Abstract
Purpose
To identify the underlying genetic causes of fundus albipunctatus (FA), a rare form of congenital stationary night blindness that is characterized by the presence of white dots in the midperiphery of the retina and delayed dark adaptation, in Pakistan.
Methods
Two families with FA were identified by fundus examination, and genome-wide single nucleotide polymorphism genotyping was performed for two individuals from family A and six individuals from family B. Genotyping data were subsequently used to identify the identical homozygous regions present in the affected individuals of both families using the online homozygosity mapping tool Homozygosity Mapper. Candidate genes selected from the homozygous regions were sequenced.
Results
Three identical homozygous regions were identified in affected persons of family A (on chromosomes 8, 10, and 12), whereas a single shared homozygous region on chromosome 12 was found in family B. In both families, the homozygous region on chromosome 12 harbored the retinol dehydrogenase 5 (RDH5) gene, in which mutations are known to be causative of FA. RDH5 sequence analysis revealed a novel five base pair deletion, c.913_917delGTGCT (p.Val305Hisfs*29), in family A, and a novel missense mutation, c.758T>G (p.Met253Arg), in family B.
Conclusions
We identified two novel disease-causing RDH5 mutations in Pakistani families with FA, which will improve diagnosis and genetic counseling, and may even lead to treatment of this disease in these families.
Introduction
Fundus albipunctatus (FA; OMIM:136880), or flecked retina disease, was described for the first time by Lauber [1]. FA is a rare form of congenital stationary night blindness and is characterized by the presence of typical white dots on the whole fundus or concentrated in the midperipheral region of the retina, with or without macular involvement, and a delay in dark adaptation. The inheritance pattern of FA is autosomal recessive [2-5]. In one family, a male and his two daughters showed FA, which could be due to autosomal dominant or pseudodominant (i.e., autosomal recessive) inheritance [6]. Mutations in three genes–retinol dehydrogenase 5 (RDH5), retinaldehyde-binding protein 1 (RLBP1), and retinal pigment epithelium–specific protein (RPE65)–are known to be associated with FA [7-10]. Retinitis punctata albescens has similar phenotypic characteristics but is progressive in nature and is mostly caused by mutations in RLBP1 [8].
FA-causing mutations were first identified in RDH5, which is expressed predominantly in the retinal pigment epithelium (RPE) [7]. RDH5 encodes an enzyme that is part of the visual cycle, which involves a series of specialized enzymes and retinoid binding proteins that are essential for the regeneration of the 11-cis retinal chromophore [11-14]. RDH5 consists of 318 amino acids and is highly conserved among different species [15]. Within the RPE cells, RDH5 resides in the smooth endoplasmic reticulum [16] where it is principally involved in chromophore regeneration by catalyzing the final step in the biosynthesis of 11-cis retinal [7,17-20].
The current study explores the molecular mechanisms behind FA in Pakistani families, using high-density single nucleotide polymorphism (SNP) microarrays and sequence analysis of known FA genes located in the identified homozygous regions. Using this approach, we identified two novel mutations in RDH5 in two families with FA.
Methods
Approval of the study
Approval for this study was granted by the Ethics Committee/Institutional Review Board of Shifa College of Medicine/Shifa International Hospital, Islamabad. Signed informed consent was obtained from members of both families participating in the current study.
Family collection and clinical evaluation
Families A and B (Figure 1) reside in remote areas of Pakistan and were part of a cohort of 83 families with retinitis pigmentosa and associated retinal diseases. Blood samples were collected from affected and normal individuals of both families and DNA was extracted by a standard protocol [21]. Pedigrees were drawn using Haplopainter [22]. Both families were clinically evaluated by fundus examination; in addition, electroretinography (ERG) measurements were recorded for family A.
Figure 1.
Pedigrees and sequencing results. A: Segregation of the mutation in family A. B: Segregation of the mutation in family B. C and D: Sequence electropherograms of affected individuals carrying homozygous variants (upper panels) and unaffected heterozygous carriers (middle panels) of families A (C) and B (D), along with the results of a control individual (wild-type [wt], lower panels). Arrows point to the probands; individuals tested with single nucleotide polymorphism (SNP) microarrays are indicated with asterisks.
Homozygosity mapping analysis
All affected individuals from both families and one healthy person from family B were subjected to high-density HumanOmniExpress (>700 K; Illumina Inc., San Diego, CA) single nucleotide polymorphism (SNP) microarray analysis. Genotyping data were analyzed with the online tool Homozygosity Mapper [23]. Haplotypes of affected and normal individuals were compared in each family to identify the identical homozygous regions shared by all affected individuals.
Primer design and RDH5 sequence analysis
The online tool Primer3 [24] was used to design PCR primers (Table 1). The five exons of RDH5, including their flanking exon-intron boundaries, were amplified by PCR using standard conditions and reagents. PCR-amplified exonic fragments were electrophoretically separated on 2% agarose gels containing ethidium bromide and DNA bands were visualized under ultraviolet transillumination. PCR clean-up purification plates (NucleoFast® 96 PCR; Cat. No. 743100.10, Macherey-Nagel, Düren, Germany) were used to purify the amplified fragments according to the manufacturer’s protocol. Briefly, 20 µl of each amplified PCR product was transferred to Nucleofast 96 PCR plate. Wells were filled up to 100 µl volume with RNase-free water to ensure the uniform loading. Contaminants were removed by ultrafilteration with the help of a vacuum apparatus for 10 min. Thirty µl of RNase-free water was poured in each well and DNA was recovered by thorough mixing with a multi-channel pipette. Sanger sequencing was then performed with Big Dye Terminator version 3 and analyzed on a 3730 DNA analyzer (Applied Biosystems, Inc., Foster City, CA).
Table 1. Primer sequences of RDH5.
| Exon | Forward primer (5′-3′) | Reverse primer (5′-3′) | Amplified fragment length (bp) |
|---|---|---|---|
| 1 |
CTAGGCAAATCTGGCCTCTG |
GGTCCACCTCAGAGTTGTGG |
396 |
| 2 |
GGAAAGGGCTTGAGGGC |
GACTGTGGGGATCAGGACAC |
450 |
| 3 |
CTCCCAGGAAGAAGAGGGAG |
CACCTCTGCTGGCCCAC |
399 |
| 4 |
ATGTCCCTCAAAGTCCCCTC |
AGGCTTATGCAGGACTGGC |
301 |
| 5 | GGCCCCAGAAGACAGTACC | CGTGCAGCTGTAGATGTGAG | 589 |
Vector NTI Advance (TM) 2011 software from Invitrogen Corporation (Carlsbad, CA) was used to analyze the sequencing results of RDH5 exons.
In silico analysis
Sorting Intolerant from Tolerant (SIFT), Polymorphism Phenotyping v2 (Polyphen-2), and Mutation Taster [25] were used to assess the possible pathological nature of the missense variant identified in this study. Project HOPE [26] was used to analyze and predict the structural variations in mutant RDH5.
Amino acid conservation
RDH5 protein sequences from different species including human (H. sapiens, ENSP00000257895), macaque (M. mulatta, ENSMMUP00000017380), mouse (M. musculus, ENSMUSP00000026406), dog (C. familiaris, ENSCAFP00000000084), cow (B. taurus, ENSBTAP00000056512), cat (F. catus, ENSFCAP00000012945), tetraodon (T. nigroviridis, ENSTNIP00000022889), and round worm (C. elegans, F35B12.2) were aligned using Vector NTI Advance™ 2011 to check the evolutionary conservation of the substituted amino acid in RDH5.
Results
Clinical studies
Initial symptoms of visual complaints in patients from both families were observed from early childhood. Fundus examination of affected individuals revealed the presence of white dots typical of FA in the midperiphery of the retina (Figure 2; Table 2). ERG responses of cone and rod photoreceptors were diminished in affected individual IV-1 of family A (Table 3). This individual had daytime vision problems, which confirms that cone photoreceptors were also affected. Macular degeneration was also observed in individual IV-1 of family A and individual IV-7 of family B. ERG results were not available for family B. The visual acuity (VA) of affected individual IV-7 of family B was different from the VAs of other individuals (VI-2, VI-3) of this family, and the density of white dots was also variable, which indicates intrafamilial phenotypic variability. Affected individuals of family B had normal daytime vision.
Figure 2.
Fundus photographs of affected individuals from both families. A, B: Right and left eye, respectively, of affected individual IV-1 of family A (see arrow, Figure 1A). C, D: Right and left eye, respectively, of affected individual IV-7 of family B (see arrow, Figure 1B). E, F: Right and left eye, respectively, of affected individual VI-2 of family B. G, H: Right and left eye, respectively, of affected individual VI-3 of family B.
Table 2. Clinical features of affected individuals in both families.
| Individual | Age (years) | VA (RE, LE) | Fundus phenotype | RPE degeneration | Retinoscopy |
|---|---|---|---|---|---|
| Family A, IV-1 |
35 |
6/12, 6/12 |
White dots, macular degenerative changes |
Yes |
Not determined |
| Family B, IV-7 |
45 |
6/18, 6/12 |
White dots, macular degenerative changes |
Yes |
Hypermetropia |
| Family B, VI-2 |
17 |
6/6, 6/6 |
White dots, macula healthy |
No |
Low hypermetropia |
| Family B, VI-3 | 10 | 6/6, 6/6 | White dots, macula healthy | No | Low hypermetropia |
LE, left eye; RE, right eye; RPE, retinal pigment epithilium; VA, visual acuity.
Table 3. ERG responses of affected individual IV-1 of Family A in comparison with ERG responses of a control individual.
| Measured parameters using monopolar electrodes | Adaptation | Flash strength (cd•s/m2) | Proband family A | Control | Normal values (Age=40 years) |
|---|---|---|---|---|---|
| Scotopic 25 dB b-wave amplitude (µV) |
Dark |
0.01 |
45.1 |
173.20 |
>141 |
| Scotopic 0 dB b-wave amplitude (µV) |
Dark |
3.0 |
149.1 |
496.80 |
>387 |
| Oscillatory potential amplitude (µV) |
Dark |
3.0 |
80.3 |
123.90 |
>75 |
| Photopic 0 dB b-wave amplitude (µV) |
Light |
3.0 |
70.7 |
80.80 |
>82 |
| Photopic 30 Hz flicker amplitude (µV) | Light | 3.0 | 49.5 | 55.90 | >56 |
Age of affected individual at the time of investigation was 35 years.
Genetic studies
In family A, three homozygous regions were identified that were shared by the affected persons (Figure 3A). The largest homozygous region spanned 24.5 Mb (hg19: 3.3–27.8 Mb; flanked by SNPs rs4881131 and rs10764698) on chromosome 10. The second and third homozygous regions were 10.5 Mb (hg19: 46.4–56.9 Mb; flanked by rs11183300 and rs7314300) and 8.1 Mb (hg19: 25.9–34.0 Mb; flanked by rs9521585 and rs9555687) in length, and were located on chromosomes 12 and 8, respectively. The second largest region (10.5 Mb) on chromosome 12 harbored the FA-associated gene RDH5. RDH5 sequence analysis identified a novel homozygous 5 bp deletion (c.913_917delGTGCT; p.Val305Hisfs*29) in family A (Figure 1C).
Figure 3.
Homozygosity mapping results. A: Plot of homozygous regions identified in affected individuals in family A using Homozygosity Mapper analysis. B: Plot of homozygous regions identified in affected individuals in family B using Homozygosity Mapper analysis. The red lines indicate homozygous regions shared by affected individuals in each family. The arrows indicate the homozygous regions that harbor RDH5.
The mutation c.913_917delGTGCT (p.Val305Hisfs*29) segregated in family A (Figure 1A) was consistent with an autosomal recessive inheritance pattern. Both affected individuals carried this mutation in a homozygous state, while both parents and an unaffected brother carried this variant heterozygously. The mutation causes a frameshift in the open reading frame and results in the replacement of the last 14 amino acids of the RDH5 protein by 28 aberrant amino acids. This mutation is predicted to affect part of the transmembrane domain and elongate the cytosolic C-terminal tail. As this deletion is located in the last exon of RDH5, nonsense-mediated decay of the mutant mRNA is not predicted.
In family B homozygosity mapping revealed an 8.9 Mb (hg19: 52.6–61.5 Mb) homozygous segment (Figure 3B) flanked by SNPs rs1894035 and rs1395538, encompassing the RDH5 gene. RDH5 sequence analysis revealed a novel homozygous missense mutation (c.758T>G; p.Met253Arg) in this family. Segregation analysis confirmed that all affected individuals were homozygous for the mutation c.758T>G (p.Met253Arg; Figure 1B), suggesting that this variant may be disease causing. The methionine at position 253 is a highly conserved amino acid residue among different species (Figure 4), and c.758T is an evolutionarily highly conserved nucleotide with a phyloP score of 4.40. SIFT predicted p.Met253Arg to be a deleterious (score: 0.05) mutation, Polyphen classified this mutation as probably damaging (score: 0.992), and Mutation Taster predicted this mutation to be disease causing. Structural analysis showed that there was a difference in charge and size of the wild-type Met253 and the mutant Arg253. The wild-type residue is uncharged, whereas the mutant residue is positively charged. The wild-type residue is buried in the alpha helix and the mutant residue introduces a charge in this buried residue in the core of the protein or protein complex, which can lead to misfolding of the protein. The mutant residue is bigger and probably will not fit in the core of the protein. The hydrophobicities of the wild-type and mutant residue also differ, and therefore, this mutation is likely to cause the loss of hydrophobic interactions in the core of the protein.
Figure 4.
Amino acid conservation of amino acids 245–260 of RDH5 in different species. Gray shading indicates amino acids that are identical to human RDH5 amino acids.
Ethnically matched control samples were not tested for these mutations; however, neither variant was found in dbSNP nor in 1000 Genomes.
Discussion
In this study, we have identified two novel disease-causing mutations in RDH5 in two unrelated consanguineous families with FA. Both families exhibited typical FA, as was evident from the presence of typical white dots in the midperipheral regions of the retina. In both families, the older patients–IV-1 in family A and IV-7 in family B–had macular degeneration, which might suggest a progressive disease course in these families.
Including our findings, 36 different mutations in RDH5 associated with FA have been identified to date [7,27-48]. FA patients carrying RDH5 mutations exhibit high phenotypic variability, ranging from nonprogressive to progressive disease, a variable VA, variation in the density of white dots, and occasionally macular involvement. FA with or without cone dystrophy has also been reported with varying degrees of severity [30,37,48]. A total of 85 FA patients from 68 different families carrying RDH5 mutations have been identified globally (Table 4, Table 5, and Table 6). These persons were found to exhibit a high variability in phenotype, but the presence of white dots was a common feature. In comparing the different phenotypes and genotypes associated with RDH5, it is difficult to establish a valid and clear-cut genotype-phenotype correlation.
Table 4. RDH5 mutations causing fundus albipunctatus.
| Exon/Intron | Mutations: Allele 1 | Mutations: Allele 2 | Phenotype | Families | Cases | Reference |
|---|---|---|---|---|---|---|
| Exon 2 |
c.55A>G (p.Arg19Gly) |
wt |
DWD |
1 |
1 |
[48] |
| Exon 2, 4 |
c.95delT (p.Phe32Serfs*29) |
c.712G>T (p.Gly238Trp) |
WD, MA |
1 |
1 |
[47] |
| Exon 2, 3 |
c.98T>A (p.Ile33Asn) |
c.469C>T (p.Arg157Trp) |
WD |
1 |
1 |
[39] |
| Exon 2, 4 |
c.98T>C (p.Ile33Thr) |
c.712G>T (p.Gly238Trp) |
DWD, RPED |
1 |
1 |
[48] |
| Exon 2 |
c.103G>A (p.Gly35Ser) |
c.103G>A (p.Gly35Ser) |
WD, CD, BE |
1, 1, 1 |
2, 1, 1 |
[30,32,37,46] |
| Exon 2, 5 |
c.103G>A (p.Gly35Ser) |
c.928delinsGAAG (p.Leu310delinsEV) |
WD |
1, 2 |
1, 2 |
[30,37,41] |
| Exon 2, 5 |
c.124C>T (p.Arg42Cys) |
c.928delinsGAAG (p.Leu310delinsEV) |
WD |
1 |
1 |
[41] |
| Exon 2 |
c.129delT (p.Leu44Trpfs*17) |
c.129delT (p.Leu44Trpfs*17) |
WD |
1 |
1 |
[33] |
| Exon 2, 5 |
c.211_214dupGTGG (p.Ala72Glyfs*15) |
c.801C>G (p.Cys267Trp) |
WD |
1 |
1 |
[33] |
| Exon 2, 4 |
c.218C>T (p.Ser73Phe) |
c.712G>T (p.Gly238Trp) |
WD |
1 |
1 |
[7] |
| Intron 2, 4 |
c.310+1G>A (Splice defect) |
c.712G>T (p.Gly238Trp) |
DWD |
1 |
1 |
[48] |
| Exon 3 |
c.319G>C (p.Gly107Arg) |
c.319G>C (p.Gly107Arg) |
WD, MD, SRP |
1, 1 |
2, 1 |
[35,40] |
| Exon 3, 5 | c.319G>C (p.Gly107Arg) | c.928delinsGAAG (p.Leu310delinsEV) | WD, BE | 1 | 1 | [30] |
BE, bull’s eye; CD, cone dystrophy; DWD, deep whitish dots; MA, macular atrophy; MD, macular dystrophy; RPED, retinal pigment epithilium degeneration; SRP, sectorial retinitis pigmentosa; WD, white dots.
Table 5. RDH5 mutations causing fundus albipunctatus (cont.).
| Exon/intron | Mutations: Allele 1 | Mutations: Allele 2 | Phenotype | Families | Cases | Reference |
|---|---|---|---|---|---|---|
| Exon 3 |
c.346_347insGCA (p.Gly116_Ile117insSer) |
c.346_347insGCA (p.Gly116_Ile117insSer) |
DWD, RPED |
1 |
1 |
[48] |
| Exon 3, 4 |
c.346G>C (p.Gly116Arg) |
c.710A>C (p.Tyr237Ser) |
NWD |
1 |
1 |
[48] |
| Exon 3 |
c.382G>A (p.Asp128Asn) |
c.382G>A (p.Asp128Asn) |
WD |
1 |
1 |
[47] |
| Exon 3, 4 |
c.382G>A (p.Asp128Asn) |
c.712G>T (p.Gly238Trp) |
WD |
1 |
1 |
[43] |
| Exon 3, 5 |
c.394G>A (p.Val132Met) |
c.839G>A (p.Arg280His) |
WD, CD, MD |
1, 1, 3 |
1, 2, 3 |
[30,37,38,41] |
| Exon 3, 5 |
c.416G>T (p.Gly139Val) |
c.955T>C (p.*319Argext*33) |
DWD, RPED |
1 |
1 |
[48] |
| Exon 3 |
c.470G>A (p.Arg157Gln) |
c.470G>A (p.Arg157Gln) |
DWD, RPED |
1 |
1 |
[48] |
| Exon 3, 4 |
c.470G>A (p.Arg157Gln) |
c.712G>T (p.Gly238Trp) |
WD |
1 |
1 |
[45] |
| Exon 3 |
c.490G>T (p.Val164Phe) |
c.490G>T (p.Val164Phe) |
WD, MA |
1 |
1 |
[36] |
| Exon 3, 5 |
c.530T>G (p.Val177Gly) |
c.839G>A (p. Arg280His) |
WD |
1 |
1 |
[29] |
| Exon 3, 5 |
c.530T>G (p.Val177Gly) |
c.928_930delinsGAAGTT (p.Leu310delinsEV) |
WF |
1 |
1 |
[42] |
| Exon 4 |
c.625C>T (p.Arg209*) |
c.625C>T (p.Arg209*) |
WD |
1 |
1 |
[47] |
| Exon 4, 5 | c.689_690delinsGG (p.Pro230Arg) | c.928delinsGAAG (p.Leu310delinsEV) | WD | 1 | 1 | [44] |
CD, cone dystrophy; DWD, deep whitish dots; MA, macular atrophy; MD, macular dystrophy; NWD, no white dots; RPED, retinal pigment epithilium degeneration; WD, white dots; WF, white flecks.
Table 6. RDH5 mutations causing fundus albipunctatus (cont.).
| Exon/intron | Mutations: Allele 1 | Mutations: Allele 2 | Phenotype | Families | Cases | Reference |
|---|---|---|---|---|---|---|
| Exon 4 |
c.712G>T (p.Gly238Trp) |
c.712G>T (p.Gly238Trp) |
WD, DWD, DWF |
1, 1 |
2, 2, 1 |
[7,27,48] |
| Exon 4, 5 |
c.718dupG (p.Ala240Glyfs*19) |
c.841T>C (p.Tyr281His) |
WD, BE, MD |
1, 1 |
1, 1 |
[30,41] |
|
Exon 5 |
c.758T>G (p.Met253Arg) |
c.758T>G (p.Met253Arg) |
WD, MD |
1 |
5 |
This study |
| Exon 5 |
c.791T>G (p.Val264Gly) |
c.791T>G (p.Val264Gly) |
WD |
1 |
3 |
[28] |
| Exon 5 |
c.824_825del (p.Arg275Profs*60) |
c.824_825del (p.Arg275Profs*60) |
DWD, DWF, RPED |
1 |
1 |
[48] |
| Exon 5 |
c.839G>A (p. Arg280His) |
c.880G>C (p.Ala294Pro) |
WD, MD |
1 |
2 |
[27] |
| Exon 5 |
c.839G>A (p.Arg280His) |
c.928delinsGAAG (p.Leu310delinsEV) |
WD |
1, 1, 2 |
1, 1, 2 |
[30,37,40,41] |
| Exon 5 |
c.841T>C (p.Tyr281His) |
c.928delinsGAAG (p.Leu310delinsEV) |
WD, MD |
1, 1 |
1, 1 |
[34,41] |
| Exon 5 |
c.880G>C (p.Ala294Pro) |
c.880G>C (p.Ala294Pro) |
WD |
1 |
1 |
[47] |
|
Exon 5 |
c.913_917delGTGCT (p.Val305Hisfs*29) |
c.913_917delGTGCT (p.Val305Hisfs*29) |
WD, MD |
1 |
2 |
This study |
| Exon 5 | c.928delinsGAAG (p.Leu310delinsEV) | c.928delinsGAAG (p.Leu310delinsEV) | WD, BE, PP | 1, 4, 1, 1, 4, 6 | 1, 4, 2, 1, 6, 6 | [28,30,31,37,41] |
BE, bull’s eye; DWD, deep whitish dots; DWF, deep whitish flecks; MD, macular dystrophy; PP, photophobia; RPED, retinal pigment epithilium degeneration; WD, white dots. Mutations identified in this study are in bold.
RDH5 is a transmembrane enzyme with a membrane-embedded N-terminal domain, a catalytic ectodomain, a C-terminal transmembrane domain, and a cytosolic tail [16]. The topology of retinol dehydrogenases has been controversial as human retinal reductase 1 [49] and mouse retinol dehydrogenase 1 [50] have been reported to have a membrane-embedded N-terminal domain but no C-terminal transmembrane segment, which supports the presence of a cytosolic ectodomain. RDH5 was suggested to have a cytosolic ectodomain without any C-terminal transmembrane domain [50]. However, another retinol dehydrogenase, cis-retinol/androgen dehydrogenase 1 (CRAD1), has been described in detail to have a RDH5-like structure with both a luminal ectodomain and cytosolic C-terminal domain, and a similar topology has been suggested for most of the retinol dehydrogenases [51]. The frameshift mutation p.Val305Hisfs*29 identified in family A is located in the C-terminal transmembrane domain, while the missense mutation p.Met253Arg is located in the catalytic ectodomain of RDH5 (Figure 5). As the C-terminal transmembrane region is necessary to retain CRAD1 in the endoplasmic reticulum [51], the RDH5 mutation p.Val305Hisfs*29 might affect the endoplasmic reticulum localization of RDH5. Moreover, an elongated C-terminal cytosolic tail might also create problems in the proper functioning of RDH5, as the C-terminus is thought to play a role in enzymatic activity and localization of CRAD1 and RDH5 [51].
Figure 5.
Schematic representation of RDH5 and all mutations thus far published. The membrane-embedded N-terminus consists of 18 amino acids and the ectodomain, present in the lumen of the smooth endoplasmic reticulum (SER), spans amino acids 19–288. A C-terminal membrane-spanning domain encompasses amino acids 289–310, and a small cytosolic tail of eight amino acids resides in the cytosol of retinal pigment epithelium (RPE) cells. Both missense and protein-truncating mutations are distributed across the entire protein. Mutations identified in this study are indicated in red.
Structural analysis of RDH5 performed with Project HOPE suggests that the missense mutation p.Met253Arg may cause misfolding of the RDH5 protein because of the loss of hydrophobic interactions in the core of the mutant protein. Misfolding of the mutant protein may cause it to degrade [52-54]. Absence of RDH5 leads to the accumulation of 11-cis retinol [20] in the RPE, and a reduction of 11-cis retinal in the photoreceptors, which in turn might result in the malfunctioning of rod and cone photoreceptor cells.
RDH5-associated disease can be prevented with proper genetic counseling of carriers of RDH5 mutations, and persons with this disease can be treated with 9-cis-β-carotene supplementation. Rdh−/− mice were successfully treated with 9-cis retinal [55], and 9-cis-β-carotene was given to FA patients leading to major visual improvements [56]; 9-cis-β-carotene is converted to 9-cis retinal [57,58], which is more stable than 11-cis retinal [59]. The higher stability of opsin bound to 9-cis retinal slows down the visual cascade and thus minimizes the toxicity of accumulating by-products in the visual cycle [55,60,61]. In the rod-photoreceptor outer segments 9-cis retinol will be converted to all-trans retinal during bleaching. This is subsequently reduced to all-trans retinol and, in the RPE, all-trans retinol is isomerically converted to 9-cis, 11-cis, and 13-cis retinol. A stereospecific enzyme, 9-cis retinol dehydrogenase, is reported to be involved in the synthesis of 9-cis retinoic acid by oxidizing 9-cis retinol [62], and 9-cis retinal treatment is suggested to induce the endogenous synthesis of 11-cis retinal by its interaction with the retinoid X nuclear receptor [56,59,63].
Based on our and other studies, we estimate that FA contributes to approximately 2% (4/208) of families with retinal dystrophy in Pakistan and a total of 17 patients have been identified with FA [9]. Two FA families have been reported to carry RLBP1 mutations [9], while two other families with FA have RDH5 mutations (this study). In the current study, we have identified seven additional FA patients who are candidates for 9-cis-β-carotene therapy.
In conclusion, we have identified two novel disease-causing mutations, c.913_917delGTGCT (p.Val305Hisfs*29) and c.758T>G (p.Met253Arg), in two Pakistani families with FA. Our study expands the current mutation spectrum of RDH5 and contributes to the existing body of knowledge. In addition, this study will help clinicians to improve the diagnosis of FA by differentiating FA from retinitis punctata albescens, providing genetic counseling and prescribing the correct treatment to patients.
Acknowledgments
We thank all participants of both families. The current study was supported by the Pakistan Academy of Sciences through grant no. PAS/I-9/Project awarded (to R.Q. and M.A.) and a core grant from the Shifa College of Medicine. We also acknowledge the Higher Education Commission of Pakistan for supporting M.A. by an IRSIP Scholarship, which enabled him to work at the Radboud University Nijmegen Medical Centre, Nijmegen, The Netherlands. This work was also financially supported by the Foundation Fighting Blindness, United States, the Stichting Nederlands Oogheelkundig Onderzoek, the Nelly Reef Foundation, the Stichting ter Verbetering van het Lot der Blinden (to F.P.M.C., R.W.J.C., and A.I.d.H.), the Rotterdamse Stichting Blindenbelangen, the Stichting Blindenhulp, the Stichting voor Ooglijders, the Stichting A.F. Deutman Researchfonds Oogheelkunde (to F.P.M.C. and M.I.K.), and the European Community's Seventh Framework Program FP7/2007–2013 under grant agreement no. 223143 (Project acronym TECHGENE, to H. Scheffer).
References
- 1.Lauber H. Die sogenannte Retinitis Punctata Albescens. Klin Monatsbl Augenheilkd. 1910;48:133–48. [Google Scholar]
- 2.Traboulsi EI, Leroy BP, Zeitz C. Congenital stationary night blindness. In: Traboulsi EI, editor. Genetic diseases of the eye. New York: Oxford University Press; 2012. p. 476–83. [Google Scholar]
- 3.Krill AE. Fleck retina diseases. In: Krill AE, Archer DB, editors. Hereditary retinal and choroidal diseases. Philadelphia: Harper and Row; 1977. p. 739–824. [Google Scholar]
- 4.Marmor MF. Long-term follow-up of the physiologic abnormalities and fundus changes in fundus albipunctatus. Ophthalmology. 1990;97:380–4. doi: 10.1016/s0161-6420(90)32577-0. [DOI] [PubMed] [Google Scholar]
- 5.Gass JDM. Stereoscopic atlas of macular diseases: diagnosis and treatment. 4th ed. St. Louis: Mosby; 1997. p. 350–1. [Google Scholar]
- 6.Kranias G, Augsburger JJ, Raymond LA. Resolution of night blindness in fundus albipunctatus. Ann Ophthalmol. 1981;13:871–4. [PubMed] [Google Scholar]
- 7.Yamamoto H, Simon A, Eriksson U, Harris E, Berson EL, Dryja TP. Mutations in the gene encoding 11-cis retinol dehydrogenase cause delayed dark adaptation and fundus albipunctatus. Nat Genet. 1999;22:188–91. doi: 10.1038/9707. [DOI] [PubMed] [Google Scholar]
- 8.Katsanis N, Shroyer NF, Lewis RA, Cavender JC, Al-Rajhi AA, Jabak M, Lupski JR. Fundus albipunctatus and retinitis punctata albescens in a pedigree with an R150Q mutation in RLBP1. Clin Genet. 2001;59:424–9. doi: 10.1034/j.1399-0004.2001.590607.x. [DOI] [PubMed] [Google Scholar]
- 9.Naz S, Ali S, Riazuddin SA, Farooq T, Butt NH, Zafar AU, Khan SN, Husnain T, MacDonald IM, Sieving PA, Hejtmancik JF, Riazuddin S. Mutations in RLBP1 associated with fundus albipunctatus in consanguineous Pakistani families. Br J Ophthalmol. 2011;95:1019–24. doi: 10.1136/bjo.2010.189076. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Schatz P, Preising M, Lorenz B, Sander B, Larsen M, Rosenberg T. Fundus albipunctatus associated with compound heterozygous mutations in RPE65. Ophthalmology. 2011;118:888–94. doi: 10.1016/j.ophtha.2010.09.005. [DOI] [PubMed] [Google Scholar]
- 11.Simon A, Hellman U, Wernstedt C, Eriksson U. The retinal pigment epithelial-specific 11-cis retinol dehydrogenase belongs to the family of short chain alcohol dehydrogenases. J Biol Chem. 1995;270:1107–12. [PubMed] [Google Scholar]
- 12.Okada T, Ernst OP, Palczewski K, Hofmann KP. Activation of rhodopsin: new insights from structural and biochemical studies. Trends Biochem Sci. 2001;26:318–24. doi: 10.1016/s0968-0004(01)01799-6. [DOI] [PubMed] [Google Scholar]
- 13.McBee JK, Palczewski K, Baehr W, Pepperberg DR. Confronting complexity: the interlink of phototransduction and retinoid metabolism in the vertebrate retina. Prog Retin Eye Res. 2001;20:469–529. doi: 10.1016/s1350-9462(01)00002-7. [DOI] [PubMed] [Google Scholar]
- 14.Parker RO, Crouch RK. Retinol dehydrogenases (RDHs) in the visual cycle. Exp Eye Res. 2010;91:788–92. doi: 10.1016/j.exer.2010.08.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Simon A, Lagercrantz J, Bajalica-Lagercrantz S, Eriksson U. Primary structure of human 11-cis retinol dehydrogenase and organization and chromosomal localization of the corresponding gene. Genomics. 1996;36:424–30. doi: 10.1006/geno.1996.0487. [DOI] [PubMed] [Google Scholar]
- 16.Simon A, Romert A, Gustafson AL, McCaffery JM, Eriksson U. Intracellular localization and membrane topology of 11-cis retinol dehydrogenase in the retinal pigment epithelium suggest a compartmentalized synthesis of 11-cis retinaldehyde. J Cell Sci. 1999;112:549–58. doi: 10.1242/jcs.112.4.549. [DOI] [PubMed] [Google Scholar]
- 17.Farjo KM, Moiseyev G, Takahashi Y, Crouch RK, Ma JX. The 11-cis-retinol dehydrogenase activity of RDH10 and its interaction with visual cycle proteins. Invest Ophthalmol Vis Sci. 2009;50:5089–97. doi: 10.1167/iovs.09-3797. [DOI] [PubMed] [Google Scholar]
- 18.Mata NL, Radu RA, Clemmons RC, Travis GH. Isomerization and oxidation of vitamin a in cone-dominant retinas: a novel pathway for visual-pigment regeneration in daylight. Neuron. 2002;36:69–80. doi: 10.1016/s0896-6273(02)00912-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Jang GF, Van Hooser JP, Kuksa V, McBee JK, He YG, Janssen JJM, Driessen CAGG, Palczewski K. Characterization of a dehydrogenase activity responsible for oxidation of 11-cis-retinol in the retinal pigment epithelium of mice with a disrupted RDH5 gene. A model for the human hereditary disease fundus albipunctatus. J Biol Chem. 2001;276:32456–65. doi: 10.1074/jbc.M104949200. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Driessen CAGG, Winkens HJ, Hoffmann K, Kuhlmann LD, Janssen BPM, Van Vugt AHM, Van Hooser JP, Wieringa BE, Deutman AF, Palczewski K, Ruether K, Janssen JJM. Disruption of the 11-cis-retinol dehydrogenase gene leads to accumulation of cis-retinols and cis-retinyl esters. Mol Cell Biol. 2000;20:4275–87. doi: 10.1128/mcb.20.12.4275-4287.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Sambrook J, Russell DW. The condensed protocols from Molecular cloning: a laboratory manual. Cold Spring Harbor (NY): Cold Spring Harbor Laboratory Press; 2006. [Google Scholar]
- 22.Thiele H, Nürnberg P. HaploPainter: a tool for drawing pedigrees with complex haplotypes. Bioinformatics. 2005;21:1730–2. doi: 10.1093/bioinformatics/bth488. [DOI] [PubMed] [Google Scholar]
- 23.Seelow D, Schuelke M, Hildebrandt F, Nurnberg P. HomozygosityMapper–an interactive approach to homozygosity mapping. Nucleic Acids Res. 2009;37:W593–9. doi: 10.1093/nar/gkp369. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Rozen S, Skaletsky H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol. 2000;132:365–86. doi: 10.1385/1-59259-192-2:365. [DOI] [PubMed] [Google Scholar]
- 25.Schwarz JM, Rodelsperger C, Schuelke M, Seelow D. MutationTaster evaluates disease-causing potential of sequence alterations. Nat Methods. 2010;7:575–6. doi: 10.1038/nmeth0810-575. [DOI] [PubMed] [Google Scholar]
- 26.Venselaar H, Te Beek TA, Kuipers RK, Hekkelman ML, Vriend G. Protein structure analysis of mutations causing inheritable diseases. An e-Science approach with life scientist friendly interfaces. BMC Bioinformatics. 2010;11:548. doi: 10.1186/1471-2105-11-548. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Gonzalez-Fernandez F, Kurz D, Bao Y, Newman S, Conway BP, Young JE, Han DP, Khani SC. 11-cis retinol dehydrogenase mutations as a major cause of the congenital night-blindness disorder known as fundus albipunctatus. Mol Vis. 1999;5:41. [PubMed] [Google Scholar]
- 28.Hirose E, Inoue Y, Morimura H, Okamoto N, Fukuda M, Yamamoto S, Fujikado T, Tano Y. Mutations in the 11-cis retinol dehydrogenase gene in Japanese patients with fundus albipunctatus. Invest Ophthalmol Vis Sci. 2000;41:3933–5. [PubMed] [Google Scholar]
- 29.Kuroiwa S, Kikuchi T, Yoshimura N. A novel compound heterozygous mutation in the RDH5 gene in a patient with fundus albipunctatus. Am J Ophthalmol. 2000;130:672–5. doi: 10.1016/s0002-9394(00)00765-0. [DOI] [PubMed] [Google Scholar]
- 30.Nakamura M, Hotta Y, Tanikawa A, Terasaki H, Miyake Y. A high association with cone dystrophy in fundus albipunctatus caused by mutations of the RDH5 gene. Invest Ophthalmol Vis Sci. 2000;41:3925–32. [PubMed] [Google Scholar]
- 31.Wada Y, Abe T, Fuse N, Tamai M. A frequent 1085delC/insGAAG mutation in the RDH5 gene in Japanese patients with fundus albipunctatus. Invest Ophthalmol Vis Sci. 2000;41:1894–7. [PubMed] [Google Scholar]
- 32.Wada Y, Abe T, Sato H, Tamai M. A novel Gly35Ser mutation in the RDH5 gene in a Japanese family with fundus albipunctatus associated with cone dystrophy. Arch Ophthalmol. 2001;119:1059–63. doi: 10.1001/archopht.119.7.1059. [DOI] [PubMed] [Google Scholar]
- 33.Driessen CAGG, Janssen BPM, Winkens HJ, Kuhlmann LD, Van Vugt AHM, Pinckers AJLG, Deutman AF, Janssen JJM. Null mutation in the human 11-cis retinol dehydrogenase gene associated with fundus albipunctatus. Ophthalmology. 2001;108:1479–84. doi: 10.1016/s0161-6420(01)00640-6. [DOI] [PubMed] [Google Scholar]
- 34.Nakamura M, Miyake Y. Macular dystrophy in a 9-year-old boy with fundus albipunctatus. Am J Ophthalmol. 2002;133:278–80. doi: 10.1016/s0002-9394(01)01304-6. [DOI] [PubMed] [Google Scholar]
- 35.Hotta K, Nakamura M, Kondo M, Ito S, Terasaki H, Miyake Y, Hida T. Macular dystrophy in a Japanese family with fundus albipunctatus. Am J Ophthalmol. 2003;135:917–9. doi: 10.1016/s0002-9394(02)02290-0. [DOI] [PubMed] [Google Scholar]
- 36.Yamamoto H, Yakushijin K, Kusuhara S, Escano MF, Nagai A, Negi A. A novel RDH5 gene mutation in a patient with fundus albipunctatus presenting with macular atrophy and fading white dots. Am J Ophthalmol. 2003;136:572–4. doi: 10.1016/s0002-9394(03)00332-5. [DOI] [PubMed] [Google Scholar]
- 37.Nakamura M, Skalet J, Miyake Y. RDH5 gene mutations and electroretinogram in fundus albipunctatus with or without macular dystrophy: RDH5 mutations and ERG in fundus albipunctatus. Doc Ophthalmol. 2003;107:3–11. doi: 10.1023/a:1024498826904. [DOI] [PubMed] [Google Scholar]
- 38.Nakamura M, Lin J, Miyake Y. Young monozygotic twin sisters with fundus albipunctatus and cone dystrophy. Arch Ophthalmol. 2004;122:1203–7. doi: 10.1001/archopht.122.8.1203. [DOI] [PubMed] [Google Scholar]
- 39.Rüther K, Janssen BPM, Kellner U, Janssen JJM, Bohne M, Reimann J, Driessen CAGG. Klinische und molecular-genetische Befunde bei einer Patientin mit Fundus Albipunctatus. Ophthalmologe. 2004;101:177–85. doi: 10.1007/s00347-003-0895-y. [DOI] [PubMed] [Google Scholar]
- 40.Sato M, Oshika T, Kaji Y, Nose H. A novel homozygous Gly107Arg mutation in the RDH5 gene in a Japanese patient with fundus albipunctatus with sectorial retinitis pigmentosa. Ophthalmic Res. 2004;36:43–50. doi: 10.1159/000076109. [DOI] [PubMed] [Google Scholar]
- 41.Niwa Y, Kondo M, Ueno S, Nakamura M, Terasaki H, Miyake Y. Cone and rod dysfunction in fundus albipunctatus with RDH5 mutation: an electrophysiological study. Invest Ophthalmol Vis Sci. 2005;46:1480–5. doi: 10.1167/iovs.04-0638. [DOI] [PubMed] [Google Scholar]
- 42.Hayashi T, Goto-Omoto S, Takeuchi T, Gekka T, Ueoka Y, Kitahara K. Compound heterozygous RDH5 mutations in familial fleck retina with night blindness. Acta Ophthalmol Scand. 2006;84:254–8. doi: 10.1111/j.1600-0420.2005.00575.x. [DOI] [PubMed] [Google Scholar]
- 43.Iannaccone A, Tedesco SA, Gallaher KT, Yamamoto H, Charles S, Dryja TP. Fundus albipunctatus in a 6-year old girl due to compound heterozygous mutations in the RDH5 gene. Doc Ophthalmol. 2007;115:111–6. doi: 10.1007/s10633-007-9054-0. [DOI] [PubMed] [Google Scholar]
- 44.Wang C, Nakanishi N, Ohishi K, Hikoya A, Koide K, Sato M, Nakamura M, Hotta Y, Minoshima S. Novel RDH5 mutation in family with mother having fundus albipunctatus and three children with retinitis pigmentosa. Ophthalmic Genet. 2008;29:29–32. doi: 10.1080/13816810701663535. [DOI] [PubMed] [Google Scholar]
- 45.Hajali M, Fishman GA, Dryja TP, Sweeney MO, Lindeman M. Diagnosis in a patient with fundus albipunctatus and atypical fundus changes. Doc Ophthalmol. 2009;118:233–8. doi: 10.1007/s10633-008-9151-8. [DOI] [PubMed] [Google Scholar]
- 46.Querques G, Carrillo P, Querques L, Bux AV, Del Curatolo MV, Delle NN. High-definition optical coherence tomographic visualization of photoreceptor layer and retinal flecks in fundus albipunctatus associated with cone dystrophy. Arch Ophthalmol. 2009;127:703–6. doi: 10.1001/archophthalmol.2009.87. [DOI] [PubMed] [Google Scholar]
- 47.Schatz P, Preising M, Lorenz B, Sander B, Larsen M, Eckstein C, Rosenberg T. Lack of autofluorescence in fundus albipunctatus associated with mutations in RDH5. Retina. 2010;30:1704–13. doi: 10.1097/IAE.0b013e3181dc050a. [DOI] [PubMed] [Google Scholar]
- 48.Sergouniotis PI, Sohn EH, Li Z, McBain VA, Wright GA, Moore AT, Robson AG, Holder GE, Webster AR. Phenotypic variability in RDH5 retinopathy (Fundus Albipunctatus). Ophthalmology. 2011;118:1661–70. doi: 10.1016/j.ophtha.2010.12.031. [DOI] [PubMed] [Google Scholar]
- 49.Belyaeva OV, Stetsenko AV, Nelson P, Kedishvili NY. Properties of short-chain dehydrogenase/reductase RalR1: characterization of purified enzyme, its orientation in the microsomal membrane, and distribution in human tissues and cell lines. Biochemistry. 2003;42:14838–45. doi: 10.1021/bi035288u. [DOI] [PubMed] [Google Scholar]
- 50.Zhang M, Hu P, Napoli JL. Elements in the N-terminal signaling sequence that determine cytosolic topology of short-chain dehydrogenases/reductases. Studies with retinol dehydrogenase type 1 and cis-retinol/androgen dehydrogenase type 1. J Biol Chem. 2004;279:51482–9. doi: 10.1074/jbc.M409051200. [DOI] [PubMed] [Google Scholar]
- 51.Lidén M, Tryggvason K, Eriksson U. The C-terminal region of cis-retinol/androgen dehydrogenase 1 (CRAD1) confers ER localization and in vivo enzymatic function. Exp Cell Res. 2005;311:205–17. doi: 10.1016/j.yexcr.2005.07.032. [DOI] [PubMed] [Google Scholar]
- 52.Kubota H. Quality control against misfolded proteins in the cytosol: a network for cell survival. J Biochem. 2009;146:609–16. doi: 10.1093/jb/mvp139. [DOI] [PubMed] [Google Scholar]
- 53.Zhang X, Qian SB. Chaperone-mediated hierarchical control in targeting misfolded proteins to aggresomes. Mol Biol Cell. 2011;22:3277–88. doi: 10.1091/mbc.E11-05-0388. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Chen B, Retzlaff M, Roos T, Frydman J. Cellular strategies of protein quality control. Cold Spring Harb Perspect Biol. 2011;3:a004374. doi: 10.1101/cshperspect.a004374. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Maeda A, Maeda T, Palczewski K. Improvement in rod and cone function in mouse model of Fundus albipunctatus after pharmacologic treatment with 9-cis-retinal. Invest Ophthalmol Vis Sci. 2006;47:4540–6. doi: 10.1167/iovs.06-0215. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Rotenstreich Y, Harats D, Shaish A, Pras E, Belkin M. Treatment of a retinal dystrophy, fundus albipunctatus, with oral 9-cis-β-carotene. Br J Ophthalmol. 2010;94:616–21. doi: 10.1136/bjo.2009.167049. [DOI] [PubMed] [Google Scholar]
- 57.Nagao A, Olson JA. Enzymatic formation of 9-cis, 13-cis, and all-trans retinals from isomers of beta-carotene. FASEB J. 1994;8:968–73. doi: 10.1096/fasebj.8.12.8088462. [DOI] [PubMed] [Google Scholar]
- 58.Hébuterne X, Wang XD, Johnson EJ, Krinsky NI, Russell RM. Intestinal absorption and metabolism of 9-cis-β-carotene in vivo: biosynthesis of 9-cis-retinoic acid. J Lipid Res. 1995;36:1264–73. [PubMed] [Google Scholar]
- 59.Urbach J, Rando RR. Isomerization of all-trans-retinoic acid to 9-cis-retinoic acid. Biochem J. 1994;299:459–65. doi: 10.1042/bj2990459. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Radu RA, Mata NL, Nusinowitz S, Liu X, Sieving PA, Travis GH. Treatment with isotretinoin inhibits lipofuscin accumulation in a mouse model of recessive Stargardt's macular degeneration. Proc Natl Acad Sci USA. 2003;100:4742–7. doi: 10.1073/pnas.0737855100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Radu RA, Han Y, Bui TV, Nusinowitz S, Bok D, Lichter J, Widder K, Travis GH, Mata NL. Reductions in serum vitamin A arrest accumulation of toxic retinal fluorophores: a potential therapy for treatment of lipofuscin-based retinal diseases. Invest Ophthalmol Vis Sci. 2005;46:4393–401. doi: 10.1167/iovs.05-0820. [DOI] [PubMed] [Google Scholar]
- 62.Mertz JR, Shang E, Piantedosi R, Wei S, Wolgemuth DJ, Blaner WS. Identification and characterization of a stereospecific human enzyme that catalyzes 9-cis-retinol oxidation. A possible role in 9-cis-retinoic acid formation. J Biol Chem. 1997;272:11744–9. doi: 10.1074/jbc.272.18.11744. [DOI] [PubMed] [Google Scholar]
- 63.Heyman RA, Mangelsdorf DJ, Dyck JA, Stein RB, Eichele G, Evans RM, Thaller C. 9-cis retinoic acid is a high affinity ligand for the retinoid X receptor. Cell. 1992;68:397–406. doi: 10.1016/0092-8674(92)90479-v. [DOI] [PubMed] [Google Scholar]