lymnaea cDNAs did not reveal exon 26, found in the III–IV linkers of mammalian Cav3.1 and Cav3.2 channel genes (Figure S5). Genomic sequence surrounding optional exons 8b and exon 25c were obtained by PCR and compared to other available snail and mammalian sequences (Figures S1, Figure S2, Figure S3, Table 2 ). PCR was also used to generate the APRASPEQSD sequence deletion, HA-tagged channels and −/+ exon 8b and −/+ exon 25c splice variants ( Table 2 ).
Table 2. Primers used for sequencing and cloning.
Name of DNA primer | DNA primer sequence |
III–IVL RT-PCR screen 5′1 | CTTTCATCTCTCCGTCCTATTGGC |
III–IVL RT-PCR screen 3′1 | CTCTAATGTATCGGTAAAAGCCCAGTGC |
III–IVL RT-PCR screen 5′2 | CAAATCGGAGCCAATGTGAGGCAG |
III–IVL RT-PCR screen 3′2 | GCCAAATCAAAGTATTTGCTATTGATC |
I–IIL intron 5′1 | CTGTGCTCGCAGCATCTAATATGCTG |
I–IIL intron 3′1 | CTGAGTCTGGCCTGTGCCAAGCTGTA |
I–IIL intron 5′2 | CTCAATGTGGATTATGAGCCTAGCAAAACTCA |
I–IIL intron 5′2 | CATCTGTGTCACTCTGCATGGACAACTGTG |
III–IVL intron 5′1 | CGGGAGTCTCAAGAAATTGAGGAG |
III–IVL intron 3′1 | GCCAAATCAAAGTATTTGCTATTGATC |
III–IVL intron 5′2 | GAGGAGCGGGCCAAGCGTGCTGCT |
III–IVL intron 3′2 | TGTGTGAATGAGCAGACGGCTGTG |
pGEM Adaptor 5′ | CATG GCTCGAGATAGATCTATATGTCGACATCAAAA |
pGEM Adaptor 3′ | CGCG TTTTGATGTCGACATATAGATCTATCTCGAGC |
LCav3 −8b +5P 5′ | P-GCTTTTTGCTGACAATCTTCTTATGGAT |
LCav3 −8b +5P 3′ | P-CCTTTCTTTTTAGACTTTTTCCTGCGC |
LCav3 +25c 5′ | AATTGGGCCCGACGTCGCATG |
LCav3 +25c 3′1 | CGGACGACGATGCTTTAGGTCCCTCACTCTTTCTTTTTTTATCCAGTTTCTC |
LCav3 +25c 3′2 | TAGTGGGCCCAGTATGGAGGTTCTCTCATCTCGGACGACGATGCTTTAGGTCCCTCAC |
LCav3 ΔAPRASPE +5P 5′ | P-ATAGACTCCATGTCATCGCCACGACGACCC |
LCav3 ΔAPRASPE +5P 3′ | P-CTGCGGGCTGCTAGACGGTCTCG |
LCav3 HA 5P 5′ | P-GATCCCTACCCCTACGACGTGCCCGACTACGCCCCC |
LCav3 HA 5P 3′ | P-GATCGGGGGCGTAGTCGGGCACGTCGTAGGGGTAGG |
I–IIL (−8b) pET-22b 5′ | AAATGTCATATGTCTGAAACAAAGAAGAGAGAGACAGAG |
I–IIL (−8b) pET-22b 3′ | GAATCTCTCGAGGGCAGTAGGGTTATAGGATAAAGTGC |
RNA extraction and PCR
mRNA for cDNA analyses was extracted [43] from 50–75% and 100% embryos grouped according to morphological features of egg capsules [44] and the shell length of juvenile and adult snails [45].
Lymnaea transcripts were amplified by quantitative RT-PCR (qPCR) with primers designed against LCav1 [46], LCav2 [47], LCav3 and −/+ exons 8b and 25c splice isoforms of LCav3 ( Table 3 ). qPCR transcripts were normalized against standards, actin, SDHA and HPRT1. Cycle threshold (CT) values for the HPRT1 gene were found to produce the lowest stability value (i.e. 0.098) using NormFinder software [48], indicating its suitability as a reference gene. Expression levels of genes/isoforms were normalized relative to HPRT1 using the ΔΔCT method [49] where ratio = (Etarget gene)ΔCTtarget gene/(EHPRT1)ΔCTHPRT1. Amplicons ranged from 119 to 145 bp, producing single products, with PCR efficiencies (E) ranging from 86 to 110%, with templates generated with 1∶5 serial dilutions of pooled cDNA as templates ( Table 3 ). qPCR reactions were carried out in quadruplicate, and standardized between 96 well plate samples with primers against HPRT1.
Table 3. Primers used in quantitative RT-PCR experiment (Figure3).
Real time RT primers: | Ampl. Length | length | Tm (NN) | GC% | qPCR E | R2 | Slope | ||
1 | Lymnaea actin 5′ | CTCACCGACTACCTGATGAAGAT | 102 | 23 | 55.16 | 48 | 92.9 | 0.998 | −3.504 |
Lymnaea actin 3′ | GTAGCAGAGCTTCTCCTTGATGTC | 24 | 57.48 | 50 | |||||
2 | Lymnaea HPRT1 5′ | TGTAGAAGACATCATTGACACTGG | 145 | 24 | 53.86 | 42 | 90.4 | 0.985 | −3.576 |
Lymnaea HPRT1 3′ | GCCAATATAATCTGGTGCGTAAC | 23 | 53.06 | 43 | |||||
3 | Lymnaea SDHA 5′ | GCTTCAAAGCTGCCTGTATAACTA | 122 | 24 | 55.74 | 42 | 93.9 | 0.997 | −3.478 |
Lymnaea SDHA 3′ | ATAGAAGTGGTACTGCCAGTGGT | 23 | 55.07 | 48 | |||||
4 | LCav1 5′ | CCTCATCATCATTGGCTCATT | 119 | 21 | 51.41 | 43 | 99.1 | 0.990 | −3.347 |
LCav1 3′ | TCTCTCTCAGTTTCTGGAAGTCAC | 24 | 55.56 | 46 | |||||
5 | LCav2 5′ | TCTCGATGAATATGTTAGGGTCTG | 142 | 24 | 54.1 | 42 | 107.9 | 0.982 | −3.147 |
LCav2 3′ | GTAGGCCAACTTGTAAGGACACTT | 24 | 54.86 | 46 | |||||
13 | LCav3 Universal 5′ | CAGAGTGACACAGATGTGCTACAG | 139 | 24 | 57.34 | 50 | 104.7 | 0.986 | −3.215 |
LCav3 Universal 3′ | GGTTATAGGATAAAGTGCCATGCT | 24 | 54.14 | 42 | |||||
14 | LCav3 +8b 5′ | AATCCTGAGAAATCTTTGTCCTTG | 123 | 24 | 53.09 | 38 | 92.5 | 0.954 | −3.515 |
LCav3 +8b 3′ | AGGAGGCTGATGAGATAATGAAAG | 24 | 55.14 | 42 | |||||
15 | LCav3 −8b 5′ | AGGAAAAAGTCTAAAAAGAAAGGGCT | 114 | 26 | 55.36 | 35 | 98.6 | 0.995 | −3.357 |
LCav3 −8b 3′ | CTGTAGCACATCTGTGTCACTCTG | 24 | 57.34 | 50 | |||||
16 | LCav3 +25c 5′ | GGGAGTCTCAAGAAATTGAGGAG | 122 | 23 | 54.2 | 48 | 95.8 | 0.986 | −3.426 |
LCav3 +25c 3′ | GTATGGAGGTTCTCTCATCTCAGAC | 25 | 55.84 | 48 | |||||
17 | LCav3 −25c 5′ | GGTTGTAGTTGAAAACTTCCACAAATG | 121 | 27 | 54.59 | 37 | 91.5 | 0.982 | −3.545 |
LCav3 −25c 3′ | TGGAGGTTCTCTCATCTTCTTTCT | 24 | 55.14 | 42 | |||||
22 | LNALCN Universal 5′ | GCTTTTACTGGTCCTAATTGATGC | 141 | 24 | 53.87 | 42 | 100.6 | 0.985 | 3.307 |
LNALCN Universal 3′ | AACAGGGCTTCAAGAGAAAATAGA | 24 | 54,19 | 38 |
Cloning, transfection and electrophysiological recording
Previously, the full-length coding sequence of LCav3 +8b −25c was cloned into the pIRES2-EGFP vector for heterologous expression in HEK-293T cells with bicistronic expression of eGFP (BD Biosciences Clontech) [3]. The other three splice variant combinations, −8b −25c, −8b +25c and +8b +25c as well as +8b (ΔAPRASPE) −25c were created by PCR cassette mutagenesis and reinserted into pIRES2-EGFP vector ( Table 2 ).
We use an optimized cell culture and CaPO4 transfection strategy for heterologous expression and patch clamp recording of ion channel cDNAs in HEK-293T cells, previously outlined in video protocol format http://www.jove.com/video/2314 [50]. Whole cell patches were sealed with pipette resistances of 2–5 MΩ, and with typical access resistance maintained after breakthrough between 4 and 6 MΩ [3], [50]. Series resistance was compensated to 70% (prediction and correction; 10-µs time lag). Only recordings with minimal leak (<10% of peak) and small current sizes (<500 pA) were used for generating peak current-voltage relationship curves due to loss of voltage clamp above 500 pA; all other recordings were typically maintained below 1.5 nA. Offline leak subtraction was carried out using the Clampfit 10.1 software (Molecular Devices). Voltage-command protocols and the curve fitting of data are described previously [3], [50].
Measurement of membrane expression
Current densities (pA/pF) were measured from transfections of 6 µg of plasmid of the LCav3 splice variants [50], quantified to equal amounts by plasmid linearization, electrophoresis and densinometric analysis.
Luminometry
Single haemagglutinin (HA) epitope tags were introduced into the Domain I s5–s6 extracellular loops of the four full-length LCav3 variant constructs. Equimolar amounts of mock, epitope-tagged and un-tagged LCav3 were transfected into HEK-293T cells, and after incubation cells were labeled with rat α-HA monoclonal antibody under membrane permeabilized and non-permeabilized conditions, and luminometry quantified using a FilterMax F5 Multi-Mode Microplate Reader (Molecular Devices) with a chemiluminescence reaction catalyzed with a goat α-rat HRP-conjugated secondary antibody.
Biotinylation
Surface-expressed channels were measured by biotinylation and identified in Western blots with snail Cav3 channel-specific polyclonal antibodies raised in rabbits using as antigen a large portion of the LCav3 I–II linker peptide lacking exon 8b expressed and purified from bacteria using a pET-22b(+) protein expression vector ( Table 2 ). Antibodies were pre-tested for immune reactivity in Western blotting and immunolabeling, as reported previously for antibodies produced strictly against the exon 8b peptide sequence [3]. HEK-293T cell were transfected with equimolar amounts of LCav3 channel variants and biotinylated with Sulfo-NHS-SS-Biotin (Pierce). Surface-labelled, biotinyated fractions were isolated using NeurAvidin® Agarose columns, with the Cav3 channel surface and total protein pools quantified on Western blots using HRP-activated chemiluminescence from a goat α-rabbit secondary antibody.
Supporting Information
Acknowledgments
We would like to thank Dr. A.N. Boone for her helpful suggestions and assistance in designing the qPCR experiment, A. Bozorgzad, Dr. J. Gurska and L. Sauder for their assistance, and Drs. J. Neufeld and T. Dieckmann for providing access to their equipment and facilities.
Footnotes
Competing Interests: JDS is a PLoS ONE Editorial Board member. This does not alter the authors' adherence to all the PLoS ONE policies on sharing data and materials.
Funding: This work was funded through a Natural Sciences and Engineering Research Council (NSERC) Discovery grant to JDS and a NSERC Canada Graduate Scholarship award to AS. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Senatore A, Zhorov BS, Spafford JD. WIREs Membr Transp Signal; 2012. Cav3 T-Type Channels. doi: 10.1002/wmts.41. [Google Scholar]
- 2.Perez-Reyes E. Physiol Rev 83: 117–161. 10.1152/physrev.00018.2002 [doi]; 2003. Molecular physiology of low-voltage-activated t-type calcium channels. [DOI] [PubMed] [Google Scholar]
- 3.Senatore A, Spafford JD. J Biol Chem 285: 7447–7458. M109.090753 [pii];10.1074/jbc.M109.090753 [doi]; 2010. Transient and big are key features of an invertebrate T-type channel (LCav3) from the central nervous system of Lymnaea stagnalis. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Arias-Olguin II, Vitko I, Fortuna M, Baumgart JP, Sokolova S, et al. Characterization of the gating brake in the I–II loop of Ca(v)3.2 T-type Ca(2+) channels. J Biol Chem. 2008;283:8136–8144. doi: 10.1074/jbc.M708761200. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Baumgart JP, Vitko I, Bidaud I, Kondratskyi A, Lory P, et al. PloS one 3: e2976. 10.1371/journal.pone.0002976 [doi]; 2008. I–II loop structural determinants in the gating and surface expression of low voltage-activated calcium channels. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Shcheglovitov A, Vitko I, Bidaud I, Baumgart JP, Navarro-Gonzalez MF, et al. FEBS Lett 582: 3765–3770. S0014-5793(08)00820-X [pii];10.1016/j.febslet.2008.10.013 [doi]; 2008. Alternative splicing within the I–II loop controls surface expression of T-type Ca(v)3.1 calcium channels. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.McRory JE, Santi CM, Hamming KS, Mezeyova J, Sutton KG, et al. J Biol Chem 276: 3999–4011. 10.1074/jbc.M008215200 [doi];M008215200 [pii]; 2001. Molecular and functional characterization of a family of rat brain T-type calcium channels. [DOI] [PubMed] [Google Scholar]
- 8.Ono K, Iijima T. J Mol Cell Cardiol 48: 65–70. S0022-2828(09)00363-0 [pii];10.1016/j.yjmcc.2009.08.021 [doi]; 2010. Cardiac T-type Ca(2+) channels in the heart. [DOI] [PubMed] [Google Scholar]
- 9.Latour I, Louw DF, Beedle AM, Hamid J, Sutherland GR, et al. Glia 48: 112–119. 10.1002/glia.20063 [doi]; 2004. Expression of T-type calcium channel splice variants in human glioma. [DOI] [PubMed] [Google Scholar]
- 10.Emerick MC, Stein R, Kunze R, McNulty MM, Regan MR, et al. Proteins 64: 320–342. 10.1002/prot.20877 [doi]; 2006. Profiling the array of Ca(v)3.1 variants from the human T-type calcium channel gene CACNA1G: alternative structures, developmental expression, and biophysical variations. [DOI] [PubMed] [Google Scholar]
- 11.Monteil A, Chemin J, Bourinet E, Mennessier G, Lory P, et al. Molecular and functional properties of the human alpha(1G) subunit that forms T-type calcium channels. J Biol Chem. 2000;275:6090–6100. doi: 10.1074/jbc.275.9.6090. [DOI] [PubMed] [Google Scholar]
- 12.Zhong X, Liu JR, Kyle JW, Hanck DA, Agnew WS. Hum Mol Genet 15: 1497–1512. ddl068 [pii];10.1093/hmg/ddl068 [doi]; 2006. A profile of alternative RNA splicing and transcript variation of CACNA1H, a human T-channel gene candidate for idiopathic generalized epilepsies. [DOI] [PubMed] [Google Scholar]
- 13.David LS, Garcia E, Cain SM, Thau E, Tyson JR, et al. Channels 4: 375–389. 12874 [pii];10.4161/chan.4.5.12874 [doi]; 2010. Splice-variant changes of the Ca(V)3.2 T-type calcium channel mediate voltage-dependent facilitation and associate with cardiac hypertrophy and development. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Chemin J, Monteil A, Bourinet E, Nargeot J, Lory P. Biophys J 80: 1238–1250. S0006-3495(01)76100-0 [pii];10.1016/S0006-3495(01)76100-0 [doi]; 2001. Alternatively spliced alpha(1G) (Ca(V)3.1) intracellular loops promote specific T-type Ca(2+) channel gating properties. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Ohkubo T, Inoue Y, Kawarabayashi T, Kitamura K. Cell Physiol Biochem 16: 245–254. 89850 [pii];10.1159/000089850 [doi]; 2005. Identification and electrophysiological characteristics of isoforms of T-type calcium channel Ca(v)3.2 expressed in pregnant human uterus. [DOI] [PubMed] [Google Scholar]
- 16.Kim T, Kim S, Yun HM, Chung KC, Han YS, et al. Biochem Biophys Res Commun 378: 15–20. S0006-291X(08)01750-6 [pii];10.1016/j.bbrc.2008.09.034 [doi]; 2009. Modulation of Ca(v)3.1 T-type Ca2+ channels by the ran binding protein RanBPM. [DOI] [PubMed] [Google Scholar]
- 17.Liebeskind BJ, Hillis DM, Zakon HH. Proc Natl Acad Sci U S A 108: 9154–9159. 1106363108 [pii];10.1073/pnas.1106363108 [doi]; 2011. Evolution of sodium channels predates the origin of nervous systems in animals. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Yeoman MS, Brezden BL, Benjamin PR. LVA and HVA Ca2+ Currents in Ventricular Muscle Cells of the Lymnaea Heart. J Neurophysiol. 1999;82:2428–2440. doi: 10.1152/jn.1999.82.5.2428. [DOI] [PubMed] [Google Scholar]
- 19.Liu JH, Konig S, Michel M, Arnaudeau S, Fischer-Lougheed J, et al. Acceleration of human myoblast fusion by depolarization: graded Ca2+ signals involved. Development. 2003;130:3437–3446. doi: 10.1242/dev.00562. [DOI] [PubMed] [Google Scholar]
- 20.Taylor JT, Zeng XB, Pottle JE, Lee K, Wang AR, et al. Calcium signaling and T-type calcium channels in cancer cell cycling. World J Gastroenterol. 2008;14:4984–4991. doi: 10.3748/wjg.14.4984. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Di Biase V, Franzini-Armstrong C. J Cell Biol 171: 695–704. jcb.200503077 [pii];10.1083/jcb.200503077 [doi]; 2005. Evolution of skeletal type e-c coupling: a novel means of controlling calcium delivery. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Lin YC, Spencer AN. Calcium currents from jellyfish striated muscle cells: preservation of phenotype, characterisation of currents and channel localisation. J Exp Biol. 2001;204:3717–3726. doi: 10.1242/jeb.204.21.3717. [DOI] [PubMed] [Google Scholar]
- 23.Steger KA, Shtonda BB, Thacker C, Snutch TP, Avery L. J Exp Biol 208: 2191–2203. 208/11/2191 [pii];10.1242/jeb.01616 [doi]; 2005. The C. elegans T-type calcium channel CCA-1 boosts neuromuscular transmission. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Mackie GO, Meech RW. Separate sodium and calcium spikes in the same axon. Nature. 1985;313:791–793. doi: 10.1038/313791a0. [DOI] [PubMed] [Google Scholar]
- 25.Eaholtz G, Scheuer T, Catterall WA. Neuron 12: 1041–1048. 0896-6273(94)90312-3 [pii]; 1994. Restoration of inactivation and block of open sodium channels by an inactivation gate peptide. [DOI] [PubMed] [Google Scholar]
- 26.Hertel KJ. J Biol Chem 283: 1211–1215. R700035200 [pii];10.1074/jbc.R700035200 [doi]; 2008. Combinatorial control of exon recognition. [DOI] [PubMed] [Google Scholar]
- 27.Kalsotra A, Cooper TA. Nat Rev Genet 12: 715–729. nrg3052 [pii];10.1038/nrg3052 [doi]; 2011. Functional consequences of developmentally regulated alternative splicing. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Wang ET, Sandberg R, Luo S, Khrebtukova I, Zhang L, et al. Nature 456: 470–476. nature07509 [pii];10.1038/nature07509 [doi]; 2008. Alternative isoform regulation in human tissue transcriptomes. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Broicher T, Kanyshkova T, Landgraf P, Rankovic V, Meuth P, et al. Mol Cell Neurosci 36: 132–145. S1044-7431(07)00128-5 [pii];10.1016/j.mcn.2007.05.013 [doi]; 2007. Specific expression of low-voltage-activated calcium channel isoforms and splice variants in thalamic local circuit interneurons. [DOI] [PubMed] [Google Scholar]
- 30.Tscherter A, David F, Ivanova T, Deleuze C, Renger JJ, et al. J Physiol 589: 1707–1724. jphysiol.2010.203836 [pii];10.1113/jphysiol.2010.203836 [doi]; 2011. Minimal alterations in T-type calcium channel gating markedly modify physiological firing dynamics. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Chemin J, Monteil A, Perez-Reyes E, Bourinet E, Nargeot J, et al. J Physiol 540: 3–14. PHY_13269 [pii]; 2002. Specific contribution of human T-type calcium channel isotypes (alpha(1G), alpha(1H) and alpha(1I)) to neuronal excitability. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Astori S, Wimmer RD, Prosser HM, Corti C, Corsi M, et al. Proc Natl Acad Sci U S A 108: 13823–13828. 1105115108 [pii];10.1073/pnas.1105115108 [doi]; 2011. The Ca(V)3.3 calcium channel is the major sleep spindle pacemaker in thalamus. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.McKay BE, McRory JE, Molineux ML, Hamid J, Snutch TP, et al. Ca(V)3 T-type calcium channel isoforms differentially distribute to somatic and dendritic compartments in rat central neurons. Eur J Neurosci. 2006;24:2581–2594. doi: 10.1111/j.1460-9568.2006.05136.x. [DOI] [PubMed] [Google Scholar]
- 34.Crandall SR, Govindaiah G, Cox CL. J Neurosci 30: 15419–15429. 30/46/15419 [pii];10.1523/JNEUROSCI.3636-10.2010 [doi]; 2010. Low-threshold Ca2+ current amplifies distal dendritic signaling in thalamic reticular neurons. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Kang HW, Park JY, Lee JH. Biochim Biophys Acta 1778: 2740–2748. S0005-2736(08)00238-1 [pii];10.1016/j.bbamem.2008.08.002 [doi]; 2008. Distinct contributions of different structural regions to the current kinetics of the Cav3.3 T-type Ca2+ channel. [DOI] [PubMed] [Google Scholar]
- 36.Groome JR, Dice MC, Fujimoto E, Ruben PC. Biophys J 93: 1519–1533. S0006-3495(07)71412-1 [pii];10.1529/biophysj.106.102079 [doi]; 2007. Charge immobilization of skeletal muscle Na+ channels: role of residues in the inactivation linker. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Perez-Reyes E. Mol Pharmacol 77: 136–138. mol.109.062133 [pii];10.1124/mol.109.062133 [doi]; 2010. G protein-mediated inhibition of Cav3.2 T-type channels revisited. [DOI] [PubMed] [Google Scholar]
- 38.Hildebrand ME, Isope P, Miyazaki T, Nakaya T, Garcia E, et al. J Neurosci 29: 9668–9682. 29/31/9668 [pii];10.1523/JNEUROSCI.0362-09.2009 [doi]; 2009. Functional coupling between mGluR1 and Cav3.1 T-type calcium channels contributes to parallel fiber-induced fast calcium signaling within Purkinje cell dendritic spines. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Anderson D, Mehaffey WH, Iftinca M, Rehak R, Engbers JD, et al. Nat Neurosci 13: 333–337. nn.2493 [pii];10.1038/nn.2493 [doi]; 2010. Regulation of neuronal activity by Cav3-Kv4 channel signaling complexes. [DOI] [PubMed] [Google Scholar]
- 40.Altier C, Garcia-Caballero A, Simms B, You H, Chen L, et al. Nat Neurosci 14: 173–180. nn.2712 [pii];10.1038/nn.2712 [doi]; 2011. The Cavbeta subunit prevents RFP2-mediated ubiquitination and proteasomal degradation of L-type channels. [DOI] [PubMed] [Google Scholar]
- 41.Mezghrani A, Monteil A, Watschinger K, Sinnegger-Brauns MJ, Barrere C, et al. J Neurosci 28: 4501–4511. 28/17/4501 [pii];10.1523/JNEUROSCI.2844-07.2008 [doi]; 2008. A destructive interaction mechanism accounts for dominant-negative effects of misfolded mutants of voltage-gated calcium channels. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Baumgart JP, Vitko I, Bidaud I, Kondratskyi A, Lory P, et al. PloS one 3: e2976. 10.1371/journal.pone.0002976 [doi]; 2008. I–II loop structural determinants in the gating and surface expression of low voltage-activated calcium channels. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Chomczynski P, Sacchi N. Anal Biochem 162: 156–159. 10.1006/abio.1987.9999 [doi];0003-2697(87)90021-2 [pii]; 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. [DOI] [PubMed] [Google Scholar]
- 44.Marois R, Croll RP. J Comp Neurol 322: 255–265. 10.1002/cne.903220211 [doi]; 1992. Development of serotoninlike immunoreactivity in the embryonic nervous system of the snail Lymnaea stagnalis. [DOI] [PubMed] [Google Scholar]
- 45.McComb C, Varshney N, Lukowiak K. J Exp Biol 208: 1459–1467. 208/8/1459 [pii];10.1242/jeb.01544 [doi]; 2005. Juvenile Lymnaea ventilate, learn and remember differently than do adult Lymnaea. [DOI] [PubMed] [Google Scholar]
- 46.Spafford JD, Dunn T, Smit AB, Syed NI, Zamponi GW. In vitro characterization of L-type calcium channels and their contribution to firing behavior in invertebrate respiratory neurons. J Neurophysiol. 2006;95:42–52. doi: 10.1152/jn.00658.2005. [DOI] [PubMed] [Google Scholar]
- 47.Spafford JD, Chen L, Feng ZP, Smit AB, Zamponi GW. Expression and modulation of an invertebrate presynaptic calcium channel alpha1 subunit homolog. J Biol Chem. 2003;278:21178–21187. doi: 10.1074/jbc.M302212200. [DOI] [PubMed] [Google Scholar]
- 48.Andersen CL, Jensen JL, Orntoft TF. Cancer Res 64: 5245–5250. 10.1158/0008-5472.CAN-04-0496 [doi];64/15/5245 [pii]; 2004. Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. [DOI] [PubMed] [Google Scholar]
- 49.Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001;29:e45. doi: 10.1093/nar/29.9.e45. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Senatore A, Boone AN, Spafford JD. J Vis Exp 47: doi: 10.3791/2314. 2314 [pii];10.3791/2314 [doi]; 2011. Optimized transfection strategy for expression and electrophysiological recording of recombinant voltage-gated ion channels in HEK-293T cells. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.