Regulatory T cells use programmed death 1 ligands to directly suppress autoreactive B cells in vivo

Abstract

The mechanisms by which regulatory T cells (T_regs) suppress autoantibody production are unclear. Here we have addressed this question using transgenic mice expressing model antigens in the kidney. We report that T_regs were essential and sufficient to suppress autoreactive B cells in an antigen-specific manner and to prevent them from producing autoantibodies. Most of this suppression was mediated through the inhibitory cell-surface-molecule programmed death-1 (PD-1). Suppression required PD-1 expression on autoreactive B cells and expression of the two PD-1 ligands on T_regs. PD-1 ligation inhibited activation of autoreactive B cells, suppressed their proliferation, and induced their apoptosis. Intermediate PD-1⁺ cells, such as T helper cells, were dispensable for suppression. These findings demonstrate in vivo that T_regs use PD-1 ligands to directly suppress autoreactive B cells, and they identify a previously undescribed peripheral B-cell tolerance mechanism against tissue autoantigens.

Autoantibodies (auto-Ab) cause various autoimmune diseases, such as systemic lupus erythematosus and certain forms of glomerulonephritis. Depletion of autoreactive B cells ameliorates many, but not all, autoimmune diseases. However, this approach causes severe immunosuppression due to the general loss of B cells. Specific control of autoreactive B cells is required for improved therapies.

Regulatory T cells (T_regs) are powerful suppressors of autoreactive T cells with high therapeutic potential (1–3). T_regs also suppress auto-Ab production (4, 5). We recently showed in vivo that they do so in an antigen-specific (Ag-specific) manner (6, 7). These studies used rat insulin promoter HEL/OVA (ROH) mice expressing ovalbumin (OVA) and hen egg lysozyme (HEL) in pancreatic islet β-cells. Autoreactive OVA- and HEL-specific B cells, but not B cells specific for a foreign antigen, failed to proliferate in response to in vivo autoantigen (auto-Ag) challenge and instead underwent apoptosis in a strictly T_reg-dependent fashion. T_regs can affect B cells indirectly by suppressing the T-helper (Th) cells required for antibody production (8, 9). This did not rule out that T_regs might also suppress B cells directly. Cell culture systems have revealed that CD25⁺ T_regs can kill cocultured B cells (10–12). A recent in vivo study showed that T_regs enter germinal centers and suppress B cells in this site (13, 14). The question whether this occurred directly or indirectly remained open (15). This question is difficult to address in vivo because it requires an experimental system where T_regs can suppress B cells but not Th cells.

Another open question concerns the molecular mechanisms by which T_regs suppress. In principle, T_regs may suppress other T cells by (i) secreting inhibitory mediators; (ii) deprivation of survival factors; (iii) killing target cells by granzyme/perforin; and (iv) modulation of DCs by ligating inhibitory T-cell receptors (16, 17). The exact contribution of these mechanisms in relevant in vivo situations and the mechanisms by which T_regs suppress are unclear.

Programmed death-1 (PD-1, CD279) is an activation-induced member of the extended CD28/CTLA-4 family that suppresses T cells (18–21). It has been associated with exhausted memory T cells in chronic viral infection (22, 23) and with cytotoxic T-cell cross-tolerance (24). PD-1 has two known ligands, PDL-1 (B7-H1, CD274) and PDL-2 (B7-DC, CD273) (25, 26), and both of them are sufficient to mediate T-cell suppression (27, 28). T_regs have been shown to express PDL-1, but such expression was dispensable for T-cell suppression in vitro (29). Also B cells specific for foreign antigens express PD-1 ligands and interact with follicular helper T cells known to express high levels of PD-1, resulting in increased germinal center B-cell survival and plasma cell differentiation (30). On the other hand, PD-1 knockout mice develop high levels of auto-Ab (31), which is hard to reconcile with a positive effect on antibody production. Thus, the role of PD-1 on B cells is unclear.

To address these open questions, we have used mice expressing OVA and HEL in kidney glomerular podocytes (32), which allow detailed studies in an organ where auto-Ab–mediated diseases are prevalent (33). We demonstrate direct suppression of B cells by T_regs and identify PD-1 signaling as the underlying mechanism.

Results

T_regs Specifically Suppress Auto-Ab Production Against Glomerular Auto-Ag.

To study how T_regs specifically suppress auto-Ab production against peripheral tissue antigens, we used transgenic mice expressing a membrane-bound fusion protein of OVA and HEL under the control of the nephrin promoter in kidney podocytes (NOH mice) (32). We used a vaccination scheme of applying OVA in aluminium hydroxide (Alum) three times (experimental scheme in Fig. 1A), which induced robust anti-OVA titers after 3 wk in nontransgenic wild-type (WT) control mice (6, 7). When we vaccinated NOH mice with this scheme, OVA-specific IgG antibody titers were sevenfold lower compared with WT mice (Fig. 1B), indicating immune tolerance. Consistent with our previous studies on pancreatic auto-Ag (6, 7), treatment with the antibody PC61 1 d before vaccination depleted about 90% of the FoxP3⁺ T_regs (Fig. S1) and restored anti-OVA antibody production in NOH mice to 85% of that in WT controls (Fig. 1B). Antibody production against the foreign antigen β-galactosidase (β-Gal) was unchanged in NOH and WT mice, and PC61 treatment had no effect either (Fig. 1C), demonstrating auto-Ag–specific suppression by T_regs. These findings indicate that T_regs prevent autoreactive B cells from producing anti-glomerular auto-Ab.

Fig. 1.

Blocking PD-1 restores Ag-specific auto-Ab titers in vivo. (A) Experimental scheme for B and C: mice were depleted of T_regs with PC61 Ab on days −4, −1, 6, and 13 (white arrows) and immunized with 10 μg OVA and 10 μg β-Gal in Alum on days 0, 7, and 14 (black arrows). (B and C) IgG titers against OVA (B) and β-Gal (C) in NOH (black bars) or nontransgenic wild-type (WT) control mice (white bars) after depletion of T_regs on day 21. (D) Experimental scheme for E and F: mice were depleted of T_regs with PC61 Ab on days −4 and −1 and immunized with OVA/Alum on day 0. (E and F) Percentage (E) and mean fluorescence intensity (MFI) (F) of PD-1⁺ OVA-specific B cells on day 3. (G) Experimental scheme for H and I: mice were immunized on days 0, 7, and 14 and injected with PD-1–blocking RMP1-14 or isotype control Abs on the same days. (H) Anti-OVA serum IgG titers on day 21 in WT mice (white bar), NOH mice (black bar), NOH mice treated with RMP1-14 (light gray bar), or with isotype control (dark gray bar). (I) Anti-NP titers on day 14 in NOH (black bars) or WT (white bars) mice immunized with either OVA-NP or BSA-NP in Alum. *P < 0.05; **P < 0.01; ***P < 0.001 (ANOVA and Bonferroni). Data are representative of two experiments using three to four mice in each group.

PD-1 Mediates Peripheral B-Cell Tolerance Against Glomerular Auto-Ag.

To identify candidate molecules for B-cell suppression, we isolated OVA-specific B cells (representative FACS plot in Fig. S2) from immunized NOH or WT mice and determined expression of molecules previously implicated in peripheral immune tolerance, such as PD-1 or Fas (11, 18, 34). OVA vaccination increased PD-1 mRNA expression in OVA-specific B cells of NOH mice stronger (3-fold) than in WT mice (1.7-fold) (Fig. S3A), whereas no such preferential up-regulation was seen for Fas (Fig. S3B). Flow cytometry confirmed selective PD-1 protein up-regulation by OVA-specific B cells from the spleens of OVA and β-Gal–immunized NOH mice, but not in non-OVA–specific or in β-Gal–specific B cells (Fig. S4 A–C). Both the proportion of PD-1⁺ B cells (Fig. 1E and Fig. S3C) and the amount of PD-1 per B cell (Fig. 1F and Fig. S3D) were increased. PD-1 was up-regulated per B cell by only 25% (Fig. S3D); nonetheless, this small increase was quantitatively comparable to functionally relevant increases seen in other models (35). In contrast to PD-1, the PD-1 ligands remained unchanged on OVA-specific B cells after immunization (Fig. S4 D and E). T_reg depletion prevented PD-1 up-regulation on OVA-specific B cells but had no influence on β-Gal–specific B cells (Fig. 1 E and F, black bars; Fig. S4 F and G), supporting a connection between T_reg-mediated B-cell suppression and PD-1.

To test this hypothesis, we injected the PD-1 blocking antibody RMP1-14 (18) into NOH mice immunized with OVA or β-Gal (experimental scheme in Fig. 1G). This indeed restored anti-OVA IgG antibody production in NOH mice to 75% of that in WT controls, whereas an isotype antibody control showed no such effect (Fig. 1H). Antibody levels against the foreign antigen β-Gal were unchanged (Fig. S5). The restoration of suppression was reminiscent of that seen after T_reg depletion, albeit slightly less effective (Fig. 1B), suggesting that B-cell suppression by T_regs at least partially occurred via PD-1.

In NOH mice, OVA-specific B cells are autoreactive and thus might have been functionally altered during their development by central tolerance mechanisms. To address this possibility, we immunized these mice with OVA-nitrophenol (NP) or BSA-NP as a control and determined the response of NP-specific B cells. Such B cells were not autoreactive yet still were controlled by OVA-specific Th cells or T_regs. NP-specific antibody serum titers in NOH mice were 2.8-fold lower than in WT control mice after immunization with OVA-NP, but were unchanged when mice were immunized with NP-BSA (Fig. 1I). When PD-1 was blocked, anti-NP titers were restored to 67% of those in WT controls, which was not significantly different (Fig. 1I), verifying that PD-1 did not operate during B-cell development. Thus, PD-1 mediates peripheral B-cell tolerance.

Autoreactive B Cells Require PD-1 for Being Suppressed in NOH Mice.

To study whether B cells required PD-1 to be suppressed in vivo, we wanted to create a situation where only B cells were PD-1–deficient by transferring PD-1–deficient autoreactive B cells into PD-1–competent NOH or WT recipient mice. To this end, we used transgenic B cells specific for HEL (IgHEL cells) that can be distinguished from wild-type B cells by their expression of IgM of the subtype a (IgMa). We had previously shown that these cells were deleted 3 d after transfer into ROH mice expressing HEL in pancreatic islets (7). Consistent with these findings, IgHEL cells were deleted also after transfer into NOH mice (but not into WT recipients), unless T_regs were depleted (experimental scheme in Fig. 2A, results in Fig. 2B). However, when we used PD-1–deficient IgHEL cells generated by crossing IgHEL mice to PD-1^−/− mice (IgHEL×PD-1^−/− cells, experimental scheme in Fig. 2C), their numbers were similar in NOH and WT recipient mouse groups (Fig. 2D), verifying that B-cell suppression depended on their expression of PD-1.

Fig. 2.

B cells need to express PD-1 to be suppressed by T_regs in NOH mice. (A) Experimental scheme: 5 × 10⁶ IgHEL were transferred into untreated or T_reg-depleted WT (white bars in B) or NOH mice (black bars in B), which were immunized with HEL in Alum on the next day. (B) Absolute numbers of surviving B220⁺ IgMa⁺ HEL⁺ IgHEL cells 3 d after adoptive transfer. (C) Experimental scheme for D–F: Either 5 × 10⁶ IgHEL or IgHEL×PD-1^−/− cells were transferred into WT (white bars in D–F) or NOH mice (black bars in D–F), which were immunized with HEL in Alum on the next day. (D) Absolute numbers of surviving B220⁺ IgMa⁺ HEL⁺ IgHEL cells 3 d after adoptive transfer. (E) Proportion of Ki67⁺ proliferating B220⁺ IgMa⁺ HEL⁺ IgHEL B cells. (F) Representative bar graph of cleaved caspase 3 expression on IgHEL B cells. *P < 0.05 (ANOVA and Bonferroni). Data are representative of two experiments with three mice in each group.

Previously, we showed that reduction of IgHEL cell numbers occurred both by inhibiting their proliferation and by inducing apoptosis (7). When we examined proliferation by intracellular Ki67 staining, IgHEL×PD-1^−/− cells proliferated equally well in NOH and WT mice, whereas WT IgHEL cells failed to divide in NOH mice (Fig. 2E). Also, induction of apoptosis measured by determining activated caspase 3 levels was prevented in IgHEL×PD-1^−/− cells, in contrast to PD-1–competent IgHEL cells (Fig. 2F). There were about 50% more apoptotic WT IgHEL cells after 3 d in NOH mice, and although this small increase was reproducible, it did not reach statistical significance (Fig. 2F). Taken together, these findings supported the view that T_regs suppressed B cells in vivo only when the latter expressed PD-1 and that inhibition of B-cell proliferation and also apoptosis induction were involved.

Ag-Specific T_regs Are Sufficient for Suppression of PD-1⁺ B Cells in Vivo.

Next we wondered whether T_regs might provide the PD-1 ligands that triggered PD-1 on B cells. We first demonstrated that T_regs expressed PDL-1/2 and up-regulated these ligands after immunization with autoantigen (Fig. S6 A–C). T-cell levels of PDL-2 were very small, consistent with previous studies (21), but up-regulated on T_regs from PDL-1–deficient mice (Fig. S6C), supporting the notion that PDL-2 becomes functionally relevant when PDL-1 is lacking (30). Expression of mRNA for other inhibitory molecules described as suppressive mediators of T_regs like FasL, granzyme B, or perforin remained unchanged between groups or showed a reduction compared with T_regs from WT mice (Fig. S7).

Studying the functional relevance of such PD-1 ligand expression was theoretically possible by adoptively transferring T_regs lacking such ligands. This, however, first required establishing that T_regs are able to suppress B cells after adoptive transfer because our previous studies had shown only that T_regs are essential, not that they are sufficient, for such suppression (6, 7). To this end, we isolated T_regs from NOH or WT mice and injected them into IgHEL mice before immunization (experimental scheme in Fig. 3A). On day 21, HEL-specific IgMa titers were reduced in those IgHEL mice that had received NOH T_regs, but not in recipients of NOH CD25^– T cells or of T_regs from WT mice (Fig. 3B). This demonstrated that Ag-specific T_regs are sufficient for in vivo suppression of B cells.

Fig. 3.

Ag-specific T_regs are sufficient for suppression of PD-1⁺ B cells in vivo. (A) Experimental scheme: 1 × 10⁶ T_regs or Th cells were transferred into IgHEL (B) or IgHELxPD-1^−/− (C) mice on day −1, which were then immunized on days 0, 7, and 14 with HEL in Alum i.p. (B) HEL-specific IgMa serum Ab titers on day 21. (C) HEL-specific serum IgMa titers in IgHEL or IgHEL×PD-1^−/− mice after adoptive transfer of T_regs or Th cells. The Ab titers of unimmunized control mice are shown as background. *P < 0.05; **P < 0.01; ***P < 0.001 (ANOVA and Bonferroni). Data are representative of two experiments with four mice in each group.

When we transferred NOH T_regs into IgHEL×PD-1^−/− mice (experimental scheme in Fig. 3A), auto-Ab production was no longer suppressed (Fig. 3C) compared with PD-1–competent IgHEL recipients. Titers resembled those in IgHEL recipients of NOH Th cells or of WT T_regs (Fig. 3C). Thus, adoptively transferred T_regs required PD-1 expression by host cells, consistent with the necessity of PD-1 in B cells as shown above (Fig. 2).

PD-1 Ligand Expression by T_regs Is Required for B-Cell Suppression.

We next wanted to adoptively transfer PD-1 ligand-deficient T_regs into IgHEL mice to clarify whether these ligands were necessary for B-cell suppression. To this end, we crossed NOH mice with PDL-1^−/− mice and transferred their T_regs into immunized IgHEL mice. PDL-1–deficient T_regs still prevented autoantibody production (Fig. 4B), suggesting that PDL-2 also was involved in suppression. This was consistent with a previous report showing that both PD-1 ligands are sufficient on their own to signal through PD-1 (26) and implied that we needed to incapacitate both of them in our system. To do so, we transferred T_regs from NOH×PDL-1^−/− mice and blocked PDL-2 with TY25 antibodies (36) (experimental scheme in Fig. 4A), which was faster than generating NOH×PDL-1^−/−.PDL-2^−/− mice. This restored autoantibody production to levels in control mice (Fig. 4B), indicating that B cells were suppressed by PDL-1 on T_regs and by PDL-2 on unidentified cells. These PDL-2⁺ cells cannot be host cells because in that case autoantibody production should have been restored in mice treated with TY25 antibody but not injected with T_regs, yet this was not so (Fig. 4B). And if host cells indirectly used PDL-2 to render the transferred T_regs suppressive, then TY25 antibody should have disabled PDL-1–competent T_regs. Thus, our results imply that T_regs used both PD-1 ligands to suppress B cells in our system. Mechanistic analysis revealed that the lack of both ligands augmented the number of antibody-forming cells (Fig. 4C) and reduced B-cell apoptosis (Fig. 4D), consistent with the effects of PD-1 signaling on B cells (Fig. 2 E and F).

Fig. 4.

PDL-1/2 expression by T_regs is required for B-cell suppression. (A) Experimental scheme: 1 × 10⁶ T_regs from spleens of NOH or NOH×PDL-1^−/− mice were transferred into IgHEL mice that were immunized with HEL/Alum i.p. and injected with PDL-2–blocking TY25 Ab on days 0, 7, and 14. The Ab titers of unimmunized control mice were shown as background. (B) HEL-specific serum IgMa titers on day 21. (C) Proportion of cells producing anti-HEL IgMa Ab determined by ELISpot. (D) Proportion of apoptotic IgHEL cells among splenocytes on day 21. *P < 0.05; **P < 0.01 (ANOVA and Bonferroni). Data are representative of two experiments in groups of four mice each.

B-Cell Suppression by Specific T_regs Does Not Require Intermediate Th Cells.

The above findings established that T_regs need to express PD-1 ligands and that B cells need to express PD-1 in our system, consistent with direct cross talk between these cells. However, there is a theoretical scenario where intermediate Th cells are still involved: T_regs might suppress PD-1⁺ Th cells using PD-1 ligands, which then up-regulate PDL-1 and/or PDL-2 to suppress PD-1⁺ B cells. We experimentally addressed this possibility first by analyzing PD-1 expression on Th cells and T_regs. PD-1 was unchanged on these cells after immunization or T_reg depletion (Fig. S8 A–C). To test for functional relevance, we generated NOH×PD-1^−/− mice, in which the lack of PD-1 on all cells, including Th cells, precluded the scenario described above. When we adoptively transferred IgHEL cells expressing or lacking PD-1 into NOH×PD-1^−/− mice (experimental scheme in Fig. 5A), after 3 d we observed lower numbers, reduced proliferation, and increased apoptosis of PD-1–competent, but not of PD-1–deficient IgHEL cells (Fig. 5 B–D). Thus, PD-1⁺ IgHEL cells were suppressed even when all other cells in the system, including Th cells, were PD-1–deficient (Fig. 5 B–D, right pair of bars).

Fig. 5.

T_regs directly suppress B cells. (A) Experimental scheme: Either 5 × 10⁶ IgHEL (white bars in B–D, F, and G) or IgHEL×PD-1^−/− (black bars in B–D, F, and G) B cells were transferred into PD-1–competent NOH or into NOH×PD-1^−/− mice, which were immunized with HEL/Alum on the next day. (B) Absolute numbers of IgHEL cells in the spleen 3 d after immunization. (C) Proportions of proliferating IgHEL cells. (D) Proportion of apoptotic IgHEL cells at 18 h after immunization. (E–G) Same experiment as in A except that mice were immunized twice in a weekly interval. (F) HEL-specific IgMa serum Ab titers on day 14. (G) Numbers of antibody-forming cells in the spleens measured by ELISpot. (H) Numbers of HEL-specific antibody-forming cells in the spleens of T_reg-depleted NOH–PD-1^−/− mice measured by ELISpot. *P < 0.05; **P < 0.01; ***P < 0.001 (ANOVA and Bonferroni). Data are representative of two experiments in groups of three to five mice.

Finally, we examined auto-Ab titers and numbers of autoreactive B cells in this system after 14 d (experimental scheme in Fig. 5E). Anti-HEL IgMa titers in NOH×PD-1^−/− recipients of IgHEL×PD-1^−/− cells were 10-fold higher than in recipients of WT cells (Fig. 5F, right pair of bars), indicating that PD-1 on B cells alone was essential and sufficient to suppress auto-Ab formation almost completely. Also after transfer into PD-1–competent NOH mice, PD-1⁺ B cells were prevented from producing auto-Ab (Fig. 5F, left pair of bars). In these recipients, IgHEL cells produced even somewhat more auto-Ab than after transfer into NOH×PD-1^−/− mice (Fig. 5F), excluding a contribution of PD-1 on other host cells to autoantibody inhibition in our system because in this case less auto-Ab should have been produced. When we examined the numbers of autoreactive B cells surviving 14 d after transfer, results were similar (Fig. 5G). In PD-1–deficient NOH recipient mice, PD-1 deficiency in IgHEL cells and T_reg depletion increased B-cell survival to a similar extent, and the combination was not synergistic (Fig. 5H), supporting the conclusion that PD-1 on B cells, and only on B cells, was the target molecule of T_regs. These findings showed that PD-1 expression by cells other than autoreactive B cells, including Th cells, was dispensable for suppression, implying that T_regs directly suppressed B cells in vivo.

Discussion

T_regs potently inhibit autoreactive T and B cells, but the underlying molecular mechanisms remain unclear, especially those that suppress B cells. Here we show that T_regs control autoreactive B cells specific for tissue auto-Ag through the suppressive surface molecule PD-1. Others have previously shown that follicular Th cells express high amounts of PD-1 (37) and that PD-1 inhibits Th cells (38), suggesting that indirect B-cell suppression, by curbing help for auto-Ab production, may play a role. Cell culture studies by others had hinted at the possibility of direct suppression (10–12), but providing in vivo evidence required an experimental system by which either the direct or the indirect route of suppression could be incapacitated. This became possible by our identification of PD-1 as the main suppressor of auto-Ab formation. Performing a series of adoptive transfer experiments, we found that B cells, and only B cells, needed to express PD-1 and that T_regs needed to express PD-1 ligands, implying direct communication between T_regs and B cells. On the basis of our findings (i) that direct suppression entirely depended on PD-1, (ii) that PD-1 reduced auto-Ab production by 65–75%, and (iii) that T_regs reduced such production by 85–90%, it can be calculated that 65–85% of the T_reg effect in our system resulted from PD-1–mediated direct suppression. The PD-1–independent part of the T_reg effect may occur by indirect suppression, for example, by inhibiting Th cells. Thus, our findings are not inconsistent with previous studies showing indirect suppression in other systems (8, 39).

PD-1 expressed by follicular Th cells has previously been shown to improve antibody formation against foreign antigens by promoting the survival of B cells expressing PD-1 ligands (30). This positive effect was difficult to reconcile with the high auto-Ab titers and the lupus symptoms observed in PD-1 knockout mice (21, 31). In our study, T_regs expressing PD-1 ligands acted negatively on autoreactive PD-1⁺ B cells, explaining the phenotype of PD-1–deficient mice (21, 38). This is no contradiction because T_regs will operate only in responses against self-antigens and prevail over the positive effect on follicular Th cells. Thus, the mechanism described here will not operate in antibody generation against foreign antigens.

Also, in humans, there is evidence that PD-1 suppresses antibody-mediated autoimmunity. For example, a single-nucleotide polymorphism of the PDCD1 gene that incapacitated PD-1 expression was linked to the presence of rheumatoid factors and rheumatoid arthritis symptoms and to lupus erythematosus with nephritis (40). Our findings suggest that B cells lacking PD-1 functionality in these individuals might have been unable to receive suppressive signals from T_regs.

B-cell apoptosis induced by T_regs has been previously shown in vitro and occurred by granzyme B/perforin-mediated cell lysis (10, 12) or by Fas (11). Our findings provide in vivo evidence for T_reg-induced B-cell apoptosis by PD-1. Engagement of PD-1 on B cells has been shown to inhibit B-cell receptor (BCR) signaling by recruiting SHP-2 to its phosphotyrosine and dephosphorylating key signal transducers of BCR signaling (41), which may deprive B cells of survival signals. It remains to be clarified whether this molecular mechanism applies in our system.

Throughout this study, the accrual of apoptotic B cells was less prominent than the increase of autoantibody titers or of viable autoreactive B cells. This may be due to the rapid in vivo clearance of apoptotic cells in healthy organisms (42), which prevented accumulation of large numbers of apoptotic B cells. However, even if apoptosis induction occurred slowly, it may still be sufficient for peripheral tolerance induction because self-antigens are normally always present, allowing continual incapacitation of autoreactive B cells.

Our findings identified PD-1 ligands as suppressive effector molecules of T_regs. It has been previously reported that PDL-1 affects the development of T_regs (27), raising the question whether the PDL-1–deficient T_regs that we adoptively transferred might carry developmental defects. However, this cannot explain our observations because PDL-1–deficient T_regs were still able to suppress, unless also PDL-2 was blocked. Although PDL-2 possesses high affinity to PD-1 (21), its levels were very low on PDL-1–competent T_regs. However, it was higher on PDL-1–deficient T_regs, which may indicate that T_regs use PDL-2 only when they lack PDL-1.

An open question in our system concerns the intrasplenic site where T_regs and autoreactive B cells meet. T_regs and B cells make contacts at the T-cell–B-cell border and within germinal centers (9). CXCR5⁺ T_regs were very recently shown to enter germinal centers to suppress B cells, affinity maturation of antibodies, and plasma cell differentiation (13, 14). Further studies are necessary to identify the site of suppression in our model.

PD-1–blocking antibodies are being discussed for clinical application in cancer (43), persistent viral hepatitis (44), and AIDS (45) as a means to invigorate suppressed or exhausted T-cell responses. Also antibody responses were found to be increased after PD-1 blockade, which our results suggest to be due to inhibition of T_reg function. Our findings also suggest that auto-Ab production might occur as a side effect of such blockade. A current preclinical study showed little evidence of auto-Ab generation (45), which may be explained by the short duration of antibody treatment, by maintained PD-1–independent suppression of autoreactive Th cells, or by the absence of adjuvants such as Alum in our study. Finally, our study suggests that T_regs that were caused to express PD-1 ligands might allow treatment of antibody-mediated autoimmune disease. Given that T_regs specifically suppressed auto-Ab formation, this approach should be associated with fewer side effects than therapies targeting all B cells, such as depletion with CD20-specific antibodies.

Materials and Methods

Mice and Reagents.

All mice were bred and maintained under specific pathogen-free conditions at the central animal facility of the University Clinic of Bonn (House of Experimental Therapy) and used at 8–14 wk of age according to German animal experimentation laws. All studies were approved by an external review board (Bezirksregierung Köln, Cologne). All reagents, if not otherwise specified, were from Sigma-Aldrich. CD25⁺ cells were depleted by injecting 300 μg of PC61 antibody (purified from hybridoma supernatant) i.p. For in vivo blockage of PD-1 or PDL-2, 250 μg of RMP1-14 (18) or 250 μg of TY25 antibodies (34), respectively, were injected i.p. at weekly intervals. Mice were immunized i.p. with 10 μg antigen in aluminum hydroxide at a 1:1 ratio in 200 μL total volume at weekly intervals.

Isolation and Transfer of Primary B-Cell and T_regs.

B cells were isolated from IgHEL (MD4) mice, and T_regs or Th cells were isolated from NOH or C57BL/6 mice. Single-cell suspensions were treated with erythrocyte lysis buffer (146 mM NH₄Cl, 10 mM NaHCO₃ and 2 mM EDTA) to remove red blood cells. B cells were further purified by magnetic cell separation using the negative B-cell isolation kit from Miltenyi (purity ∼97%). T_regs were purified using the T_reg isolation kit from Miltenyi (purity ∼90%).

ELISA and ELISpot.

Antigen-specific serum IgG, IgM, and IgMa titers were measured by ELISA, and antibody-forming cells (AFC) numbers by ELISpot as described (6).

Real-Time PCR.

RNA was isolated using TRIzol. Contaminating DNA was eliminated with DNase. One microgram of RNA was converted to cDNA using High Capacity Reverse Transcription kit. The SYBR Green-PCR was done on an Abi Prism 7900HT System. One microliter of cDNA was used with the following settings: 40 cycles of 15 s of denaturation at 95 °C and 1 min of primer annealing and elongation at 60 °C. Samples were run in triplicates, and GAPDH served as internal control for normalization. Primers were designed by Primer Express Software and purchased from Invitrogen. Sequences were the following: PD-1—forw. 5′AAGCTTATGTGGGTCCGGC′3 and rev. 5′GGATCCTCAAAGAGGCC′3; Fas—forw. 5′TCTGGTGCTTGCTGGCTCAC′3 and rev. 5′CCATAGGCGATTTCTGGGAC′3; PDL-1—forw. 5′TGCTTCTCAATGTGACC′3 and rev. 5′GGAACAACAGGATGGAT′3; PDL-2—forw. 5′TGACCCTCTGAGTTGGATGGA′3 and rev. 5′GCCGGGATGAAAGCATGA′3; FasL—forw.5′CGGTGGTATTTTTCATGGTTCTGG′3 and rev. 5′CTTGTGGTTTAGGGGCTGGTTGTT′3; granzyme B—forw. 5′GGGAAGATGAAGATCCTCCTGC′3 and rev. 5′TGATCTCCCCTGCCTTTGTC′3; and perforin—forw.5′CCCTAGGCCAGAGGCAAAC′3 and rev. 5′AAAATTGGCTACCTTGGAGTGG′3.

Flow Cytometry.

Cells were stained in PBS 0.1% BSA 0.1% sodium azide for 20 min on ice using fluorochrome-labeled monoclonal antibodies from eBiosciences if not otherwise specified: CD4 (GK 1.5), CD25 (PC61), DO11.10 TCR (KJ1-26), Foxp3 (FJK-16s), B220 (RA3-6B2), IgMa (DS-1; BD Bioscience), PD-1 (J43), PDL-1 (MIH5; BD Bioscience), PDL-2 (TY25), Fas (15A7), FasL (MFL3), and Ki67 (SP6; Thermo Scientific). Apoptosis was determined by a caspase 3/7 FLICA kit (Immunochemistry Technologies). To identify Ag-specific B cells, soluble HEL was conjugated to Alexa₆₄₇ fluorochrome with a commercial kit (Invitrogen) and used at 2.5 μg/mL. Dead cells were excluded by Hoechst 33258 or 7-AAD and analyzed on a BDCanto II (Becton Dickinson). To determine absolute cell numbers, 1 × 10⁵ CaliBRITE APC beads were added before flow cytometry as an internal reference. For intracellular staining, cells were stained for surface makers, fixed with 2% (vol/vol) paraformaldehyde, permeabilized with 0.25% Triton X in PBS, and stained with Foxp3- or Ki67-specific antibodies. Results were analyzed with FlowJo software (TreeStar).

Statistical Analysis.

Results are expressed as mean ± SEM; *P < 0.05; **P < 0.01; ***P < 0.001. Comparisons were made using ANOVA test with Bonferroni posttest using Prism 4 software (Graphpad Software).