Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2013 Sep 1.
Published in final edited form as: Plasmid. 2012 Apr 1;68(2):86–92. doi: 10.1016/j.plasmid.2012.03.002

Development of an IPTG Inducible Expression Vector Adapted for Bacteroides fragilis

Anita C Parker 1, C Jeffrey Smith 1,*
PMCID: PMC3389198  NIHMSID: NIHMS368305  PMID: 22487080

Abstract

The genus Bacteroides are gram-negative, obligate anaerobes indigenous to the gastrointestinal tract of humans and animals. The Bacteroides and other members of the Bacteroidetes phylum have diverged from the Proteobacteria. These organisms evolved a unique promoter structure for the initiation of transcription, hence common genetic tools are of limited use in the Bacteroides. An expression vector that can control gene expression in the Bacteroides was constructed by engineering the lacO1,3 repressor binding sites into the promoter of the cfxA β-lactamase gene. The gene for the LacI repressor was placed under control of the Bacteroides tetQ gene promoter for constitutive expression and inserted into the vector. Studies utilizing the xylosidase reporter gene, Xa, showed that the gene was induced by Isoproply β-D-1-thiogalactopyransoide (IPTG) in a time and concentration dependent manner from 10–250 μM over a 10–240 min time frame. The utility of the vector was demonstrated by insertion of the Bacteroides fragilis trxA gene into the plasmid. TrxA synthesis was monitored by Western hybridization and the results indicated that it was regulated by the presence of IPTG in the media. This is the first transcriptional regulatory system developed for the Bacteroides that has incorporated components from the Proteobacteria and demonstrates the feasibility of modifying existing genetic tools for use in these organisms.

Keywords: Bacteroides fragilis, expression vector, LacI

1. Introduction

The Bacteroides are Gram-negative anaerobes that inhabit the gastrointestinal tract of mammals. They are part of the unique phylum, Bacteroidetes, that is significantly diverged from the main Proteobacteria lineages and possess a number of novel biochemical properties such as the presence of membrane sphingolipids (An et al 2011; Karlsson et al 2011; Paster et al 1994; Smith et al 2006). These organisms make up a significant portion, 20–60%, of the total indigenous microflora of the colon depending on diet and other factors, and thus their contribution to human health is considerable (Eckburg et al 2005; Ley et al 2006; Wu et al 2011). As members of the normal flora they influence the development of the immune system and contribute to a wide range of physiological activities associated with the colon including the digestion of complex carbohydrates, energy generation in the form of short chain fatty acids, vitamin synthesis, and bile acid metabolism. In addition to the health benefits, Bacteroides are important opportunistic pathogens being the most frequently isolated anaerobes from infections (Finegold and George 1989). These organisms predominate in intraabdominal and pelvic infections and are the most common anaerobe isolated from blood (Comstock and Tzianabos 2000; Lassmann et al 2007).

There is considerable interest in the Bacteroides as model systems for the normal intestinal microflora and for endogenous opportunistic infections, both of which require genetic tools for functional analyses. One basic need is for an expression vector system that allows regulated gene expression in Bacteroides species. Typical systems used for prokaryotes rely on the lac or ara promoters of Escherichia coli and these have proven invaluable in studies for a wide range of bacterial species. However, early work showed that the Bacteroides are unable to express genes under control of the lac promoter and in fact they do not recognize the E. coli consensus promoter or typical gram-positive promoters (Smith et al 1992). Subsequent studies have shown that Bacteroides species have a unique promoter structure that is recognized by its core RNA polymerase with σ70 (Bayley et al 2000; Vingadassalom et al 2005). The recognition sequence, TTTG (N19–21)TANNTTTG, is centered around bases −7 and −33 relative to the TIS (transcription start site). Interestingly this promoter sequence also was shown to be conserved in the Flavobacteria, another member of the Bacteroidetes phylum (Chen et al 2007).

Given this limitation in transcription initiation there are two options for the development of expression vectors. First would be to identify an inducible gene system in Bacteroides that could be easily manipulated, but there is a paucity of information on specific transcriptional regulatory factors in these organisms. A second approach would be to modify an existing, well proven system so that it responds to the Bacteroides transcriptional machinery. In this paper we have taken the E. coli lac system, with all its accumulated knowledge, to construct an inducible expression system that responds to Isoproply β-D-1-thiogalactopyransoide (IPTG). The LacI repressor and the lac operator binding sites were engineered onto a plasmid containing the relatively strong cfxA promoter. Using transcriptional fusions and Western Blot techniques the system was shown to be induced by IPTG in a time and concentration dependent manner.

2. Materials and methods

2.1 Bacterial strains and growth

B. fragilis strain 638R was the Bacteroides host strain for all studies (Table 1). Strains were routinely grown in Difco Brain Heart Infusion Broth supplemented with hemin (0.005 g/l), NaHCO3 (2 g/l) and cysteine (0.5g/l) [BHIS]. Antibiotics were added as needed at the following concentrations: Rifampicin (Rf, 20μg/ml), Gentamicin (25μg/ml) and Erythromycin (Em, 10μg/ml). Cultures were incubated in a Coy anaerobic chamber with an atmosphere of 80% N2 10% CO2 and 10% H2 at 37°C. E. coli EC100 was used for routine DNA manipulations and cloning. Plasmids constructed in E. coli were mobilized into Bacteroides strains by triparental mating using RK231 as a conjugal helper plasmid (Bacic et al 2005). Cultures were grown Luria-Bertani (LB) medium with appropriate antibiotics as described in the text: Spectinomycin (Sp, 60μg/ml) and Kanamycin (Km, 25μg/ml).

Table 1.

Strains and plasmids used in this study

strain or plasmid relevant propertiesa reference
Strains
 B. fragilis 638R Wild type, clinical isolate, Rfr (Privitera et al 1979)
 E. coli EC100 laboratory strain, F- mcrA Δ(mrr-hsdRMS-mcrBC) Φ80dlacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara, leu)7697 galU galK λ− rpsL (Strr) nupG Epicentre, Inc, Madison
Plasmids
 pFD288 8.9 kb, shuttle vector, Emr, (Spr) (Smith et al 1995)
 pFD351 11.1 kb, pFD288 containing cfxA gene, Emr, Fxr, (Spr) (Parker and Smith 1993)
 pFD1140 9.1 kb, pFD288 containing lacO1,3 modified cfxA promoter, Emr, (Spr) this study
 pFD1142 10.5 kb, pFD288 containing 504 bp tetQ promoter fragment and lacI gene, Emr, (Spr) this study
 pFD1146 9.4 kb, IPTG inducible Bacteroides expression vector, Emr, (Spr) this study
 pFD1147 10.4 kb, pFD1146 containing the XA reporter gene cloned into BamHI site, Emr, (Spr) this study
 pFD1153 9.8 kb, pFD1146 containing trxA-cMyc gene cloned into the BamHI and SacI sites, Emr, (Spr) this study
 pSRKKm 5.8 kb, IPTG inducible Proteobacteria expression vector, (Kmr) (Khan et al 2008)
Open in a new tab
a

The antibiotic resistance phenotypes expressed in E. coli are indicated by the designations enclosed by parentheses and Bacteroides phenotypes are shown without parentheses.

2.2. Construction of pFD1146

Shuttle vector, pFD288, was the base plasmid used for construction of pFD1146. First, the constitutive cfxA promoter was amplified from pFD351 using a primer, Cfx-lacO1-R, that incorporated the lacO1 operator site 1 bp downstream of the cfxA TIS and a second primer, Cfx-F, about 340 bp upstream of the promoter (Table 2). This fragment was cloned into SphI/SalI digested pFD288. This construct was the template for primers Cfx-lacO3-F and Cfx-R which incorporated the lacO3 site, 42 bp upstream from the −33 region of the cfxA promoter and encompassed an EcoRV site downstream of the of the promoter region. The resulting amplified fragment containing the lacO3, cfxA promoter, and the lacO1 site was digested with SphI + EcoRV and cloned into similarly digested pFD288 to form pFD1140. Next the lacI gene was amplified from pSRKKm using primers Laci-F and Laci-R, and then inserted into a plasmid downstream of the tetQ promoter to form pFD1142. Finally the tetQ, lacI transcriptional fusion was amplified from pFD1142 using primers I-tet-F and I-tet-R, digested with EcoRI+SmaI and then ligated into EcoRI + EcoRV digested pFD1140 to form the final product pFD1146. The nucleotide sequence of this plasmid, GenBank Accession, JQ776640, was determined by deduction from the previously reported sequences of pFD288 and the other components, and it was confirmed by sequence analysis of the newly modified regulatory regions between nucleotides 7600 and 9400.

Table 2.

Oligonucleotide primers used for construction of pFD1146

primer name sequencea
cfxA promoter & lacO1 cloning
 Cfx-lacO1-R (SalI) acgtgtcgacaattgttatccgctcacaattGCCGACAAAGGTACATAACTAAAG
 Cfx-F (SphI) acgtgcatgcCATGATTTGAAAGCTCATA
lacO3 cloning
 Cfx-lacO3-F (SphI) acgtgcatgcggcagtgagcgcaacgcaattTTACAAAGAAAATTCGACAAACTG
 Cfx-R CGAACTTAGTCATTTGAATG
lacI cloning
 Laci-F (SalI) acgtgtcgacaaataagaaacaattATGAAACCAGTAACGTTATACGA
 Laci-R (EcoRI) acgtgaattcAACTCACATTAATTGCGTTG
tetQ promoter +lacI cloning
 I-tet-F (EcoRI) acgtgaattCCCAAAAGGTCTAAAAGTAA
 I-tet-R (SmaI) acgtcccgggAACTCACATTAATTGCGTTG
Open in a new tab
a

The primer sequences are shown 5′-3′. Uppercase letters designate sequences that match the template in question. Lowercase letters are additions to the 5′ end. Sequence in italics shows the engineered restriction sites. Sequences in bold font show insertions of the lacO1 or lacO3 binding sites, or in the case of primer Laci-F the bold font is the B. fragilis ahpC ribosome binding site engineered upstream of the lacI ATG start site.

The xylosidase reporter gene, XA, originally obtained from pXA1 (Whitehead 1997) on a BamHI fragment was ligated into the expression vector to form pFD1147. Another construct, pFD1153, contained the B. fragilis trxA gene (Reott et al 2009) with a c-Myc tag at the C-terminus cloned into pFD1146.

2.3. Xylosidase transcriptional fusion assay

To determine the activity of xylosidase transcriptional fusions B. fragilis cells containing the appropriate plasmid were grown in BHIS media to mid-logarithmic phase (A550 0.3–0.6) and were harvested by centrifugation. The cells were suspended in 1.35 ml 50mM sodium phosphate buffer (pH 6.8) and the cell solution was divided to three equal aliquots. Fifty μl CTAB solution (0.05% hexadecyltrimethylammonium bromide + 10mM dithiothreitol in 50mM sodium phosphate buffer) was added to each tube, mixed and incubated at 37°C. Next 10μl 100mM p-nitrophenyl-D-xylopyranoside in dimethyl sulfoxide was added to each reaction, and incubated at 37°C for 15 min. The reaction was stopped by the addition of 50μl of 2% Na2CO3 and cells were removed by centrifugation. The absorbance of the supernatant at 405nm was recorded. Activity units were determined by the formula [A405/(T × V × A550)] × 1000; where T is equal to time of assay in min, and V is the volume of cells calculated to the original culture.

2.4. Western hybridizations

Samples for Western blots were obtained from cultures grown with IPTG induction as described in the text. Cultures were centrifuged and stored at −80°C until SDS-PAGE was performed as described previously (Laemmli 1970). Samples were adjusted to equal amounts of protein and then 16–20 μg of each was added to loading buffer containing running dye in a total volume of 20 μl, boiled for 10 min, allowed to quickly cool on ice, and then loaded on a 12% SDS-PAGE gel. Proteins then were transferred to a PVDF membrane, probed with primary antibody, then labeled with an alkaline phosphatase secondary antibody, and bands were visualized using chromogenic detection with nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate. Digital densitometric analysis of photographic images was performed using ImageQuant software (Amersham Bioscience) to estimate relative band intensity. Densitometric measurements from at least 2 independent gels were obtained. Experiments measuring the c-Myc tagged TrxA utilized a monoclonal c-Myc primary antibody (Sigma) and anti-mouse secondary antibody. The LacI protein was identified with rabbit anti-LacI (Lifespan Bioscience, Seattle) and anti-rabbit IgG secondary.

3. Results and discussion

3.1. Strategy and construction of a Bacteroides expression vector

We previously constructed a constitutive Bacteroides expression vector based on the outward firing promoter of IS4351 (Smith, Rogers, and McKee 1992). This plasmid has been used extensively for complementation experiments but it has obvious drawbacks for experiments where more precise regulation of gene expression is desired. In this regard the starch/maltose inducible osuA promoter has been cloned into vector pFD1045 and used to control B. fragilis gene expression in a more responsive manner (Lobo et al 2011; Spence et al 2006). Although this system has allowed for some “user” controlled regulation of gene expression, the osuA promoter is subject to induction by aerobic stress and by growth phase so these factors have limited its utility. To overcome some of these shortcomings an expression system was designed around the lacI repressor which would be IPTG inducible. This avoids some of the problems surrounding the use of native Bacteroides systems where there are still relatively few details for any substrate inducible gene systems. Further, IPTG is apparently freely permeable across cell membranes so the lack of suitable transport systems is not a factor for induction of gene expression.

Several modifications were necessary to adapt the lacI system to the Bacteroides transcriptional machinery. The first consideration was to replace the lacZ promoter with one recognized by the Bacteroides RNA polymerase while at the same time retaining the lacO operator sites. This was accomplished by cloning the constitutive cfxA promoter from Tn4555 into the shuttle vector pFD288. Two sequential cloning steps were used with primer pairs that contained either the lacO1 or lacO3 repressor binding sites. Previous work has shown that the spacing between the lacO operators was critical for maximal LacI repression (Oehler et al 1990). The construction strategy used here maintained that optimal spacing for the lacO3 binding site with respect to the -33 and the lacO1 site with respect to the TIS (Fig. 1). The lacO2 site was not incorporated into this vector since its location in the 5′ end of the lacZ gene would not be practical for routine use in an expression vector.

Fig. 1.

Fig. 1

Open in a new tab

Nucleotide sequence and features of the B. fragilis cfxA promoter with incorporated lacO binding sites in pFD1146. The cfxA and tetQ promoter regions and lacI coding sequence are show with the block arrows and the relative locations of the lacO operators are indicated. The map is drawn to scale. The nucleotide sequence shows the cfxA promoter with the precise location of the −7 and 33 sites relative to the lacO1,3 repressor binding sites. In addition, the unique restriction sites suitable for cloning a gene of interest are also shown.

The second modification needed was to provide for adequate expression of the cloned LacI structural gene. A 504 bp fragment containing the tetQ promoter from CTn341 was utilized for constitutive transcriptional activation of lacI. The cloned promoter fragment did not include the tetracycline attenuation leader sequence located between the TIS and the tetQ structural gene, thus LacI was not subject to tetracycline induction (Wang et al 2005). Another concern was to allow for optimal translation of the gene product. Although the B. fragilis ribosome binding site (RBS) has not been specifically determined, the complement of the 16S rRNA 3′ end is, AGAAAGGAG. This is not a good match with the native lacI RBS thus the B. fragilis ahpC gene RBS was inserted adjacent to the translation start site (Fig. 1, and supplemental data). The expression of LacI in B. fragilis was examined by Western hybridization analyses. As shown in Fig. 2, LacI was produced from the pFD1142 construct in 638R and readily detected as a protein band identical in size to that produced by pSRKKm in E. coli. There were some cross reacting proteins in 638R but these did not interfere with identification of the LacI product at about 40 kDa.

Fig. 2.

Fig. 2

Open in a new tab

Western hybridization showing the production of LacI from pFD1142 in B. fragilis. (A) Western hybridization with LacI antibody; (B) the 0.8% SDS-PAGE gel use for the Western hybridization. Lane mw, SeeBlue7 Plus2 molecular weight markers; lane 1, B. fragilis 638R; lane 2, B. fragilis 638R + pFD1142 (1/20 dilution); lane 3 B. fragilis 638R + pFD1142; Lane 4, E. coli containing pSRKKm as a positive control. The 38 kDa band corresponding to LacI is indicated by the arrow to the right of the panel.

The final construct, pFD1146, was produced by insertion of the tetQ/lacI fusion into the plasmid containing the cfxA+lacO1,3 promoter (Fig. 3). Western hybridization showed that LacI was expressed to the same levels as shown above for pFD1142 (data not shown). The possible toxicity of LacI was gauged by growth curve studies. The results in Fig. 4 compare pFD1140 (no LacI), pFD1146 (LacI), pFD1147 (LacI + xylosidase reporter gene) to the wild type strain with no plasmids. The results show that each of the plasmid bearing strains had a slight growth defect compared to the parent strain but this was not associated with the presence of the lacI gene or the reporter gene. This decreased growth rate was similar to what we have observed with other ermF containing plasmids in the presence of erythromycin (data not shown).

Fig. 3.

Fig. 3

Open in a new tab

Functional map of the expression vector, pFD1146. The map shows the major features of the expression plasmid as grey block arrows for genes and promoters and rectangles for other sites. The replication gene, repA, is required for replication in Bacteroides and ermF is the Bacteroides erythromycin resistance gene. The RK2 oriT used for mobiliztion of the plasmid from E. coli to Bacteroides is shown and the aad9 gene provides resistance to spectinomycin in E. coli.

Fig. 4.

Fig. 4

Open in a new tab

Growth characteristics of B. fragilis strains containing pFD1146 and related plasmids. Growth in BHIS was measured in 13×100 mm tubes at A550 at the intervals indicated. The parent strain 638R was grown without erythromycin and the plasmid containing strains were grown in the presence of 10 μg/ml of erythromycin.

3.2. IPTG induction of the xylosidase reporter gene

The expression system was tested using the xylosidase reporter gene, XA, originally isolated from Bacteroides ovatus (Whitehead 1997). Cells containing pFD1147 were grown to mid-logarithmic phase and then IPTG from .001 – 1.0 mM was added to test induction. After two h incubation cells were harvested and xylosidase activity was measured (Fig. 5A). The promoter was not significantly induced at the lowest concentrations of IPTG but the addition of 0.05 mM resulted in an increase of about 5-fold over the control. Further induction was noted up to about 0.25 mM IPTG above which activity seemed to level off. Similarly the response of the promoter to time following induction was examined at a constant IPTG concentration of 1 mM IPTG (Fig. 5B). After about 10 min of IPTG induction xylosidase activity was observed and continued to increase in proportion to the length of time following addition. The xylosidase activity appeared to peak at about 4 h and remained high for the course of the experiment.

Fig. 5.

Fig. 5

Open in a new tab

IPTG controlled expression of the xylosidase reporter gene in pFD1147. (A) Cultures of 638R containing pFD1147 were grown in BHIS media to mid-logarithmic phase (A550 0.3) and then induced for 2 h with the concentration of IPTG indicated. Cells then were harvested by centrifugation and xylosidase assays were performed. (B) Cells were grown in BHIS media to mid-logarithmic phase (A550 0.3) and then induced with 1.0 mM IPTG for the time indicated. Cells then were harvested by centrifugation and xylosidase assays were performed. All data were obtained from triplicate assays in two independent experiments.

Induction of the reporter gene also was tested using lactose. Cells containing pFD1147 were grown to mid-logarithmic phase and then split. One half received 10 mM lactose and both were incubated for an additional 2.5 h. Analysis of xylosidase activity showed no differences between the lactose treated or untreated cultures. Although B. fragilis contains more than 10 genes annotated as β-galactosidases there was no obvious induction of the cfxA promoter suggesting that allolactose is not produced in these cells under the conditions tested.

Previous studies had shown that exposure to air induced the expression of many carbohydrate utilization systems but cultures shaken in air for an hour showed no increase in xylosidase [(Sund et al 2008) and data not show].

3.3. Regulated expression of a B. fragilis thioredoxin, TrxA

The pFD1146 expression system was finally tested using a native B. fragilis gene, trxA, that was modified to contain the c-Myc tag at the 3′ end of the gene. As shown in Western hybridization results, Fig. 6A, there was a good correlation between the length of time following induction with 1 mM IPTG and the amount of TrxA produced. The results were similar to the reporter gene assays with near maximum induction by about 4 h. Analysis of the Western blots by densitometry showed that were was some additional TrxA produced out to at least 6 h (data not shown). The dependence of TrxA induction on the concentration of IPTG was maximal at 0.5 mM IPTG and decreased somewhat at 2 mM (Fig. 6B). This result was similar to the analyses with the XA reporter gene.

Fig. 6.

Fig. 6

Open in a new tab

Regulated expression of the B. fragilis trxA gene cloned into pFD1146. Western hybridization analyses of the cMyc-tagged trxA gene product with c-Myc antibody was used to measure induction following the addition of IPTG. Cells were grown in BHIS to mid-logarithmic phase (A550 0.35), then induced as described below and cells electrophoresed on 15% SDS-PAGE gels. (A) Cells were induced with 1 mM IPTG for 0–24 h as indicated and then harvested by centrifugation. c=no induction prior to addition of IPTG. (B) Cells were induced for 3.5 h with the concentration of IPTG as indicated. The c-Myc tagged TrxA protein with a mass of 12,700 is indicated by the arrowhead on the right of the blot. A non-specific protein that reacts with the cMyc antibody but does not respond to IPTG addition is present above the cMyc-tagged TrxA protein.

3.4. Summary and conclusions

The results reported here describe the construction of a Bacteroides expression vector that uses the LacI repressor to control transcription from the cfxA promoter in an inducer dependent manner over a 7–10-fold range of activity. This range of activity is not as great as that seen in many vectors in Proteobacteria systems, therefore this might be an area of future development for the system. For example it should be possible to replace the cfxA promoter with one of the strong Bacteroides 16S rRNA promoters which exhibit exceptionally high levels of transcriptional activity (Mastropalol et al 2009). Such a system would be useful for the production of Bacteroidetes proteins such as cell surface proteases or secreted enzymes that are not processed properly in typical E. coli host vector system (Barkocy-Gallagher et al 1999; Rasmussen et al 1991).

The expression system was reasonably effective in the repression of transcription from the cfxA promoter but in the absence of IPTG there still was a low level of background activity. This was true in both the xylosidase assays and the TrxA Western Blots so the system may not be useful for cloning of toxic products. This leaky expression might be caused by insufficient LacI so it might be helpful to place the lacI gene under control of a stronger constitutive promoter. Alternatively it might be useful to modify the codon usage of lacI to one that is more favorable to the Bacteroides translation system. These organisms have a distinct array of tRNA’s that are rarely used in E. coli and the converse also is true.

Supplementary Material

01

Highlights.

  • An IPTG inducible expression vector was designed for Bacteroides fragilis

  • The expression vector is a hybrid of the operators lacO1,3 from E. coli lacZ and the cfxA promoter from Bacteroides

  • The vector was tested with a xylosidase reporter gene and with a native B. fragilis gene by Western hybridization.

Acknowledgments

This work was supported in part by Public Health Service Grant AI40588 to C.J.S. from the National Institutes of Health.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. An D, Na C, Bielawski J, Hannun YA, Kasper DL. Membrane sphingolipids as essential molecular signals for Bacteroides survival in the intestine. Proc Natl Acad Sci U S A. 2011;108:4666–4671. doi: 10.1073/pnas.1001501107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bacic M, Parker AC, Stagg J, Whitley HP, Wells WG, Jacob LA, Smith CJ. Genetic and structural analysis of the Bacteroides conjugative transposon CTn341. J Bacteriol. 2005;187:2858–2869. doi: 10.1128/JB.187.8.2858-2869.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Barkocy-Gallagher GA, Foley JW, Lantz MS. Activities of the Porphyromonas gingivalis PrtP Proteinase Determined by Construction of prtP-Deficient Mutants and Expression of the Gene in Bacteroides Species. J Bacteriol. 1999;181:246–255. doi: 10.1128/jb.181.1.246-255.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bayley DP, Rocha ER, Smith CJ. Analysis of cepA and other Bacteroides fragilis genes reveals a unique promoter structure. FEMS Microbiol Lett. 2000;193:149–154. doi: 10.1111/j.1574-6968.2000.tb09417.x. [DOI] [PubMed] [Google Scholar]
  5. Chen S, Bagdasarian M, Kaufman MG, Bates AK, Walker ED. Mutational Analysis of the ompA Promoter from Flavobacterium johnsoniae. J Bacteriol. 2007;189:5108–5118. doi: 10.1128/JB.00401-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Comstock LE, Tzianabos AO. Abscesses. In: Nataro JP, Blaser MJ, Cunningham-Rundles S, editors. Persistent Bacterial Infections. ASM Press; Washington DC: 2000. pp. 397–408. [Google Scholar]
  7. Eckburg PB, Bik EM, Bernstein CN, Purdom E, Dethlefsen L, Sargent M, Gill SR, Nelson KE, Relman DA. Diversity of the Human Intestinal Microbial Flora. Science. 2005;308:1635–1638. doi: 10.1126/science.1110591. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Finegold SM, George WL. Anaerobic Infections in Humans. Academic Press; New York: 1989. [Google Scholar]
  9. Karlsson FH, Ussery DW, Nielsen J, Nookaew I. A Closer Look at Bacteroides: Phylogenetic Relationship and Genomic Implications of a Life in the Human Gut. Microb Ecol. 2011;61:473–485. doi: 10.1007/s00248-010-9796-1. [DOI] [PubMed] [Google Scholar]
  10. Khan SR, Gaines J, Roop RM, II, Farrand SK. Broad-host-range expression vectors with tightly regulated promoters and their use to examine the influence of TraR and TraM expression on Ti plasmid quorum sensing. Appl Environ Microbiol. 2008;74:5053–5062. doi: 10.1128/AEM.01098-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 1970;227:680–685. doi: 10.1038/227680a0. [DOI] [PubMed] [Google Scholar]
  12. Lassmann B, Gustafson DR, Wood CM, Rosenblatt JE. Reemergence of Anaerobic Bacteremia. Clin Infect Dis. 2007;44:895–900. doi: 10.1086/512197. [DOI] [PubMed] [Google Scholar]
  13. Ley RE, Turnbaugh PJ, Klein S, Gordon JI. Microbial ecology: human gut microbes associated with obesity. Nature. 2006;444:1022–1023. doi: 10.1038/4441022a. [DOI] [PubMed] [Google Scholar]
  14. Lobo LA, Smith CJ, Rocha ER. Flavin mononucleotide (FMN)-based fluorescent protein (FbFP) as reporter for gene expression in the anaerobe Bacteroides fragilis. FEMS Microbiol Lett. 2011;317:67–74. doi: 10.1111/j.1574-6968.2011.02212.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Mastropalol MD, Thorson ML, Stevens AM. Comparison of Bacteroides thetaiotaomicron and Escherichia coli 16S rRNA gene expression signals. Microbiol. 2009;155:2683–2693. doi: 10.1099/mic.0.027748-0. [DOI] [PubMed] [Google Scholar]
  16. Oehler S, Eismann ER, Kramer H, Muller-Hill B. The three operators of the lac operon cooperate in repression. EMBO J. 1990;9:973–979. doi: 10.1002/j.1460-2075.1990.tb08199.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Parker AC, Smith CJ. Genetic and biochemical analysis of a novel Ambler class A beta-lactamase responsible for cefoxitin resistance in Bacteroides species. Antimicrob Agents Chemother. 1993;37:1028–1036. doi: 10.1128/aac.37.5.1028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Paster BJ, Dewhirst FE, Olsen I, Fraser GJ. Phylogeny of Bacteroides, Prevotella, and Porphyromonas spp. and related bacteria. J Bacteriol. 1994;176:725–732. doi: 10.1128/jb.176.3.725-732.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Privitera G, Dublanchet A, Sebald M. Transfer of multiple antibiotic resistance between subspecies of Bacteroides fragilis. J Infect Dis. 1979;139:97–101. doi: 10.1093/infdis/139.1.97. [DOI] [PubMed] [Google Scholar]
  20. Rasmussen BA, Gluzman Y, Tally FP. Escherichia coli chromosomal mutations that permit direct cloning of the Bacteroides fragilis metallo-β-lactamase gene, ccrA. Mol Microbiol. 1991;5:1211–1219. doi: 10.1111/j.1365-2958.1991.tb01895.x. [DOI] [PubMed] [Google Scholar]
  21. Reott MA, Parker AC, Rocha ER, Smith CJ. Thioredoxins in redox maintenance and survival during oxidative stress of Bacteroides fragilis. J Bacteriol. 2009;191:3384–3391. doi: 10.1128/JB.01665-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Smith CJ, Rocha ER, Paster BJ. The medically important Bacteroides spp. in health and disease. In: Dworkin M, editor. The Prokaryotes: an Evolving Electronic Resource for the Microbiological Community. Vol. 7. Springer Verlag; New York: 2006. pp. 381–427. [Google Scholar]
  23. Smith CJ, Rogers MB, McKee ML. Heterologous gene expression in Bacteroides fragilis. Plasmid. 1992;27:141–154. doi: 10.1016/0147-619x(92)90014-2. [DOI] [PubMed] [Google Scholar]
  24. Smith CJ, Rollins LA, Parker AC. Nucleotide sequence determination and genetic analysis of the Bacteroides plasmid, pBI143. Plasmid. 1995;34:211–222. doi: 10.1006/plas.1995.0007. [DOI] [PubMed] [Google Scholar]
  25. Spence C, Wells WG, Smith CJ. Characterization of the primary starch utilization operon in the obligate anaerobe Bacteroides fragilis: regulation by carbon source and oxygen. J Bacteriol. 2006;188:4663–4672. doi: 10.1128/JB.00125-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Sund CJ, Rocha ER, Tzianabos AO, Wells WG, Gee JM, Reott MA, O’Rourke DP, Smith CJ. The Bacteroides fragilis Transcriptome Response To Oxygen and H2O2: The Role Of OxyR And Its Effect On Survival And Virulence. Mol Microbiol. 2008;67:129–142. doi: 10.1111/j.1365-2958.2007.06031.x. [DOI] [PubMed] [Google Scholar]
  27. Vingadassalom D, Kolb A, Mayer C, Rybkine R, Collatz E, Prodglajen I. An unusual primary sigma factor in the Bacteroidetes phylum. Mol Microbiol. 2005;56:888–902. doi: 10.1111/j.1365-2958.2005.04590.x. [DOI] [PubMed] [Google Scholar]
  28. Wang Y, Rotman ER, Shoemaker NB, Salyers AA. Translational Control of Tetracycline Resistance and Conjugation in the Bacteroides Conjugative Transposon CTnDOT. J Bacteriol. 2005;187:2673–2680. doi: 10.1128/JB.187.8.2673-2680.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Whitehead TR. Development of a bifunctional xylosidase/arabinosidase gene as a reporter gene for the gram-negative anaerobes Bacteroides and Porphyromonas, and Escherichia coli. Curr Microbiol. 1997;35:282–286. doi: 10.1007/s002849900255. [DOI] [PubMed] [Google Scholar]
  30. Wu GD, Chen J, Hoffman C, Bittinger K, Chen YY, Keilbaugh SA, Bewtra M, Knights D, Walters WA, Knight R, Sinha R, Gilroy E, Gupta K, Baldassano R, Nessel L, Hongzhe L, Bushman FD, Lweis JD. Linking Long-Term Dietary Patterns with Gut Microbial Enterotypes. Science. 2011;334:105–108. doi: 10.1126/science.1208344. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

01
NIHMS368305-supplement-01.txt (17.7KB, txt)

RESOURCES