Skip to main content
The Journal of Biological Chemistry logoLink to The Journal of Biological Chemistry
. 2012 May 17;287(28):23626–23634. doi: 10.1074/jbc.M112.347195

Analysis of Nuclear Factor-κB (NF-κB) Essential Modulator (NEMO) Binding to Linear and Lysine-linked Ubiquitin Chains and Its Role in the Activation of NF-κB*

Tobias Kensche ‡,1, Fuminori Tokunaga §,¶,1, Fumiyo Ikeda ‡,2, Eiji Goto , Kazuhiro Iwai §,‖,3, Ivan Dikic ‡,4
PMCID: PMC3390637  PMID: 22605335

Background: Binding of NEMO to ubiquitin chains is essential for the activation of NF-κB.

Results: Full-length NEMO preferentially binds linear ubiquitin chains in competition with lysine-linked ubiquitin chains. NEMO binding linear di-ubiquitin is sufficient for full NF-κB activation.

Conclusion: NEMO is a high affinity receptor for linear ubiquitin chains and a low affinity receptor for long lysine-linked ubiquitin chains.

Significance: Ubiquitin binding selectivity of NEMO is crucial for understanding the NF-κB activation pathways.

Keywords: NF-κB, Signal Transduction, Tumor Necrosis Factor (TNF), Ubiquitin, Ubiquitylation, NEMO, TNF Receptor, UBAN, Linear Ubiquitin Chains

Abstract

Nuclear factor-κB (NF-κB) essential modulator (NEMO), a component of the inhibitor of κB kinase (IKK) complex, controls NF-κB signaling by binding to ubiquitin chains. Structural studies of NEMO provided a rationale for the specific binding between the UBAN (ubiquitin binding in ABIN and NEMO) domain of NEMO and linear (Met-1-linked) di-ubiquitin chains. Full-length NEMO can also interact with Lys-11-, Lys-48-, and Lys-63-linked ubiquitin chains of varying length in cells. Here, we show that purified full-length NEMO binds preferentially to linear ubiquitin chains in competition with lysine-linked ubiquitin chains of defined length, including long Lys-63-linked deca-ubiquitins. Linear di-ubiquitins were sufficient to activate both the IKK complex in vitro and to trigger maximal NF-κB activation in cells. In TNFα-stimulated cells, NEMO chimeras engineered to bind exclusively to Lys-63-linked ubiquitin chains mediated partial NF-κB activation compared with cells expressing NEMO that binds to linear ubiquitin chains. We propose that NEMO functions as a high affinity receptor for linear ubiquitin chains and a low affinity receptor for long lysine-linked ubiquitin chains. This phenomenon could explain quantitatively distinct NF-κB activation patterns in response to numerous cell stimuli.

Introduction

NF-κB transcription factors play a crucial role during development as well as in various biological functions including innate and adaptive immunity, inflammation, and cell survival (1, 2). The NF-κB signaling pathway is activated by various stimuli including LPS, TNFα, IL-1, and UV irradiation (1). It is well established that the kinase complex IKK5 is critical for the mediation of its downstream signal by phosphorylating inhibitor of κB (IκB), which leads to its subsequent degradation by the ubiquitin-proteasome system (2). The IKK complex consists of two kinases, IKKα and IKKβ, and a regulatory subunit called NEMO (3). It has been shown that NEMO is a critical component for cell survival and activation of the canonical NF-κB pathway (4, 5).

Formation of different ubiquitin chains was suggested to control compartment-specific signals necessary to activate NF-κB (6) efficiently. These ubiquitin signals are transmitted by proteins containing ubiquitin binding domains, which directly interact with mono- or polyubiquitin chains (7). For example, upon TNFα stimulation the ubiquitin ligases cellular inhibitor of apoptosis protein (cIAP)-1/2 are recruited to the TNF receptor (TNFR) complex (8), where multiple components, such as TNF receptor-associated factor 2/5, receptor-interacting protein (RIP) 1 and cIAPs, are ubiquitylated by Lys-63-, Lys-11-, or Lys-48-linked ubiquitin chains (9, 10). More recent studies have shown that an E3 ligase, linear ubiquitin chain assembly complex (LUBAC), regulates the TNF signaling pathway by linearly ubiquitylating NEMO leading to the activation of IKK kinases (11–13).

In such signaling cascades, the binding of the adaptor protein NEMO to ubiquitin chains appears to be a critical node in linking upstream ubiquitin signals with the activation of the IKK complex and subsequently the NF-κB pathway (10, 14–17). NEMO is readily precipitated in protein complexes containing highly Lys-63-polyubiquitylated substrates (18); however, these complexes involved multiple interaction surfaces, and it was not clear whether interactions between NEMO and long Lys-63-linked ubiquitin chains are direct. More recent structural and functional studies indicate that the isolated NEMO UBAN domain preferentially binds to linear ubiquitin chains, but it can also bind with lower affinity to other types of ubiquitin chains including Lys-11, Lys-48, and Lys-63, presumably when they form longer chains (10, 14). This led to the hypothesis that in addition to the linkage type also the length of the chains might be a critical determinant in NF-κB activation (19). To address these issues we have undertaken a systematic and thorough biochemical approach by purifying full-length NEMO and analyzing its binding to ubiquitin chains with different linkages and length. In addition, by utilizing engineered NEMO chimeras that recognize exclusively Lys-63-linked ubiquitin chains as well as NEMO that is permanently linearly ubiquitylated we have tested the contribution of the linkage and length of specific ubiquitin chains in the activation of the NF-κB pathway upon TNFα stimulation in vivo.

EXPERIMENTAL PROCEDURES

Plasmids, Antibodies, and Reagents

To generate linear ubiquitin-fused NEMO constructs the ORF of Arabidopsis ubiquitin, whose Gly-75 and Gly-76 were replaced by Val (ubiquitin-VV) to create an MluI site, was generated by PCR. Two to seven tandem uncleavable ubiquitin cDNAs were prepared by inserting the mutant ubiquitin encoding MluI∼BssHI into the MluI site of ubiquitin-VV. The whole nucleotide sequence was verified, and the respective tandem ubiquitin cDNA was ligated into FLAG-His6-human NEMO in pcDNA3.1 vector (Invitrogen). Full-length murine NEMO and human IκBα-WT (amino acids 1–54) and IκBα-AA (amino acid 1–54 S34A/S36A) were cloned into pMAL-C2x (New England Biolabs). Full-length murine NEMO was cloned into pGEX-4T1 (GE Healthcare) using a standard PCR method. Human TAB2-NZF was swapped with NEMO UBAN (amino acids 250–339) or ZnF (amino acids 388–412), in the full-length NEMO cloned into pBABE (described in Ref. 14) or pGEX-4T1, by site-directed mutagenesis method using mega-mutagenesis primers. Mega-mutagenesis primers were produced by PCR using the human Npl4 zinc finger (NZF) domain as template (amino acids 663–693) with oligonucleotides that contain the complementary sequence flanking the site of insertion. F305A and F312A mutations in mouse and human NEMO, respectively, were introduced by site-directed mutagenesis.

Antibodies against following proteins were obtained and used following the manufacturers' protocols: Ser(P)-32/36-IκBα (9246; Cell Signaling), phospho-IKKα/β (2681; Cell Signaling), FLAG (clone M2; Agilent), IKKα/β (sc-7607; Santa Cruz Biotechnology), or IKKα (Imgenex); MBP (sc-13564, Santa Cruz Biotechnology); ubiquitin (sc-8017; Santa Cruz Biotechnology; Fig. 3A only, or 13-1600; Invitrogen), β-actin (C-2; Santa Cruz Biotechnology), GAPDH (14C16; Cell Signaling), PARP (9542; Cell Signaling), NEMO (sc-8330; Santa Cruz Biotechnology). Antibodies against IκBα, phospho-p38, p38, phospho-JNK, JNK, and p65 were as described previously (14). Anti-FLAG M2 was purchased from Sigma. Murine TNFα was purchased from Peprotech. Bovine ubiquitin was purchased from Sigma.

FIGURE 3.

FIGURE 3.

Linear di-ubiquitin is essential and sufficient to activate the IKK complex and NF-κB. A, linear di-ubiquitin and IKK complex induce phosphorylation of IκBα in vitro. Recombinant IKKα/β and NEMO (IKKγ) complex, MBP-IκBα-WT, or MBP-IκBα-AA, and linearly, Lys-63-, or Lys-48-linked di-ubiquitin were incubated as described under “Experimental Procedures.” Phosphorylation of MBP-IκBα by IKK was detected by immunoblotting. B, linear di-ubiquitin-fused NEMO induces sufficient NF-κB activity. HEK293T cells were transfected with increasing amounts (0.01, 0.03, 0.1, 0.3, and 1.0 μg) of FLAG-NEMO-[Ub]0–7 plasmids with NF-κB luciferase reporter, and the luciferase activity was measured 24 h after transfection. C, endogenous IKKα/β bound to linear di-ubiquitin-fused NEMO were phosphorylated. HEK293T cells, transfected with the indicated plasmids, were lysed and immunoprecipitated with anti-FLAG antibody. Immunoprecipitates were separated by SDS gels and immunoblotted with anti-phospho-IKKα/β and anti-IKKα/β antibodies. D, linear ubiquitin-fused NEMO-F312A mutant does not induce sufficient NF-κB activity. HEK293T cells were transfected with increasing amounts (0.01, 0.03, 0.1, 0.3, and 1.0 μg) of FLAG-NEMO-[Ub]0–4 plasmids with NF-κB luciferase reporter, and the luciferase activity was measured 24 h after transfection.

Cell Culture, Immunoprecipitation, Immunoblotting, and Retroviral Transduction

HeLa S3 cells were cultured at 37 °C under 7.5% CO2 in Spinner flasks using S-MEM (Sigma) supplemented with 10% fetal bovine serum (FBS; Sigma), 100 IU/ml penicillin G, and 100 μg/ml streptomycin with gentle stirring, and HEK293T cells were cultured in DMEM (Sigma) containing 10% FBS, 100 IU/ml penicillin G, and 100 μg/ml streptomycin. Transfections were performed using Lipofectamine2000 (Invitrogen) or ExGen 500 (Thermo) following the manufacturer's protocols. Immunoprecipitation, electrophoresis, and immunoblotting were performed as described previously (20). Wild-type and NEMO-deficient MEF cells were described previously (5). Retroviral transduction of NEMO-deficient MEFs with pBABE NEMO constructs was described elsewhere (14).

Luciferase Assay

The luciferase reporter assay was performed as described (20). Briefly, pSP-6×NF-κB-Luc, pSV40-Renilla-Luc, and various doses of pcDNA3.1-FLAG-His6-NEMO-[Ub]0–7 were transfected to HEK293T cells. In NEMO-deficient N-1 cells (21), cells were transfected with luciferase vectors, 1 μg of pcDNA3.1-FLAG-His6-NEMO or F312A mutant, with or without LUBAC components of pcDNA3.1-myc-HOIP (0.3 μg), pcDNA3.1-HOIL-1L (0.15 μg), and pcDNA3.1-T7-SHARPIN (0.15 μg). After 24 h, cells were lysed, and luciferase activity was measured using Bright-Glo luciferase assay systems (Promega). Some N-1 cells were treated with 10 ng/ml human TNF-α (Promega) for 6 h before harvest.

Preparation of Recombinant Proteins and Cellular Extracts

Recombinant E1, UbcH5c, His6-HOIP-HOIL-1L-Myc-SHARPIN complex, and Myc-IKKα-His6-IKKβ-FLAG-NEMO complex were prepared as described (13, 20). The MBP-fused IκBα (amino acids 1–54), IκBα-AA (amino acids 1–54, S32A/S36A), and NEMO (expression in Escherichia coli BL21 containing pRARE) were expressed in E. coli and purified using amylose resin (New England Biolabs). Lys-63- and Lys-48-linked ubiquitin chains were prepared as described previously (22). For the preparation of linear ubiquitin chains, GST-di-, tri-, or tetra-ubiquitin was expressed in E. coli BL21, purified, and cleaved with thrombin protease (biotinylated thrombin kit; Novagen) according to the manufacturer's instructions. Thrombin buffer was exchanged with 50 mm Tris-HCl, pH 7.5. Other GST-fused proteins were expressed in E. coli BL21 containing pRARE and induced by isopropyl 1-thio-β-d-galactopyranoside (100 μm) at 16 °C overnight, and purified using glutathione-Sepharose 4B (GE Healthcare).

HeLa S-100 fraction II was prepared according to the method of Hershko and co-workers (23). Briefly, crude HeLa cell extracts in hypotonic buffer (10 mm Tris-HCl, pH 7.5, 1.5 mm MgCl2, 20 mm NaCl, 0.5 mm DTT, 0.5 mm PMSF) were lysed by a Dounce homogenizer, and a cytosolic fraction was prepared by ultracentrifugation at 100,000 × g for 1 h. The supernatant (S-100) was applied to a DEAE-Sepharose column. The bound fraction (fraction II), which excludes endogenous ubiquitin, was eluted with a buffer (10 mm Tris-HCl, pH 7.5, 1.5 mm MgCl2, 500 mm NaCl, 0.5 mm DTT, 0.5 mm PMSF), and dialyzed with a re-equilibrated buffer (20 mm Tris-HCl, pH 7.5, 0.1 m NaCl, 0.5 mm DTT, 0.5 mm PMSF, 1 μg/ml leupeptin).

MBP and GST Pulldown Experiments

GST- or MBP-fused proteins immobilized with Sepharose beads were incubated with 1 μg of indicated ubiquitin chains in pulldown buffer (150 mm NaCl, 50 mm Tris-HCl, pH 7.5, 5 mm DTT, 0.1% Nonidet P-40, 0.25 mg/ml BSA) at 4 °C for 16 h on a rotator, or FLAG-tagged proteins were expressed in HEK293-T cells, which were lysed 24 h after transfection and incubated with GST-proteins at 4 °C for 16 h on a rotator. The beads were washed three times with pulldown buffer without BSA. The proteins were then eluted with SDS-sample buffer and boiled at 95 °C for 1 min. The samples were separated on a 12% or 15% SDS-polyacrylamide gels and transferred to PVDF membranes.

In Vitro IKK Kinase Assay

A total of 30 μl of samples containing 10 mm Tris-HCl, pH 7.5, 5 mm MgCl2, 2 mm DTT, 0.5 mm ATP, 10 mm creatine phosphate, 50 μg/ml creatine phosphokinase, 2 mg/ml HeLa-S-100 fraction II, 250 μg/ml ubiquitin, 20 μm ubiquitin aldehyde (Boston Biochem), 100 ng of E1, 200 ng of UbcH5c, 2 μg of LUBAC, and 100 ng of MBP-IκBα or MBP-IκBα-AA were mixed and incubated at 37 °C for 1 h. Effects of di-ubiquitins on IKK activation were examined in total 20 μl of samples containing 10 mm Tris-HCl, pH 7.5, 5 mm MgCl2, 2 mm DTT, 1 mm ATP, 100 ng of IKK complex, 100 ng of MBP-IκBα or MBP-IκBα-AA, and increasing amounts (0.1, 0.3, and 1 μg) of linear-, Lys-63-, and Lys-48-di-ubiquitins. Samples were incubated at 37 °C for 1 h.

Quantitative PCR

RNA was isolated from MEFs using an RNeasy kit (Qiagen). mRNA (2 μg) was reverse transcribed to cDNA using random primer. Quantitative PCR was performed using SensiMix SYBR and Fluorescein kit (Bioline) and primer pairs specific for mouse A20 (forward primer, ctccagcctcacttccagta; reverse primer, aatacatgcagccagctttc) or mouse actin (forward primer, tgttaccaactgggacgaca; reverse primer, ggggtgttgaaggtctcaaa).

Nuclear Fractionation

Cells were first lysed in hypotonic buffer (20 mm HEPES, pH 7.9, 10 mm KCl, 1 mm EDTA, 0.2% EDTA, 10% glycerol, 1.5 mm MgCl2, 1 mm DTT, 1 mm PMSF), left on ice for 2 min, and centrifuged for 1 min at 13,000 rpm. Supernatant was collected as cytoplasmic fraction. Pellet was resuspended in 3 × pellet volume of hypertonic buffer (20 mm HEPES, pH 7.9, 10 mm KCl, 0.2 mm EDTA, 20 mm glycerol, 1.5 mm MgCl2, 400 mm NaCl, 1 mm DTT, 1 mm PMSF), kept on ice for 30 min, and centrifuged for 5 min at 13,000 rpm.

Statistical Analysis

Student's t test was performed using GraphPad Prism software.

RESULTS

Full-length NEMO Preferentially Binds to Linear Ubiquitin Chains

We have shown previously that linear di-ubiquitin binds to NEMO UBAN domain, whereas Lys-63-linked di-ubiquitin could not be detected in GST binding assays (14, 24). However, it was proposed that the C terminus of NEMO, comprising the UBAN and the ZnF, has a higher affinity toward Lys-63- and Lys-48-linked ubiquitin chains consisting of three or more ubiquitin moieties (25). To elucidate the ubiquitin binding preferences of full-length NEMO we performed in vitro binding studies with bacterially purified recombinant full-length NEMO and ubiquitin chains of different linkage types and lengths. Purified NEMO was incubated with equal concentrations of different ubiquitin chain types in the same tube, and binding of NEMO was monitored by washing off unbound chains and Western blot analysis (Fig. 1). Because ubiquitin chains of the same length but with different linkage display different mobility on SDS gels, it is possible to distinguish the different types of chains by using the same anti-ubiquitin antibody (Fig. 1). We first examined the binding preference of full-length MBP-tagged NEMO toward Lys-11-, Lys-63- and linear-tri-ubiquitin (Fig. 1A). Incubation of MBP-NEMO with these different chain types led to a selective binding of linear tri-ubiquitin in competition with the other chain types (Fig. 1A). We have shown previously that only tetra- and longer ubiquitin chains of Lys-63 linkage could be involved in binding to NEMO, and mutational analysis indicated that they bind only to distal patches on the NEMO UBAN domain compared with longitudinal arrangement of linear chains that recognizes both proximal and distal patches (14). Based on this evidence NEMO binding to linear and Lys-63-linked ubiquitin chains is competitive, and it is not possible that both are bound to NEMO at the same time. In accordance, we observed that linear tetra-ubiquitin was able to block binding of Lys-63-linked tetra-ubiquitin with GST-NEMO or MBP-NEMO in vitro (supplemental Fig. S1 and Fig. 1, B and F). In contrast to NEMO, receptor-associated protein 80 (RAP80) selectively bound to Lys-63-linked tetra-ubiquitin (Fig. 1C). This is in accordance with a previous study showing that the two ubiquitin interacting motif domains of RAP80 as a unit selectively bind Lys-63-linked but not Lys-48- or linearly linked di-ubiquitin (26). Because the length of ubiquitin chains might influence the affinity toward NEMO, we set out to analyze the binding of Lys-63-linked hexa- or hepta-ubiquitin to NEMO, in competition with linear tetra-ubiquitin (Fig. 1D). In both cases we found that NEMO selectively bound to linear tetra-ubiquitin compared with the binding to hexa- or to hepta-Lys-63-linked ubiquitin chains. Comparing the ubiquitin binding preference of NEMO with a mixture of long Lys-63-linked ubiquitin chains revealed that NEMO did not pull down Lys-63-linked chains up to at least deca-ubiquitin in the presence of linear tetra-ubiquitin (Fig. 1E). Chains that were longer than deca-ubiquitin showed interaction with NEMO despite the presence of linear tetra-ubiquitin, but because ubiquitin chains longer than deca-ubiquitin were not separated, it is not clear what size of Lys-63-linked chains was necessary for binding and also whether this precipitation of high molecular mass ubiquitin chains is a specific interaction. To get more detailed information about the ubiquitin binding preference of NEMO, we incubated 1 μg of Lys-63-linked tetra-ubiquitin together with different amounts of linearly linked tetra-ubiquitin (Fig. 1F). Interaction of NEMO with linear tetra-ubiquitin alone is rather weak (Fig. 1F). In contrast, already the addition of 20 ng of linear tetra-ubiquitin leads to a strong linear chain binding, emphasizing the high binding preference of NEMO to linear chains. The increase of binding of NEMO to linear chains correlates strongly with an increasing input where already 100 ng of linear ubiquitin chains shows a much stronger binding than Lys-63-linked ubiquitin chains, of which 1 μg was used. Moreover, the linear chains compete out the binding toward Lys-63-linked ubiquitin chains, clearly visible by a decreased Lys-63-linked chain binding, already in the presence of only 200 ng of linear ubiquitin chains. Taken together these results demonstrate the quantitative distinction in ubiquitin chain binding selectivity of full-length NEMO toward linear ubiquitin chains compared with long Lys-63-linked ubiquitin chains.

FIGURE 1.

FIGURE 1.

Full-length NEMO preferentially binds linear ubiquitin chains in competition with other chain types. A, full-length NEMO preferentially binds to linear tri-ubiquitin in competition with Lys-11- and Lys-63-linked tri-ubiquitin. MBP-NEMO was incubated with 1 μg of the indicated ubiquitin chains, and the pulldowns, together with 2% of total input, were separated by SDS-PAGE and analyzed by Western blotting with an anti-ubiquitin antibody. B, full-length NEMO preferentially binds to linear tetra-ubiquitin in competition with Lys-63-linked tetra-ubiquitin. MBP-NEMO was incubated with 1 μg of the indicated ubiquitin chains, and pulldowns and Western blot analysis were performed as in A. C, RAP80 preferentially binds to Lys-63-linked tetra-ubiquitin in competition with linear tetra-ubiquitin. GST-full-length-RAP80 was incubated with 1 μg of the indicated ubiquitin chains, and pulldowns and Western blot analysis were performed as in A. D, NEMO preferentially binds to linear tetra-ubiquitin in competition with Lys-63-linked hexa- and hepta-ubiquitin. Pulldowns and Western blot analysis were performed as in A. E, NEMO preferentially binds to linear tetra-ubiquitin in competition with Lys-63-linked ubiquitin chains of different length. Pulldowns and Western blot analysis were performed as in A. F, binding of small amounts of linear ubiquitin chains to full-length NEMO competes out binding to Lys-63-linked ubiquitin chains. MBP-NEMO was incubated with the indicated amounts of linear and Lys-63-linked ubiquitin chains, and pulldowns and Western blot analysis were performed as in A.

The E3 ligase LUBAC Activates the IKK Complex and NF-κB in a NEMO-dependent Manner

Currently reported evidence indicates that NEMO binding to linear ubiquitin chains is essential for NF-κB activation in cells (14, 17). To assess further whether linear ubiquitin chains can activate the IKK complex we investigated the effect of LUBAC-induced linear ubiquitylation on IKK activation in vitro. To this end we examined the phosphorylation of IκBα using HeLa-S-100 fraction II, lacking endogenous ubiquitin, together with E1, E2 (UbcH5c), and LUBAC, which specifically produces linear ubiquitin chains (Fig. 2A) (27). Both endogenous IκBα and exogenously added MBP-IκBα (amino acids 1–54) were efficiently phosphorylated by addition of E1, E2, and LUBAC to fraction II of HeLa S-100 lysates that contain the IKK complex and IκBα (Fig. 2A). The addition of E1 and E2 alone failed to phosphorylate IκBα (Fig. 2A), indicating a linear ubiquitin chain-dependent activation of the IKK complex.

FIGURE 2.

FIGURE 2.

The E3-ligase LUBAC activates the IKK complex and NF-κB in a NEMO-ubiquitin binding-dependent manner. A, ubiquitin ligase activity of LUBAC enhances IκBα phosphorylation. E1, UbcH5c, LUBAC, ubiquitin, and HeLa S-100 fraction II were incubated with MBP-IκBα-WT or MBP-IκBα-AA as described under “Experimental Procedures.” Phosphorylation of exogenous and endogenous IκBα was detected by immunoblotting. B, ubiquitin binding of NEMO is crucial for NF-κB activation by LUBAC. NEMO-deficient N-1 cells were transfected with plasmids with NF-κB luciferase reporter and with WT-NEMO or NEMO-F312A and either LUBAC or treated with TNFα as indicated, and the luciferase activity was measured 24 h after transfection.

Next, we wanted to examine whether LUBAC can activate NF-κB and whether this action depends on the ability of NEMO to bind ubiquitin chains. To this end we utilized from Rat-1 cells derived NEMO-deficient N-1 cells and performed a luciferase assay (Fig. 2B) (21). As expected, TNFα treatment of N-1 cells did not activate NF-κB. In contrast, N-1 cells reconstituted with human WT-NEMO showed strong NF-κB activation upon TNFα treatment. However, TNFα treatment did not activate NF-κΒ when N-1 cells were reconstituted with the NEMO-UBAN mutant F312A that cannot bind to ubiquitin. To evaluate the role of LUBAC in the activation of NF-κB in the context of NEMO-ubiquitin binding we overexpressed LUBAC in N-1 cells reconstituted with WT-NEMO or NEMO-F312A (Fig. 2B). LUBAC overexpression in N-1 cells reconstituted with WT-NEMO showed a strong activation of NF-κB, whereas NF-κB did not get activated in NEMO-deficient N-1 cells or in cells that were reconstituted with NEMO-F312A. This indicates that the binding of NEMO to LUBAC-produced linear chains is important for the activation of NF-κB.

Modification of NEMO with Linear Di-ubiquitin Is Sufficient for Full NF-κB Activation in a NEMO-UBAN-dependent Manner

Because LUBAC produces linear chains and its addition to cell lysate activates IKK, we asked whether linear ubiquitin-chains can activate the IKK complex directly and whether other chain types are able to do so. To test this we incubated di-ubiquitin chains with the purified IKK complex and analyzed its activity (Fig. 3A). Addition of purified linearly linked di-ubiquitin to the IKK complex induced phosphorylation of MBP-IκBα (Fig. 3A). This activation was specific for the linear-ubiquitin linkage because when we tested Lys-63- and Lys-48-linked di-ubiquitins, which bind with approximately 100-fold lower affinity to the UBAN domain of NEMO (14, 17), activation of the IKK complex could not be observed (Fig. 3A).

Because linear ubiquitin chains can activate the IKK complex in vitro (Fig. 3A) and di-ubiquitin is sufficient to do so, we asked whether linearly ubiquitylated NEMO can activate NF-κB in vivo and what chain length is required for efficient activation. To this end, we generated FLAG-NEMO fused with one to seven noncleavable linear ubiquitin moieties (FLAG-NEMO-Ub1–7) at the C terminus of the protein, thus mimicking the linearly ubiquitylated NEMO. Introduction of NEMO together with NF-κB luciferase reporter in HEK293T cells showed no activation of NF-κB, whereas NEMO-Ub1 partially activated NF-κB (Fig. 3B). Introduction of NEMO having two to seven linearly conjugated ubiquitins potentiated NF-κB strongly and in a similar manner, indicating that the essential unit for full activation of NF-κB is linear di-ubiquitin (Fig. 3B). As a control, GFP fused to seven linearly conjugated ubiquitins at the C terminus could not activate NF-κB (data not shown). To further validate the activation of IKK, we immunoprecipitated endogenous IKKα/β in complex with NEMO or ubiquitin-fused NEMO and checked the phosphorylation levels of IKKs (Fig. 3C). Although similar levels of endogenous IKKα/β were co-immunoprecipitated with NEMO or ubiquitin-fused NEMO, IKKα/β in combination with NEMO-Ub2 was heavily phosphorylated compared with that with NEMO or NEMO-Ub1 (Fig. 3C). The proper activation of NF-κB by linear di-ubiquitin attached to NEMO depended on the ability of NEMO to bind to ubiquitin, because when we overexpressed the ubiquitin binding-deficient mutant NEMO-F312A-Ub2, NF-κB activation was significantly weaker compared with WT-NEMO-Ub2 (compare Fig. 3, B and D). This residual NF-κB activation in cells expressing NEMO-F312A-Ub1, 2–4 was also not specific for the linear linkage as activation with NEMO-F312A-Ub4 was even weaker than with NEMO-F312A-Ub1 (Fig. 3D). To examine if the binding of IKKα or IKKβ to linear ubiquitin might be involved in the activation of the IKK-complex we overexpressed FLAG-tagged IKKα, IKKβ, or NEMO in HEK293T cells and performed a pulldown assay with GST-di- or tetra-ubiquitin (supplemental Fig. S2). Although FLAG-NEMO strongly bound to GST-di- and tetra-ubiquitin, there was no interaction of IKKα or IKKβ with linear ubiquitin chains. These results strongly suggest that conjugation of linear di-ubiquitin to NEMO in concert with the interaction of NEMO with linear di-ubiquitin induces efficient canonical IKK activation.

NEMO That Selectively Binds to Lys-63-linked Ubiquitin Chains Weakly Activates NF-κB

Previous studies proposed that complex formation between NEMO and Lys-63-linked ubiquitin chains is important for the TNFα-induced activation of NF-κB signaling (18, 28). To test whether the binding of NEMO to Lys-63-linked ubiquitin chains is sufficient to activate the NF-κB pathway, we engineered NEMO chimeras that contain the NZF domain of TAK1-binding protein (TAB)2, an exclusive binder of Lys-63-linked ubiquitin chains (29) (Fig. 4A). To this end we swapped the NEMO-ZnF with the TAB2-NZF domain in combination with or without UBAN mutation at Phe-305 (F305A-NZF-ΔZnF-K63 or NZF-ΔZnF-K63/M1, Fig. 4A). In addition, we constructed a NEMO chimera, where we replaced the UBAN of NEMO with the NZF (NZF-ΔUBAN-K63; Fig. 4A). With these selective Lys-63 binding NEMO chimeras we set out to analyze the relevance of NEMO binding to Lys-63-linked ubiquitin chains in the activation of NF-κB.

FIGURE 4.

FIGURE 4.

TAB2-NZF-containing NEMO chimeras with UBAN mutation selectively binds Lys-63-linked ubiquitin chains. A, domain structure of wild-type and different NEMO mutant constructs. Different NEMO constructs with the indicated ubiquitin binding selectivity were used to analyze ubiquitin binding and reconstitute NEMO-deficient MEFs. B, NEMO with intact UBAN has high affinity to linear ubiquitin chains and NEMO chimeras with NZF domain have high affinity to Lys-63-linked ubiquitin chains. Purified GST-tagged NEMO mutants were incubated with either Lys-63- or linearly linked ubiquitin chains, and pulldowns and Western blot analysis were performed as in Fig. 1A. WT-NEMO potently bound linear ubiquitin chains. A mutation in the UBAN (F305A) totally abolishes the binding to ubiquitin. The NZFΔUBAN-K63 mutant and the F305A-NZFΔZnF-K63 mutant only bind to Lys-63-linked ubiquitin chains, and NZFΔZnF-K63/M1-mutant binds to linearly and Lys-63-linked ubiquitin chains. C, NZF- and UBAN-containing chimeras bind Lys-63- or linearly linked ubiquitin chains with similar strength, whereas UBAN-only containing WT-NEMO selectively binds linear and NZF, but UBAN mutant NEMO proteins selectively bind Lys-63 ubiquitin chains when exposed to both chain types. Purified GST-WT and mutant NEMO proteins were incubated with 1 μg of the indicated ubiquitin chains, and pulldowns and Western blot analysis were performed as in Fig. 1A.

To first confirm the ubiquitin-binding properties of these NEMO variants we purified the respective GST fusion proteins and incubated them with linearly or Lys-63-linked tetra-ubiquitin chains (Fig. 4B). We observed an exclusive binding of the two NZF-containing chimeras F305A-NZF-ΔZnF-K63 and NZF-ΔUBAN-K63 to Lys-63-linked ubiquitin chains. On the other hand, NEMO mutant NZF-ΔZnF-K63/M1 bound to both linearly and Lys-63-linked ubiquitin chains. In contrast, GST-WT-NEMO is a selective linear ubiquitin chain binder, whereas weak binding to Lys-63-linked tetra-ubiquitin was visible only after longer exposures of the film to the Western blot membrane (data not shown). The F305A mutation abolished the binding to ubiquitin, also as shown previously (14).

To further test how these chimeras bind to different ubiquitin chain types, we performed binding competition assays with the different GST-NEMO chimeras and linearly and Lys-63-linked tetra-ubiquitin chains (Fig. 4C). Although WT-NEMO and the NZF-containing but UBAN-deficient chimeras selectively bound linearly and Lys-63-linked tetra-ubiquitin chains respectively, as expected, the NEMO mutant NZF-ΔZnF-K63/M1 bound to linearly and Lys-63-linked tetra-ubiquitin chains with similar strength.

Next, we examined whether these Lys-63-selective NEMO chimeras are able to mediate TNFα-induced NF-κB signaling by generating reconstituted NEMO-deficient MEF lines with the respective NEMO mutants or WT-NEMO (Fig. 5). In these cell lines WT-NEMO and mutants were expressed at similar levels and could form an IKK complex (supplemental Fig. S3). TNFα-induced IKK activation was then examined using the reconstituted MEFs (Fig. 5A). In NEMO-deficient MEFs reconstituted with WT-NEMO or the mutant NEMO-NZF-ΔZnF-K63/M1, we observed degradation of IκBα after treatment with TNFα for 15 min (Fig. 5A). Interestingly, MEFs, which express either NEMO-NZF-ΔUBAN-K63 or NEMO-F305A-NZF-ΔZnF-K63, showed only partial degradation of IκBα with both mutants. The impaired activation of IKK in NEMO knock-out MEFs reconstituted with NEMO-F305A mutant has been shown previously (14). These observations suggest that binding of NEMO to Lys-63-linked ubiquitin chains is not sufficient to efficiently regulate TNFα-induced activation of NF-κB signaling. To examine whether the signaling defects in NEMO mutant-expressing cells were specific for NF-κB activation, we tested the TNFR-dependent activation of MAP kinase signaling pathways (supplemental Fig. S4). As indicated by their phosphorylation, both MAP kinases p38 and JNK are activated in cells expressing WT-NEMO and NEMO chimeras, suggesting that NEMO chimeras do not nonspecifically affect other signaling functions of the TNFR.

FIGURE 5.

FIGURE 5.

Selective Lys-63-linked ubiquitin chain-binding NEMO chimeras are impaired in NF-κB activation. A, NEMO-deficient MEFs, reconstituted with linear chain binding-deficient and Lys-63-binding-selective NEMO mutants are impaired in IκBα degradation upon TNFα stimulation. NEMO-deficient MEFs stably reconstituted with different NEMO mutants were untreated or treated with TNFα (20 ng/ml) for the indicated times. The lysates were separated by SDS-PAGE, and protein content was analyzed by Western blotting. B, NEMO-deficient MEFs reconstituted with linear chain binding-deficient and Lys-63 binding-selective NEMO mutants are hampered in nuclear translocation of p65 upon TNFα stimulation. NEMO-deficient MEFs stably reconstituted with WT-NEMO or different NEMO mutants were treated with TNFα (20 ng/ml) for the indicated times. Nuclear and the cytoplasmic fractions were separated by SDS-PAGE, and the presence of p65 in the nuclear fraction was analyzed by Western blotting. Densitometrical quantification of p65 in the nuclear fraction in the shown Western blot is indicated in the graphs, where the intensity for vector (Mock) containing cells was set to 1, and the intensity of the other cell lines was related to mock. The p65 signal was measured using the software ImageJ and normalized by PARP level. C, NEMO-deficient MEFs, reconstituted with linear ubiquitin chain binding-deficient but Lys-63 binding-selective NEMO mutants are impaired in the induction of NF-κB target gene expression. NEMO-deficient MEFs stably reconstituted with different NEMO mutants were treated with TNFα (20 ng/ml) for 30 minutes, and mRNA was extracted. Quantitative PCR was performed as described under “Experimental Procedures.” Ct values of target gene A20 were normalized to Ct values of β-actin. Induction of gene expression in a cell line was determined by comparison with the expression level of the untreated sample of the same cell line. Values shown are means ± S.E. (error bars) of at least three individual experiments. *, p < 0.05, significant difference between WT-NEMO-expressing and NEMO-deficient MEFs or NEMO mutants expressing MEFs.

Next, we examined the nuclear translocation of p65 in TNFα-stimulated cells to analyze NF-κB activation in these MEFs downstream of IκBα degradation (Fig. 5B). MEFs reconstituted with WT-NEMO or NEMO-NZF-ΔZnF-K63/M1 showed strong activation of NF-κB as determined by the amount of nuclear p65 after 15 and 30 min of TNFα treatment. On the other hand, MEFs reconstituted with the ubiquitin binding-deficient F305A mutant did not mediate efficient p65 translocation. In contrast to MEFs with linear ubiquitin chain-binding NEMO, nuclear translocation of p65 was markedly impaired in MEFs expressing NEMO-NZF-ΔUBAN-K63 or NEMO-F305A-NZF-ΔZnF-K63 (Fig. 5B).

To further assess the NF-κB activation potential of Lys-63-selective NEMO chimeras, we analyzed the induction of the NF-κB target gene A20 (Fig. 5C). After 30 min of TNFα treatment, A20 gene expression was induced at 24.8 ± 2.33-fold in WT-NEMO-expressing cells and 19.1 ± 4.6-fold in NEMO-NZF-ΔZnF-K63/M1 cells compared with NEMO-deficient cells (Fig. 5C). In contrast, induction of A20 gene expression was significantly impaired in cells with Lys-63-binding NEMO or NEMO-F305 mutant (Fig. 5C). Although only WT-NEMO or the chimera that binds linear ubiquitin chains activated NF-κB properly, the Lys-63 binding-selective NEMO chimera NEMO-F305A-NZF-ΔZnF-K63 was also able to induce A20 expression at a certain level, which is significantly higher then with the non-ubiquitin-binding NEMO-F305A mutant (Fig. 5C). This is in agreement with a recent study showing that linear chain binding-deficient NEMO mutants could still partially activate NF-κB when they have a lower affinity toward Lys-63-linked ubiquitin chains (15).

DISCUSSION

Because direct NEMO-ubiquitin interactions have only been determined by using isolated NEMO fragments, we examined how full-length NEMO interacts with different types of ubiquitin chain linkages. By applying competition assays using full-length NEMO, we found that NEMO preferably binds linear ubiquitin chains compared with Lys-63- or Lys-11-linked chains, even when lysine-linked ubiquitin chains were longer than the linear chains (Fig. 1). The preference for linear ubiquitin chains is in agreement with previous studies, which showed that the NEMO-UBAN has an up to 100× higher affinity to linear di-ubiquitin over Lys-63-, or Lys-48-linked di-ubiquitin (14, 16, 17). This might suggest that in a cellular environment where different ubiquitin chain types exist, e.g. at the activated TNFR complex (10, 11, 30), NEMO will preferentially bind to linear ubiquitin chains, whereas in the absence of linear ubiquitin chains other lysine-linked chains can engage in binding to NEMO and the activation of NF-κB. In line with this, recent studies provided several lines of evidence that linear ubiquitylation by LUBAC E3 ligases is essential for the control of NF-κB signaling (11–13, 20). In the case of endogenous TNFα-receptor complexes, linear ubiquitylation was detected on RIP1 and NEMO molecules (11). The absolute quantification of ubiquitin amounts using the absolute quantification of proteins method revealed a very low abundance of linear ubiquitin chains upon overexpression of LUBAC ligase, comprising <3% of the total ubiquitin pool in untreated cells (12). This suggests that linear ubiquitin chains are tightly regulated in their production, e.g. in a compartment-specific manner and/or are forming preferentially shorter chains due to their rapid cleavage in the cellular cytosol. In this context it is interesting that linear ubiquitin chains, as short as dimer, fused to NEMO can activate NF-κB to a full extent compared with longer chains (Fig. 3). Thus, linearly linked di-ubiquitin conjugated to NEMO, due to its rather high affinity to the UBAN, constitutes an efficient and robust signal for IKK activation. On the other hand, MEFs reconstituted with NEMO chimeras harboring the highly Lys-63-selective NZF and unable to bind to linear chains led to only partial activation of NF-κB signaling (Fig. 5). This partial activation confirms that binding of NEMO to Lys-63-linked ubiquitin chains can have an effect on NF-κB activation that is quantitatively different from linear chain-dependent activation.

These results collectively suggest that NEMO can act as bi-functional ubiquitin receptor: on one side a high affinity linear ubiquitin decoder leading to an efficient activation of NF-κB and a lower affinity receptor for lysine-linked chains leading to quantitatively different patterns of NF-κB activation. Moreover, the length of the ubiquitin chains appears to be important in such pathways: linear di-ubiquitin is a sufficient signal for the full activation of NF-κB, whereas tetra- or longer lysine-linked ubiquitin chains are required for TNFα-induced activation of the NF-κB pathway. The future challenge in the field is to monitor endogenous ubiquitylation events at the activated TNFRs by using ubiquitin sensors that recognize specific chains in cells, e.g. fluorophore-tagged ubiquitin chain type-selective ubiquitin binding domains. Current data suggest that Lys-63- and Lys-11-linked ubiquitin chains are the most proximal signals conjugated to the receptor-associated complexes, whereas linear ubiquitin chains are formed following LUBAC recruitment to the TNFR complexes leading to modification of NEMO and subsequent activation on NF-κB. Dissection of dynamic changes in ubiquitin networks that control the NF-κB pathway are important for better understanding of numerous cellular processes as well as pathogenesis of human diseases including autoimmunity, cancer, and inflammation.

Acknowledgments

We thank Koraljka Husnjak and Jaime Lopez for critically reading the manuscript, the members of the Dikic laboratory for discussions and comments, and David Komander and Axel Knebel for help with ubiquitin chain purification.

*

This work was supported in part by grants-in-aid for scientific research on priority areas from the Ministry of Education, Culture, Sports, Science, and Technology, Japan and the Targeted Proteins Research Program (to K. I.).

Inline graphic

This article contains supplemental Figs. S1–S4.

5
The abbreviations used are:
IKK
inhibitor of κB kinase
LUBAC
linear ubiquitin chain assembly complex
MBP
maltose-binding protein
MEF
mouse embryonic fibroblast
NEMO
NF-κB essential modulator
NZF
Npl4 zinc finger
RAP
receptor-associated protein
RIP
receptor-interacting protein
TAB
TAK1-binding protein
TNFR
TNF receptor
Ub
ubiquitin
UBAN
ubiquitin binding in ABIN and NEMO
ZnF
zinc finger.

REFERENCES

  • 1. Wertz I. E., Dixit V. M. (2010) Signaling to NF-κB: regulation by ubiquitination. Cold Spring Harb. Perspect. Biol. 2, a003350. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Hayden M. S., Ghosh S. (2008) Shared principles in NF-κB signaling. Cell 132, 344–362 [DOI] [PubMed] [Google Scholar]
  • 3. Häcker H., Karin M. (2006) Regulation and function of IKK and IKK-related kinases. Sci. STKE 2006, re13. [DOI] [PubMed] [Google Scholar]
  • 4. Yamaoka S., Courtois G., Bessia C., Whiteside S. T., Weil R., Agou F., Kirk H. E., Kay R. J., Israël A. (1998) Complementation cloning of NEMO, a component of the IκB kinase complex essential for NF-κB activation. Cell 93, 1231–1240 [DOI] [PubMed] [Google Scholar]
  • 5. Schmidt-Supprian M., Bloch W., Courtois G., Addicks K., Israël A., Rajewsky K., Pasparakis M. (2000) NEMO/IKKγ-deficient mice model incontinentia pigmenti. Mol. Cell 5, 981–992 [DOI] [PubMed] [Google Scholar]
  • 6. Grabbe C., Husnjak K., Dikic I. (2011) The spatial and temporal organization of ubiquitin networks. Nat. Rev. Mol. Cell Biol. 12, 295–307 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Dikic I., Wakatsuki S., Walters K. J. (2009) Ubiquitin-binding domains: from structures to functions. Nat. Rev. Mol. Cell Biol. 10, 659–671 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Haas T. L., Emmerich C. H., Gerlach B., Schmukle A. C., Cordier S. M., Rieser E., Feltham R., Vince J., Warnken U., Wenger T., Koschny R., Komander D., Silke J., Walczak H. (2009) Recruitment of the linear ubiquitin chain assembly complex stabilizes the TNF-R1 signaling complex and is required for TNF-mediated gene induction. Mol. Cell 36, 831–844 [DOI] [PubMed] [Google Scholar]
  • 9. Varfolomeev E., Goncharov T., Fedorova A. V., Dynek J. N., Zobel K., Deshayes K., Fairbrother W. J., Vucic D. (2008) c-IAP1 and c-IAP2 are critical mediators of tumor necrosis factor α (TNFα)-induced NF-κB activation. J. Biol. Chem. 283, 24295–24299 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Dynek J. N., Goncharov T., Dueber E. C., Fedorova A. V., Izrael-Tomasevic A., Phu L., Helgason E., Fairbrother W. J., Deshayes K., Kirkpatrick D. S., Vucic D. (2010) c-IAP1 and UbcH5 promote K11-linked polyubiquitination of RIP1 in TNF signalling. EMBO J. 29, 4198–4209 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Gerlach B., Cordier S. M., Schmukle A. C., Emmerich C. H., Rieser E., Haas T. L., Webb A. I., Rickard J. A., Anderton H., Wong W. W., Nachbur U., Gangoda L., Warnken U., Purcell A. W., Silke J., Walczak H. (2011) Linear ubiquitination prevents inflammation and regulates immune signalling. Nature 471, 591–596 [DOI] [PubMed] [Google Scholar]
  • 12. Ikeda F., Deribe Y. L., Skånland S. S., Stieglitz B., Grabbe C., Franz-Wachtel M., van Wijk S. J., Goswami P., Nagy V., Terzic J., Tokunaga F., Androulidaki A., Nakagawa T., Pasparakis M., Iwai K., Sundberg J. P., Schaefer L., Rittinger K., Macek B., Dikic I. (2011) SHARPIN forms a linear ubiquitin ligase complex regulating NF-κB activity and apoptosis. Nature 471, 637–641 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Tokunaga F., Nakagawa T., Nakahara M., Saeki Y., Taniguchi M., Sakata S., Tanaka K., Nakano H., Iwai K. (2011) SHARPIN is a component of the NF-κB-activating linear ubiquitin chain assembly complex. Nature 471, 633–636 [DOI] [PubMed] [Google Scholar]
  • 14. Rahighi S., Ikeda F., Kawasaki M., Akutsu M., Suzuki N., Kato R., Kensche T., Uejima T., Bloor S., Komander D., Randow F., Wakatsuki S., Dikic I. (2009) Specific recognition of linear ubiquitin chains by NEMO is important for NF-κB activation. Cell 136, 1098–1109 [DOI] [PubMed] [Google Scholar]
  • 15. Hadian K., Griesbach R. A., Dornauer S., Wanger T. M., Nagel D., Metlitzky M., Beisker W., Schmidt-Supprian M., Krappmann D. (2011) NF-κB essential modulator (NEMO) interaction with linear and Lys-63 ubiquitin chains contributes to NF-κB activation. J. Biol. Chem. 286, 26107–26117 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Ivins F. J., Montgomery M. G., Smith S. J., Morris-Davies A. C., Taylor I. A., Rittinger K. (2009) NEMO oligomerization and its ubiquitin-binding properties. Biochem. J. 421, 243–251 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Lo Y. C., Lin S. C., Rospigliosi C. C., Conze D. B., Wu C. J., Ashwell J. D., Eliezer D., Wu H. (2009) Structural basis for recognition of di-ubiquitins by NEMO. Mol. Cell 33, 602–615 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Wu C. J., Conze D. B., Li T., Srinivasula S. M., Ashwell J. D. (2006) Sensing of Lys-63-linked polyubiquitination by NEMO is a key event in NF-κB activation [corrected]. Nat. Cell Biol. 8, 398–406 [DOI] [PubMed] [Google Scholar]
  • 19. Ikeda F., Crosetto N., Dikic I. (2010) What determines the specificity and outcomes of ubiquitin signaling? Cell 143, 677–681 [DOI] [PubMed] [Google Scholar]
  • 20. Tokunaga F., Sakata S., Saeki Y., Satomi Y., Kirisako T., Kamei K., Nakagawa T., Kato M., Murata S., Yamaoka S., Yamamoto M., Akira S., Takao T., Tanaka K., Iwai K. (2009) Involvement of linear polyubiquitylation of NEMO in NF-κB activation. Nat. Cell Biol. 11, 123–132 [DOI] [PubMed] [Google Scholar]
  • 21. Saito N., Courtois G., Chiba A., Yamamoto N., Nitta T., Hironaka N., Rowe M., Yamamoto N., Yamaoka S. (2003) Two carboxyl-terminal activation regions of Epstein-Barr virus latent membrane protein 1 activate NF-κB through distinct signaling pathways in fibroblast cell lines. J. Biol. Chem. 278, 46565–46575 [DOI] [PubMed] [Google Scholar]
  • 22. Komander D., Lord C. J., Scheel H., Swift S., Hofmann K., Ashworth A., Barford D. (2008) The structure of the CYLD USP domain explains its specificity for Lys-63-linked polyubiquitin and reveals a B box module. Mol. Cell 29, 451–464 [DOI] [PubMed] [Google Scholar]
  • 23. Hershko A., Heller H., Elias S., Ciechanover A. (1983) Components of ubiquitin-protein ligase system: resolution, affinity purification, and role in protein breakdown. J. Biol. Chem. 258, 8206–8214 [PubMed] [Google Scholar]
  • 24. Wagner S., Carpentier I., Rogov V., Kreike M., Ikeda F., Löhr F., Wu C. J., Ashwell J. D., Dötsch V., Dikic I., Beyaert R. (2008) Ubiquitin binding mediates the NF-κB inhibitory potential of ABIN proteins. Oncogene 27, 3739–3745 [DOI] [PubMed] [Google Scholar]
  • 25. Laplantine E., Fontan E., Chiaravalli J., Lopez T., Lakisic G., Véron M., Agou F., Israël A. (2009) NEMO specifically recognizes Lys-63-linked polyubiquitin chains through a new bipartite ubiquitin-binding domain. EMBO J. 28, 2885–2895 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Sato Y., Yoshikawa A., Mimura H., Yamashita M., Yamagata A., Fukai S. (2009) Structural basis for specific recognition of Lys-63-linked polyubiquitin chains by tandem UIMs of RAP80. EMBO J. 28, 2461–2468 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Kirisako T., Kamei K., Murata S., Kato M., Fukumoto H., Kanie M., Sano S., Tokunaga F., Tanaka K., Iwai K. (2006) A ubiquitin ligase complex assembles linear polyubiquitin chains. EMBO J. 25, 4877–4887 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Ea C. K., Deng L., Xia Z. P., Pineda G., Chen Z. J. (2006) Activation of IKK by TNFα requires site-specific ubiquitination of RIP1 and polyubiquitin binding by NEMO. Mol. Cell 22, 245–257 [DOI] [PubMed] [Google Scholar]
  • 29. Kulathu Y., Akutsu M., Bremm A., Hofmann K., Komander D. (2009) Two-sided ubiquitin binding explains specificity of the TAB2 NZF domain. Nat. Struct. Mol. Biol. 16, 1328–1330 [DOI] [PubMed] [Google Scholar]
  • 30. Bianchi K., Meier P. (2009) A tangled web of ubiquitin chains: breaking news in TNF-R1 signaling. Mol. Cell 36, 736–742 [DOI] [PubMed] [Google Scholar]

Articles from The Journal of Biological Chemistry are provided here courtesy of American Society for Biochemistry and Molecular Biology

RESOURCES