Skip to main content
PLOS One logoLink to PLOS One
. 2012 Jun 15;7(6):e38638. doi: 10.1371/journal.pone.0038638

Characterization of Human Coronavirus Etiology in Chinese Adults with Acute Upper Respiratory Tract Infection by Real-Time RT-PCR Assays

Roujian Lu 1, Xiaoyan Yu 1,3, Wen Wang 1, Xijie Duan 2, Linglin Zhang 1, Weimin Zhou 1, Jin Xu 2, Lingjie Xu 2, Qin Hu 1,3, Jianxin Lu 3, Li Ruan 1, Zhong Wang 2,*, Wenjie Tan 1,*
Editor: Krzysztof Pyrc4
PMCID: PMC3376151  PMID: 22719912

Abstract

Background

In addition to SARS associated coronaviruses, 4 non-SARS related human coronaviruses (HCoVs) are recognized as common respiratory pathogens. The etiology and clinical impact of HCoVs in Chinese adults with acute upper respiratory tract infection (URTI) needs to be characterized systematically by molecular detection with excellent sensitivity.

Methodology/Principal Findings

In this study, we detected 4 non-SARS related HCoV species by real-time RT-PCR in 981 nasopharyngeal swabs collected from March 2009 to February 2011. All specimens were also tested for the presence of other common respiratory viruses and newly identified viruses, human metapneumovirus (hMPV) and human bocavirus (HBoV). 157 of the 981 (16.0%) nasopharyngeal swabs were positive for HCoVs. The species detected were 229E (96 cases, 9.8%), OC43 (42 cases, 4.3%), HKU1 (16 cases, 1.6%) and NL63 (11 cases, 1.1%). HCoV-229E was circulated in 21 of the 24 months of surveillance. The detection rates for both OC43 and NL63 were showed significantly year-to-year variation between 2009/10 and 2010/11, respectively (P<0.001 and P = 0.003), and there was a higher detection frequency of HKU1 in patients aged over 60 years (P = 0.03). 48 of 157(30.57%) HCoV positive patients were co-infected. Undifferentiated human rhinoviruses and influenza (Flu) A were the most common viruses detected (more than 35%) in HCoV co-infections. Respiratory syncytial virus (RSV), human parainfluenza virus (PIV) and HBoV were detected in very low rate (less than 1%) among adult patients with URTI.

Conclusions/Significance

All 4 non-SARS-associated HCoVs were more frequently detected by real-time RT-PCR assay in adults with URTI in Beijing and HCoV-229E led to the most prevalent infection. Our study also suggested that all non-SARS-associated HCoVs contribute significantly to URTI in adult patients in China.

Introduction

Human coronaviruses (HCoVs) are enveloped viruses with a single-strand RNA genome [1]. 5 species are known to infect humans, 229E and OC43 first were identified in the 1960s, NL63 and HKU1 identified in 2004 and 2005, respectively [1]–[3], and SARS-CoV was identified during the severe acute respiratory syndrome epidemic in 2003 [4]–[5]. HCoVs are associated with respiratory syndromes ranging from mild upper to severe lower respiratory tract infections including pneumonia and bronchiolitis [1], [6]–[9]. Specifically, HCoVs can elicit a more serious respiratory disease in children, the elderly and people with underlying disease [1], [6], [10]–[11]. HCoVs circulate worldwide, although their frequencies differ from country to country depending on seasonality and detection annum [1], [12]–[16]. Most studies have focused on children or adults with more serious respiratory disease including lower respiratory tract infections [1], [17]–[22].

Upper respiratory tract infections (URTI) or “the common cold” are a significant health burden, especially among children. The major viral agents of URTI in children include rhinoviruses, HCoVs (–OC43 and –229E), RSV,PIV, adenovirus(ADV) and influenza(Flu). newly identified viruses (hMPV, HCoV-NL63,HCoV-HKU1 and HBoV) are also included. Although HCoVs are recognized as one of the most frequent causes of URTI or common colds in adults [7], epidemiological data and clinical profiles are limited on HCoVs infection in adults with URTI continuously for several years with sensitive molecular methods [1], [13], [20], [23]–[25], especially for HCoV-NL63 and HCoV-HKU1 in China after 2009 H1N1 pandemic. Ren et al reported the prevalence of HCoVs was 1% in adults with ARTI in Beijing from 2005 to 2009 by RT-PCR assays [24], which was significantly lower than in previous literatures indicated above 2.1% [1], [13], [20], [23]. In the present study, 981 nasopharyngeal swabs were collected continuously from adults with URTI in Beijing between March 2009 and February 2011. HCoVs infections were detected by Real-Time RT-PCR with excellent specifity and sensitivity [19], [23], [26], other 11 respiratory viruses infection among all specimens were also detected by sensitive molecular assays [25]–[28]. HCoVs infection and their clinical and epidemiological characteristics were analyzed.

Materials and Methods

Ethics Issues

All aspects of the study were performed in accordance with the national ethics regulations and approved by the Institutional Review Boards of the Centre for Disease Control and Prevention of China, as well as the Ethics Committee of Peking Union Medical College Hospital. Participants were received "Written Informed Consent" on the study’s purpose and of their right to keep information confidential. Written consent was obtained from all participants or their guardians.

Patients and Specimens

Nasopharyngeal swabs were collected from adults presenting with URTI to the Peking Union Medical College Hospital, Beijing, China, between March 2009 and February 2011. Patients provided informed consent for specimen collection and testing. All patients over 14 years of age were selected according to a set of criteria that included respiratory symptoms, a body temperature above 37.5°C, and a normal or low leukocyte count(≤1010/L), but not LRTI identified by pulmonary abnormalities on radiography and clinical descriptions(without bronchitis, bronchiolitis and pneumonia). Demographic data and clinical findings at the time of diagnosis were recorded on a standard form. All swabs were collected into viral transport medium and transported for immediate testing to the National Institute for Viral Disease Control and Prevention (NIVDC), China Center for Disease Control and Prevention.

Nucleic Acid Extraction and cDNA Synthesis

Viral RNA was extracted from 200 µl of sample using QIAamp MinElute Virus Spin kits (Qiagen, Germany). cDNA was synthesized with AMV reverse transcriptase and random hexamer primers (Promega, USA) as described previously [19], [23], [25].

Real-time RT-PCR for HCoV Detection

Real-time RT-PCR amplification was performed using TaqMan® One-Step RT-PCR Master Mix Reagents Kit (Applied Biosystems, USA) [19], [23], [26]. A real-time reverse transcription (RT)-PCR technique was used to screen for each of the 4 non-SARS HCoVs (Table 1). PCR was performed under the following conditions: 48°C for 30 min, 95°C for 15 min, followed by 40 cycles at 95°C for 15s, 68°C for 1min.The lower limit of detection of each HCoV real-time RT-PCR assay was 50–100 copies/25uL.The assay sensitivity, specificity and coefficients of variability(CVs) were evaluated and validated as previously described [19], [26].

Table 1. Primers and Probes (5′–3′), and Their Gene Product Targets, Used for the Respiratory Viruses Identified in the Study.

Assays andViruses detected Primer* and probe Target genes Ref
Real-time rtPCR
HCoV-OC43 OC43-F GCTCAGGAAGGTCTGCTCC N 19
OC43-R TCCTGCACTAGAGGCTCTGC
OC43-P FAM –TTCCAGATCTACTTCGCGCACATCC-TAMRA
HCoV-229E 229E-F CGCAAGAATTCAGAACCAGAG N 19
229E-R GGCAGTCAGGTTCTTCAACAA
229E-P FAM –CCACACTTCAATCAAAAGCTCCCAAATG-TAMRA
HCoV-NL63 NL63-F AGGACCTTAAATTCAGACAACGTTCT N 19
NL63-R GATTACGTTTGCGATTACCAAGACT
NL63-P FAM- TAACAGTTTTAGCACCTTCCTTAGCAACCCAAACA-TAMRA
HCoV-HKU1 HKU1-F AGTTCCCATTGCTTTCGGAGTA N 19
HKU1-R CCGGCTGTGTCTATACCAATATCC
HKU1-P FAM -CCCCTTCTGAAGCAA- MGB
Multiple-nested PCR
Mix1 FluA FA-1F CAGAGACTTGARRATGTYTTTGC Matrix 26
FA-1R GGCAAGYGCACCRGYWGARTARCT
FA-2F GACCRATCCTGTCACCTCTGACT
FA-2R AYYTCYTT GC CCATGGAATGT
FluB FB-1F GTGACTGGTGTGATACCACT HA
FB-1R TGTTTTCACCCATATTGGGC
FB-2F CATTTTGCAAATCTCAAAGG
FB-2R TGGAGGCAATCTGCTTCACC
ADV AD-1F GCCGCAGTGGTCTTACATGCACATC Hexon
AD-1R CAGCACGCCGCGGATGTCAAAGT
AD-2F GCCACCGAGACGTACTTCAGCCTG
AD-2R TTGTACGAGTACGCGGTATCCTCGCGGTC
AD-2F9 CMGASACSTACTTCAGYMTG
AD-2R9 GTASGYRKTRTCYTCSCGGTC
Mix2 hRSV RS-1F TGGGAGARGTRGCTCCAGAATACAGGC N 26
RS-1R ARCATYACTTGCCCTGMACCATAGGC
RS-2F ACYAAATTAGCAGCAGGG
RS-2R CTCTKGTWGAWGATTGTGC
Picornavirus PIC-1F GCACTTCTGTTTCCCC 5?-UTR
PIC-1R CGGACACCCAAAGTAG
PIC-2F GCACTTCTGTTTCCCC
Mix3 PIV (-1,-2,-3) P123-1F GTWCAAGGAGAYAATCARGC L 26
P123-1R GRTCYGGAGTTTCWARWCC
P1-2F GCATCAGACCCTTATTCATG
P1-2R GTTGTATCAAGCATCCCGGC
P2-2F CAGCCGATCCATACTCATTG
P2-2R CTTGTGGTGTCAAAAAATCC
P3-2F GCTGTTACTACAAGAGTACC
P3-2R GTTGCCAGATTTGAGGATGC
rtPCR
hMPV hMPV-F AACCGTGTACTAAGTGATGCACTC N 27
hMPV-R CATTGTTTGACCGGCCCCATAA
Nested PCR
HBoV HBoV-1F CCAGCAAGTCCTCCAAACTCACCTGC NP-1 28
HBoV-1R GGAGCTTCAGGATTGGAAGCTCTGTG
HBoV-2F GACCTCTGTAAGTACTATTAC
HBoV-2R CTCTGTGTTGACTGAATACAG
*

K  =  G+T, M  =  A+C, R  =  A+G, S  =  G+C, W  =  A+T, Y  =  C+T.

1st round primers:–1F,–1R; 2 nd round primers: –2F or –2F9, –2R or –2R9.

Gel-based RT-PCR for Detection of non-HCoV Respiratory Viruses

Specimens were also screened for influenza virus types A and B, parainfluenza virus types 1 to 3, respiratory syncytial virus (RSV), picornaviruses (including enteroviruses and rhinoviruses) and adenoviruses using three multiple-nested PCR assays [25]–[26] (Table 1), for human metapneumovirus (hMPV) and human bocavirus (HBoV) using PCR and nested-PCR assays [26]–[28] (Table 1). Multiple-nested PCR and nested PCR programs were run as follows: 1st round: 94°C for 2 min; 94°C for 30 s, 55/50°C 30 s, 72°C for 1 min, 35 cycles; 72°C 5 min. 2nd round: 94°C for 2 min; 94°C for 30s, 55/50°C 30s, 72°C for 1 min, 25 cycles; 72°C 5 min. RT-PCR program was run as follows: 50°C 30 min; 95 °C 15 min; 95°C 30s, 60°C 30s, 72°C 1 min, 40 cycles; 72°C 5 min. The lower limits of detection for nested PCR and RT-PCR assays were 10–100 single virus molecules/25 ul. All PCR products were confirmed by sequencing.

Statistical Analysis

Statistical analysis was performed using the predictive analysis software (PASW) statistics 18 package with X2-test and Fisher’s exact test.

Results

Detection of HCoVs and Other 11 Respiratory Viruses Infection

A total of 981 nasopharyngeal swabs were collected. The male: female ratio was 438∶543 (1∶1.24) and the median age was 29 years (age range 14 years to 91 years). HCoVs were detected by real-time RT-PCR in 157 (16.0%) of the 981 specimens: 229E in 96 (9.8%), OC43 in 42 (4.3%), HKU1 in 16 (1.6%) and NL63 in 11(1.1%). The detection rates of HCoVs are summarized in Table 2. Differences in the detection rates of OC43 and NL63 during 2009/10 and 2010/11 were statistically significant (P<0.001 and P = 0.003, respectively).

Table 2. Prevalence of Different Respiratory Virus Infections from March 2009 to February 2011.

Respiratory Virus No. of detections (%) Total
03/09–02/10 03/10–02/11
(N = 539 cases) (N = 442 cases) 981
HCoV-OC43 38(7.1)** 4(0.9) 42(4.3)
HCoV-229E 58(10.8) 38(8.6) 96(9.8)
HCoV-NL63 11(2.0) * 0(0) 11(1.1)
HCoV-HKU1 12(2.2) 4(0.9) 16(1.6)
Flu A 84(15.6) ** 3(0.7) 87(8.9)
Flu B 17(3.2) 1(0.2) 18(1.8)
PIV-1 4(0.7) 1(0.2) 5(0.5)
PIV-2 1(0.2) 0(0) 1(0.1)
PIV-3 0(0) 0(0) 0(0)
ADV 19(3.5) 1(0.2) 20(2.0)
hRSV 1(0.2) 0(0) 1(0.1)
Piconavirus Rhinoviruses 57(10.6) 14(3.2) 71(7.2)
Enterovirus 7(1.3) 0(0) 7(0.7)
hMPV 13(2.4) 13(2.9) 26(2.7)
HBoV 0(0) 2(0.5) 2(0.2)
**

P<0.001; *P = 0.003.

Other 11 respiratory viruses infection among all specimens were also detected by sensitive molecular assays (Table 1). During the same period, Flu A virus was detected in 87(8.9%) patients, Flu B virus was detected in 18(1.8%) patients, PIV-1 was detected in 5(0.5%) patients, PIV-2 was detected in 1(0.1%) patient, ADV was detected in 20(2.0%) patients, RSV was 1(0.1%) patient, rhinoviruses was detected in 71(7.2%) patients, enterovirus was detected in 7(0.7%) patients, hMPV was detected in 26(2.7%), and HBoV was detected in 2(0.2%) patients(Table 2).

Epidemiology of HcoVs

The seasonal distribution of HCoVs is shown in Fig.1. HCoV-229E was the most common species, appearing in most months and without an obvious seasonal distribution. Peaks in 229E detections occurred in May 2009, December 2009 and August 2010, corresponding with spring, winter and summer, respectively, in Beijing. HCoV-OC43 detections peaked in April 2009. This virus continued to circulate for the next 10 months but only sporadic infections were detected in the second half of the study. In 2009, when most coronavirus infections occurred, 229E and OC43 were detected in every evaluable month, with the exception of 229E in September. A peak of NL63 activity occurred in March and April 2009 with little or no subsequent activity. HCoV-HKU1 activity was sporadic throughout, with no obvious seasonal distribution.

Figure 1. Temporal distribution of the 4 HCoV species between March 2009 and February 2011 inclusive.

Figure 1

HCoVs were detected across all age groups, although NL63 cases were absent in the 30–39 years age group (Fig.2). A significantly higher detection frequency of HKU1 occurred in patients aged over 60 years (P = 0.03), but there were no significant differences in age group distribution for 229E, OC43 and NL63.

Figure 2. Frequencies of the four non SARS HCoVs infections detection by different age groups.

Figure 2

Clinical Characteristics of Patients with HCoVs Infection

Approximately equal numbers of males and females were infected with OC43, HKU1 and NL63; 229E infected significantly more female than males (62.5% versus 37.5%, P = 0.009). The clinical characteristics are summarized in Table 3. All HCoV positive patients presented with URTI. Fever, sore throat and headache were the most common symptoms at presentation. Gastrointestinal tract associated symptoms were rare. Overall there were no statistically significant differences in the clinical symptoms between species-specific HCoVs except for rhinorrhea, which was observed less in 229E-infected patients than in the other cases (P = 0.025).

Table 3. Clinical characteristics of patients with HCoV infections in the study.

Characteristics OC43 (N = 42) 229E (N = 96) NL63 (N = 11) HKU1(N = 16) P-value
Demographics:
Gender ratio (M/F) 1.1 0.58 0.83 0.78
Age in years mean/median 33.5/28.5 32.3/28 41.45/41 38.1/31.5
Respiratory symptoms:
Fever(>38°C) 37 (88.1%) 79 (82.3%) 10 (90.9%) 12 (85.7%) ns
Chills 6 (14.3%) 24 (25%) 2 (18.2%) 4 (25%) ns
Sore throat 27 (64.3%) 63 (65.6%) 8 (72.7%) 10 (62.5%) ns
Nasal obstruction 9 (21.4%) 18 (18.8%) 3 (27.3%) 2 (12.5%) ns
Rhinorrhea 17 (40.5%) 23 (24%) 5 (45.5%) 9 (56.2%)  = 0.025
Cough 14 (33.3%) 30 (31.2%) 7 (63.6%) 9 (56.3%) ns
Sputum production 8 (19%) 16 (16.7%) 5 (45.5%) 4 (25%) ns
Gastrointestinal symptoms:
Vomiting 4 (9.5%) 5 (5.2%) 1 (9.1%) 0 ns
Diarrhea 1 (2.4%) 6 (6.2%) 1 (9.1%) 0 ns
Other symptoms:
Headache 30 (71.4%) 68 (70.8%) 5 (45.5%) 11 (68.8%) ns
Muscle pain 1 (2.4%) 4 (4.2%) 0 1 (6.3%) ns

Co-detections of other Respiratory Virus in HCoV-positive Cases

High rates of co-infection with non-HCoV respiratory viruses were observed (Table 4). Of the 157 HCoV positive patients, 48 (30.57%) were co-infected, 38 of them with one other virus and 10 with 2 other viruses. Most HCoV-associated co-infections involved human rhinoviruses (all picornaviruses positive samples were confirmed to be rhinoviruses by DNA sequencing) and Flu A virus (more than 30%). Compared to single HCoV infections, there was no evidence to indicate that patients with co-infections had more serious illnesses (results not shown).

Table 4. Co-Detections of HCoVs and other Respiratory Virus in the study population.

Co-Detection withHCoVs(n = 157) Number of cases (n = 48)
HCoVs+ Flu A 18
229E+ Flu A 10
NL63+ Flu A 1
HKU1+ Flu A 2
OC43+229E+ Flu A 2
OC43+HKU1+ Flu A 2
NL63+HKU1 + Flu A 1
HCoVs +Flu B 1
229E+Flu B 1
HCoV+ ADV 6
OC43+ADV 3
229E+ADV 2
NL63+ADV+rhinoviruses* 1
HCoVs+ hRSV 1
OC43+HKU1+hRSV 1
HCoVs+ rhinoviruses 18
OC43+rhinoviruses 5
229E+rhinoviruses 9
HKU1+rhinoviruses 1
OC43+NL63+rhinoviruses 1
NL63+HKU1+rhinoviruses 1
NL63+ADV+rhinoviruses* 1
HCoVs+hMPV 1
229E+hMPV 1
HCoVs+HCoVs 4
OC43+229E 3
OC43+229E+NL63 1
*

Be only counted once in the total.

Discussion

HCoVs circulate worldwide and the prevalence of the different species varies by year and geographical location [1]. Recent reports show that HCoVs have been detected in Hong Kong [29], Italy [13], France [22], [30], USA [18], [21], [31], UK [23], Netherlands [19], Finland [32], and China [24]–[25] in respiratory and/or stool samples obtained from young children [18], [21]–[22], [31] and adults [20], [23]–[24], [33]. In our retrospective study, a 16.0% detection rate for HCoVs infection was found in adults with URTI; 229E was the most common infection (9.8% of all cases), followed by OC43 (4.3%), HKU1 (1.6%) and NL63 (1.1%). The detection rates for 229E and OC43 are consistent with other studies performed worldwide (0.1–26% &0.5–10.1%) [1], [11], [22], [26], [29]–[37], but higher than in a recent study undertaken in Beijing [24], perhaps due in our study to the exclusion of patients with lower respiratory tract infections via clinical descriptions and radiography, the use of a screening criteria leukocyte count of ≤1010/L which is likely to have excluded most patients with bacterial infection, and the use of real-time PCR with excellent sensitivity [17], [19], [23]. The studies were also undertaken in different years, suggesting that the presence or absence of circulating HCoV species during these times may have influenced these differed outcomes [1], [17], [24]. In addition, Flu A detection rate was 15.6% among URTI adult patients between 2009/2–2010/3 with the occurrence of pandemic H1N1 virus 2009, which was signicantly higher than that (0.7%) of patients between 2010/2–2011/3 (Table 2). Whether the circulating patterns of HCoVs might be affected by FluA pandemic, warrants further studies.

HCoVs exhibit variable circulation approximately every 2–3 years [1], [17], [24], [34]–[35], and this was confirmed by our observation that detection rates for both OC43 and NL63 were statistically significant between 2009/10 and 2010/11. Nevertheless, 229E strains circulated throughout the 2 years of study, often in high numbers and without discernible seasonality, in contrast to that reported in the UK [23].

A previous study in Beijing reported higher detection rates for HCoVs in individuals over 65 years of age [24]. In contrast, in this study HCoVs were detected essentially in all adult age groups. Of note, however, HKU1 infection predominated in patients aged over 60 years, suggesting that adults in this category may be at higher risk for infection with this species.

URTI occurs commonly in both children and adults and is a major cause of mild morbidity which have a high cost to society. URTI among adults are responsible for missed work and unnecessary medical care (antibiotic prescriptions), also occasionally associated serious sequelae. The clinical diagnosis of all HCoVs positive patients we studied was URTI. The main clinical signs at presentation were fever, cough, sore throat and headache, in accord with several previous studies [1], [7], [22]. Some cases also showed gastrointestinal symptoms except in HCoV-HKU1 infection patients [1], [32]. Rhinorrhea was observed in significantly fewer patients infected with 229E. Many previous reports have indicated that HCoVs have high rates of co-infection with other respiratory viruses [1], [19], [23], [26], including rhinoviruses, influenza, HMPV, ADV and RSV. In this study, co-infections were associated with each of the non-SARS HCoVs at rates similar to previous studies [1], [18], [23], [26]. Human rhinoviruses and influenza A viruses were the most common respiratory viruses detected in HCoVs-positive patients, possibly reflect the level of their circulation at the time, and which were consistent with rhinoviruses being the most common respiratory viruses for common cold [1], [36]. In contrast with virus infection among children with URTI [1], [7], [23], [36], RSV, PIV and HBoV were detected in very low rate(less than 1%) among adults with URTI in this study. It was consistent with the previous reports [26], [37]. Comparison of clinical symptoms experienced by patients with and without co-infections indicated that co-infection with HCoVs did not affect illness severity.

In summary, we found that the four non-SARS HCoVs are regularly associated with URTI in adult patients in China, although distinct seasonal patterns of circulation are not obvious. Our observation that elderly adults may be are at high risk of HKU1 infection requires further study. Our results suggest that testing algorithms that include sensitive HCoVs detection contribute to the likelihood of obtaining a laboratory diagnosis when respiratory virus infection is suspected [26], [37]–[38]. To the best of our knowledge, this is the first comprehensive analysis of the potential impact of four non-SARS HCoVs (HCoV-OC43, HCoV-229E, HCoV-NL63 and HCoV-HKU1) as causes of URTIs in adults admitted to hospital in China by real time RT-PCR assays. To identify the role of HCoVs infection in URTI of adults, more specimens include control subjects with clear clinical and epidemiological profiles warrant be investigated.

Acknowledgments

The authors thank Chris Birch and Julian Druce of the Victorian Infectious Diseases Reference Laboratory, North Melbourne, Australia, for their assistance when developing multiplex RT-PCR for other common respiratory viruses and preparation of the manuscript. We also thank the staff of the Peking Union Medical College Hospital for providing samples.

Footnotes

Competing Interests: The authors have declared that no competing interests exist.

Funding: This work was funded by the Project of the National Natural Science Foundation of China (81100062); 973 Program of China (Grant numbers: 2011CB504704); the Control and Prevention of Major Infectious Diseases Program in China (2011ZX10004-001) and China-Australia Health and HIV/AIDS Facility (CAHHF EID07). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Greenberg SB. Update on rhinovirus and coronavirus infections. Semin Resoir Crit Care Med. 2011;32:433–446. doi: 10.1055/s-0031-1283283. [DOI] [PubMed] [Google Scholar]
  • 2.van der Hoek L, Pyrc K, Jebbink MF, Vermeulen-Oost W, Berkhout RJ, et al. Identification of a new human coronavirus. Nat Med. 2004;10:368–73. doi: 10.1038/nm1024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Woo PC, Lau SK, Chu CM, Chan KH, Tsoi HW, et al. Characterization and complete genome sequence of a novel coronavirus, coronavirus HKU1, from patients with pneumonia. J Virol. 2005;79:884–95. doi: 10.1128/JVI.79.2.884-895.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Drosten C, Gunther S, Preiser W, van der Werf S, Brodt HR, et al. Identification of a novel coronavirus in patients with severe acute respiratory syndrome. N Engl J Med. 2003;348:1967–76. doi: 10.1056/NEJMoa030747. [DOI] [PubMed] [Google Scholar]
  • 5.Ksiazek TG, Erdman D, Goldsmith CS, Zaki SR, Peret T, et al. A novel coronavirus associated with severe acute respiratory syndrome. N Engl J Med. 2003;348:1953–66. doi: 10.1056/NEJMoa030781. [DOI] [PubMed] [Google Scholar]
  • 6.Fouchier RA, Hartwig NG, Bestebroer TM, Niemeyer B, de Jong JC, et al. A previously undescribed coronavirus associated with respiratory disease in humans. Proc Natl Acad Sci USA. 2004;101:6212–6. doi: 10.1073/pnas.0400762101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Makela MJ, Puhakka T, Ruuskanen O, Leinonen M, Saikku P, et al. Viruses and bacteria in the etiology of the common cold. J Clin Microbiol. 1998;36:539–42. doi: 10.1128/jcm.36.2.539-542.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Tsang KW, Ho PL, Ooi GC, Yee WK, Wang T, et al. A cluster of cases of severe acute respiratory syndrome in Hong Kong. N Engl J Med. 2003;348:1977–85. doi: 10.1056/NEJMoa030666. [DOI] [PubMed] [Google Scholar]
  • 9.van der Hoek L, Sure K, Ihorst G, Stang A, Pyrc K, et al. Croup is associated with the novel coronavirus NL63. PLoS Med. 2005;2:e240. doi: 10.1371/journal.pmed.0020240. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Nokso-Koivisto J, Pitkaranta A, Blomqvist S, Kilpi T, Hovi T. Respiratory coronavirus infections in children younger than two years of age. Pediatr Infect Dis. 2000;19:164–6. doi: 10.1097/00006454-200002000-00016. [DOI] [PubMed] [Google Scholar]
  • 11.Pene F, Merlat A, Vabret A, Rozenberg F, Buzyn A, et al. Coronavirus 229E-related pneumonia in immunocompromised patients. Clin Infect Dis. 2003;37:929–32. doi: 10.1086/377612. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Esper F, Weibel C, Ferguson D, Landry ML, Kahn JS. Coronavirus HKU1 infection in the United States. Emerg Infect Dis. 2006;12:775–9. doi: 10.3201/eid1205.051316. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Gerna G, Percivalle E, Sarasini A, Campanini G, Piralla A, et al. Human respiratory coronavirus HKU1 versus other coronavirus infections in Italian hospitalised patients. J Clin Virol. 2007;38:244–50. doi: 10.1016/j.jcv.2006.12.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Koetz A, Nilsson P, Lindén M, van der Hoek L, Ripa T. Detection of human coronavirus NL63, human metapneumovirus and respiratory syncytial virus in children with respiratory tract infections in southwest Sweden. Clin Microbiol Infect. 2006;12:1089–96. doi: 10.1111/j.1469-0691.2006.01506.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Sloots TP, McErlean P, Speicher DJ, Arden KE, Nissen MD, et al. Evidence of human coronavirus HKU1 and human bocavirus in Australian children. J Clin Virol. 2006;35:99–102. doi: 10.1016/j.jcv.2005.09.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Suzuki A, Okamoto M, Ohmi A, Watanabe O, Miyabayashi S, et al. Detection of human coronavirus-NL63 in children in Japan. Pediatr Infect Dis J. 2005;24:645–6. doi: 10.1097/01.inf.0000168846.71517.ee. [DOI] [PubMed] [Google Scholar]
  • 17.Dare RK, Fry AM, Chittaganpitch M, Sawanpanyalert P, Olsen SJ, et al. Human coronaviruses infections in rural Tailand: A comprehensive study using real-time reverse-transcription polymerase chain reaction assays. J Infect Dis. 2007;196:1321–8. doi: 10.1086/521308. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Dominguez SR, Robinson CC, Holmes KV. Detection of Four Human Coronaviruses in Respiratory Infections in Children: A One-Year Study in Colorado. J Med Virol. 2009;81:1597–604. doi: 10.1002/jmv.21541. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Esposito S, Bosis S, Niesters HG, Tremolati E, Begliatti E, et al. Impact of human coronavirus infections in otherwise healthy children who attended an emergency department. J Med Virol 2006. 2006;78:1609–15. doi: 10.1002/jmv.20745. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Gorse GJ, O'Connor TZ, Hall SL, Vitale JN, Nichol KL. Human coronavirus and acute respiratory illness in older adults with chronic obstructive pulmonary disease. J Infect Dis. 2009;199:847–57. doi: 10.1086/597122. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Talbot HKB, Crowe JE, Jr, Edwards KM, Griffin MR, Zhu Y, et al. Coronavirus infection and hospitalizations for acute respiratory illness in young children. J Med Virol. 2009;81:853–6. doi: 10.1002/jmv.21443. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Vabret A, Mourez T, Gouarin S, Petitjean J, Freymuth F. An outbreak of coronavirus OC43 respiratory infection in Normandy, France. Clin Infect Dis. 2003;36:985–9. doi: 10.1086/374222. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Gaunt ER, Hardie A, Claas ECJ, Simmonds P, Templeton KE. Epidemiology and Clinical Presentations of the Four Human Coronaviruses 229E, HKU1, NL63, and OC43 Detected over 3 Years Using a Novel Multiplex Real-Time PCR Method. J Clin Microbiol. 2010;48:2940–7. doi: 10.1128/JCM.00636-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Ren L, Gonzalez R, Xu J, Xiao Y, Li Y, et al. Prevalence of Human Coronaviruses in Adults With Acute Respiratory Tract Infections in Beijing, China. J Med Virol. 2011;83:291–7. doi: 10.1002/jmv.21956. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Druce J, Tran T, Kelly H, Kaye M, Chibo D, et al. Laboratory Diagnosis and Surveillance of Human Respiratory Viruses by PCR in Victoria, Australia, 2002–2003. J Med Virol. 2005;75:122–9. doi: 10.1002/jmv.20246. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Yu X, Lu R, Wang Z, Zhu N, Wang W, et al. Etiology and clinical characterization of respiratory virus infections in adult patients attending an emergency department in Beijing. PLoS One. 2012;7(2):e32174. doi: 10.1371/journal.pone.0032174. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Mackay IM, Jacob KC, Woolhouse D, Waller K, Syrmis MW, et al. Molecular assays for detection of human metapneumovirus. J Clin Microbiol. 2003;41:100–5. doi: 10.1128/JCM.41.1.100-105.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Manning A, Russell V, Eastick K, Leadbetter GH, Hallam N, et al. Epidemiological profil and clinical associations of human bocavirus and other human parvoviruses. J Infect Dis. 2006;194:1283–90. doi: 10.1086/508219. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Lau SK, Woo PC, Yip CC, Tse H, Tsoi HW, et al. Coronavirus HKU1 and other coronavirus infections in Hong Kong. J Clin Microbiol. 2006;44:2063–71. doi: 10.1128/JCM.02614-05. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Vabret A, Dina J, Gouarin S, Petitjean J, Tripey V, et al. Human (non-severe acute respiratory syndrome) coronavirus infections in hospitalized children in France. J Paediatr Child Health. 2007;44:176–81. doi: 10.1111/j.1440-1754.2007.01246.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Kuypers J, Martin ET, Heugel J, Wright N, Morrow R, et al. Clinical disease in children associated with newly described coronavirus subtypes. Pediatrics. 2007;119:e70–6. doi: 10.1542/peds.2006-1406. [DOI] [PubMed] [Google Scholar]
  • 32.Risku M, Lappalainen S, Rasanen S, Vesikari T. Detection of human coronaviruses in children with acute gastroenteritis. J Clin Virol. 2010;48:27–30. doi: 10.1016/j.jcv.2010.02.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Garbino J, Crespo S, Aubert JD, Rochat T, Ninet B, et al. (2006 ) A prospective hospital-based study of the clinical impact of non-severe acute respiratory syndrome (Non-SARS)-related human coronavirus infection. Clin Infect Dis. 43(8):1009–15. doi: 10.1086/507898. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Shao X, Guo X, Esper F, Weibel C, Kahn JS. Seroepidemiology of group I human coronaviruses in children. J Clin Virol. 2007;40:207–1. doi: 10.1016/j.jcv.2007.08.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Bellei N, Carraro E, Perosa A, Watanabe A, Arruda E, et al. Acute respiratory infection and influenza-like illness viral etiologies in Brazilian adults. J Med Virol. 2008;80:1824–7. doi: 10.1002/jmv.21295. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Heikkinen T, Jarvinen A. The common cold. Lancet. 2003;361:51–59. doi: 10.1016/S0140-6736(03)12162-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Mahony JB, Petrich A, Smieja M. Molecular diagnosis of respiratory virus infections. Crit Rev Clin Lab Sci. 2011;48(5–6):217–49. doi: 10.3109/10408363.2011.640976. [DOI] [PubMed] [Google Scholar]
  • 38.Pyrc K, Stożek K, Wojcik K, Gawron K, Zeglen S, et al. Use of sensitive, broad-spectrum molecular assays and human airway epithelium cultures for detection of respiratory pathogens. PLoS One. 2012;7(3):e32582. doi: 10.1371/journal.pone.0032582. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES