Abstract
Genetic analyses in Drosophila revealed a synergy between Notch and the pleiotropic transcription factor Mef2 (myocyte enhancer factor 2), which profoundly influences proliferation and metastasis. We show that these hyperproliferative and invasive Drosophila phenotypes are attributed to upregulation of eiger, a member of the tumour necrosis factor superfamily of ligands, and the consequent activation of Jun N-terminal kinase signalling, which in turn triggers the expression of the invasive marker MMP1. Expression studies in human breast tumour samples demonstrate correlation between Notch and Mef2 paralogues and support the notion that Notch–MEF2 synergy may be significant for modulating human mammary oncogenesis.
Keywords: JNK, Mef2, metastasis, Notch, proliferation
Introduction
The Notch signalling pathway defines one of the fundamental cell signalling mechanisms in metazoans, and is broadly responsible for controlling cell fates by profoundly affecting proliferation, differentiation and apoptosis throughout development (Artavanis-Tsakonas et al, 1999; Bray, 2006; Kopan and Ilagan, 2009; Artavanis-Tsakonas and Muskavitch, 2010). The Notch surface receptor interacts with membrane-bound ligands present on adjacent cells to trigger a proteolytic cascade that eventually cleaves the receptor and releases the intracellular domain (Nact) that subsequently translocates into the nucleus and participates in a transcriptional complex directing Notch-dependent transcription (Borggrefe and Oswald, 2009). Development of both vertebrate and invertebrate animal systems has been shown to be very sensitive to the dosage of Notch signalling. Dysregulation of Notch signalling almost invariably leads to mutant phenotypes and other human diseases including cancer (Mohr, 1919; Aster and Pear, 2001; Gridley, 2003).
The genetic circuitry capable of modulating Notch activity has been reported to be very complex (Kankel et al, 2007; Krejcí and Bray, 2007), as is common with ancient conserved pathways, where regulatory mechanisms are numerous and diverse (Bray, 2006). Abnormal activation of the pathway has been shown to be oncogenic based on the observations that Notch behaves as an oncogene and activating mutations have been detected in almost half the cases analysed of T-cell acute lymphoblastic leukaemias (T-ALLs; Ellisen et al, 1991; Weng et al, 2004). Notch mutations in other tumours remain scarce or non-existent, yet there is a growing list of solid cancers, including breast, prostate, skin, brain, lung, colon and pancreas (Ranganathan et al, 2011), where Notch activity has been positively correlated with oncogenic events.
We and others have shown that the activation of the Notch receptor can induce proliferation in a context-specific manner both in invertebrates and in vertebrates (Berry et al, 1997; Go et al, 1998; Baonza and Garcia-Bellido, 2000; Fre et al, 2005). Our own studies in the mouse intestine and mammary glands (Kiaris et al, 2004; Klinakis et al, 2006; Fre et al, 2009), however, lead to the conclusion that the activation of the Notch receptor per se is not necessarily oncogenic, but it is the synergy between Notch signals and other factors that drives proliferation, eventually leading to oncogenesis (Artavanis-Tsakonas and Muskavitch, 2010). These types of synergies may result in either the de-novo activation of new pathways or the enhancement of existing Notch target pathways, in both cases resulting in the acquisition of dramatic downstream functional changes.
We sought to identify genes that can synergize with activated forms of Notch to trigger proliferative events using genetic screens in Drosophila as our tool. Such synergies have been uncovered before in Drosophila (Moberg et al, 2005; Ferres-Marco et al, 2006; Vallejo et al, 2011), suggesting the existence of several factors that can influence proliferation through synergistic or additive effects with Notch signals.
The screen we carried out resulted in the identification of Mef2 (myocyte enhancer factor 2) as a crucial synergistic partner of Notch in triggering massive proliferation and an invasive metastatic phenotype. Mef2, a transcription factor, was first identified as a regulator of muscle gene expression (Gossett et al, 1989) that is required for myoblast differentiation (Bour et al, 1995; Lilly et al, 1995; Ranganayakulu et al, 1995) but also has broad and pleiotropic effects in development and disease (Potthoff and Olson, 2007; Homminga et al, 2011). Our mechanistic studies indicate that the synergy between Notch and Mef2 can be attributed to the activation of the Jun N-terminal kinase (JNK) signalling pathway. We furthermore show that this results in upregulation of the secreted ligand eiger, the orthologue of mammalian tumour necrosis factor (TNF) family cytokines. We examine the relevance of these results in human breast cancer samples and uncover a correlation between Notch and Mef2 human paralogues, suggesting that this synergy is likely to be relevant to human malignancies.
Results
Notch and Mef2 synergy affects proliferation
The activation of the Notch receptor has been shown to induce proliferation in Drosophila (Go et al, 1998; Baonza and Garcia-Bellido, 2000) and in vertebrates (Fre et al, 2005; van Es et al, 2005). Constitutively activated Notch is oncogenic in several distinct contexts, often in combination with other factors (Radtke and Raj, 2003; Ranganathan et al, 2011). In order to identify these factors, we sought to carry out a genetic screen for modifiers of a ‘large eye’ phenotype induced by the overexpression of a constitutively active, ligand-independent form of the Notch receptor (Nact), that has been shown to be oncogenic in mammals (Kiaris et al, 2004).
Ectopic expression of Nact in the Drosophila eye, using the eye-specific driver E1Gal4 (eyGal4), results in a large eye phenotype (Figure 1B) caused by elevated levels of cell proliferation as shown by an increase in EdU incorporation levels accompanied by slightly larger and distorted eye discs (Figure 1E). This proliferation increase is heterogeneous, resulting in spots of localized EdU incorporation within the undifferentiated (Elav-negative) cell compartment, both because of the non-homogeneous expression pattern of the E1Gal4 driver and because of context specificity. The phenotype is dosage sensitive to Notch signal modulation and, as expected, could be enhanced or suppressed using gain- and loss-of-function mutations in Notch pathway elements and could therefore be used as the experimental parameter in a genetic screen for Notch modifiers. Using the Exelixis collection of insertional mutations, which covers ∼50% of the Drosophila genome (Kankel et al, 2007), we identified two separate Gal4-driven mutations, d06622 and d03191, that strongly enhanced the large eye phenotype caused by Nact (Figure 1C).
Mapping of the insertion (Thibault et al, 2004) revealed that these mutations represent two separate gain-of-function alleles of Mef2, a pleiotropic, essential gene that belongs to the evolutionarily conserved MADS family of transcription factors implicated in the development of diverse tissues (Potthoff and Olson, 2007). Drosophila possesses a single Mef2 gene that codes for an ∼57 kilodalton protein (Nguyen et al, 2002), whereas vertebrates harbour four genes (Mef2 A, B, C, and D) (Potthoff and Olson, 2007). Western blot and immunofluorescence analyses of both alleles revealed elevated expression levels of the Mef2 protein compared with wild type, proving the nature of the mutations (Supplementary Figure S1).
Neither of the Exelixis Mef2 alleles on their own affected the adult eye morphology and the corresponding eye discs appeared wild type (Figure 1F). In contrast, coexpression of a single copy of either of these two Mef2 alleles with Nact resulted in massively overgrown discs, showing excessive EdU incorporation (Figure 1G). Expressing an Mef2 transgene caused an even stronger synergy with Nact (Supplementary Figure S1). Costaining with the neuronal differentiation marker Elav revealed that the hyperproliferative cell compartment was restricted to the anterior of the morphogenetic furrow harbouring the undifferentiated cells of the eye disc (Figure 1G).
To examine whether the observed synergy is confined to the eye or is a more general phenomenon, we extended our analysis to the developing wing and coexpressed Nact and Mef2 under two different wing-specific drivers, vgGal4 and MS1096Gal4. Compared with discs expressing the two genes individually, coexpression resulted, just as in the eye, in massively overgrown discs (Supplementary Figure S1), indicating that the synergy is not tissue specific.
Emphasizing the synergistic nature of the phenotype, only the coexpression of Nact and Mef2, not either gene alone, in somatic clones of the eye discs induced the expression of the Notch target Wingless outside of its normal expression realm (Figure 1H–J), that is, the lateral margins of the eye discs (Treisman and Rubin, 1995), releasing Notch signalling from its normal context-dependent restrictions. As in the eye, coexpression of Nact and Mef2 resulted in the synergistic activation of wingless in the wing, outside of its normal expression domain of the wing margin (Couso et al, 1994; Supplementary Figure S1). The activation of ectopic wingless by Nact and Mef2 demonstrates that these two genes together but not alone can synergistically affect downstream gene expression.
We thus conclude that it is the synergy between Nact and Mef2 that is responsible for inducing hyperproliferation and the accompanying phenotypes.
Notch and Mef2 synergy induces metastatic behaviour and MMP1 expression
In addition to hyperproliferation, coexpression of Nact and Mef2 in the eye consistently, albeit at low penetrance (∼5%), causes ectopic eyes in the thorax or abdomen (Figure 2A). Similar phenotypes in Drosophila have been previously reported and associated with invasive and metastatic behaviour (Ferres-Marco et al, 2006; Palomero et al, 2007).
Matrix metalloproteinases (MMPs) have been shown to degrade basement membrane and are thus required for the metastatic behaviour of cells in both mammals (McDonnell et al, 1991; Wang et al, 2010) and Drosophila (Uhlirova and Bohmann, 2006). Therefore, we used MMP1 as a molecular marker to further characterize the Nact and Mef2 invasive phenotype.
Wild-type wing discs show endogenous MMP1 in the trachea and a small region of the notum, consistent with previously published data (Figure 2B) (Page-McCaw et al, 2003). Expression of Nact using the wing pouch-specific driver MS1096Gal4 only occasionally causes a detectable upregulation of MMP1; however, MMP1 expression is markedly and consistently increased in Mef2 expressing wing discs (Figure 2C and D). We note that, even though Mef2 is ectopically expressed in the entire pouch region, MMP1 upregulation is seen only near the dorsal/ventral (D/V) boundary (as marked by the vg-LacZ reporter; Supplementary Figure S2A), which is also the defined area of active endogenous Notch signalling (Neumann and Cohen, 1998), suggesting that Mef2-dependent MMP1 expression may require Notch signals.
This notion was corroborated by the fact that when we inhibit endogenous Notch activity using an RNAi against Notch in the D/V boundary of discs expressing Mef2, we detected a dramatic downregulation of the ectopic MMP1 expression (Figure 2G). When Nact and Mef2 are coexpressed, MMP1 is highly upregulated throughout the entire wing disc (Figure 2E; Supplementary Figure S2B). To ensure that these observations are not specific to the MS1096Gal4 driver, we repeated this analysis using another wing driver, vgGal4, and obtained similar results.
To extend this analysis we generated somatic clones overexpressing Nact and Mef2 and, consistent with the above observations, ectopic expression of Nact alone did not induce MMP1 in clones (Figure 2H and H′). Mef2 alone induced some punctate expression of MMP1 only in clones that were located near the D/V boundary but not in clones located away from the boundary (Figure 2I and I′). On the other hand, coexpression of Nact and Mef2 resulted in high levels of MMP1 in every single clone regardless of its position relative to the D–V boundary (Figure 2J and J′). We furthermore find that the basement membrane immediately surrounding Nact+Mef2 clones is disrupted as indicated by gaps in the laminin expression pattern (Supplementary Figure S2D and D′). Thus, the synergy between Nact and Mef2 not only causes hyperproliferation but also induces MMP1 expression and basement membrane degradation.
The ectopic eye phenotype and MMP1 upregulation seen in cells coexpressing Nact and Mef2 all point to the possibility that these cells have acquired invasive characteristics. To test this hypothesis directly, we asked whether cells confined to a specific cellular compartment could be induced to cross the boundary to another compartment upon coexpression of both Nact and Mef2.
For this, we used the decapentaplegic-Gal4 (dppGal4) driver, which is expressed in the anterior compartment of the A/P boundary of the wing imaginal disc (Raftery et al, 1991); since Dpp represseses engrailed (en), cells expressing dppGal4 and En are mutually exclusive, creating, in normal wing discs, a clearly defined and contiguous A/P boundary (Sanicola et al, 1995). We used dppGal4 to express Nact and/or Mef2, along with GFP to mark dppGal4-expressing cells, and asked whether or not GFP-labelled cells could migrate away from the boundary into the En expression domain. In clones expressing Nact alone we never saw GFP-positive cells mixing with the En cells (Figure 2L and L′″). In contrast, single GFP-positive cells were seen some distance away from the A/P boundary among the En-positive cells upon overexpression of Mef2 alone (Figure 2M and M′″). These single cells may be apoptotic given their morphology, especially given that Mef2 causes an increase in caspase-3 cleavage (see data below in Figure 6). Most strikingly, when Nact and Mef2 were coexpressed, we observed larger clusters of cells invading the En domain (Figure 2N and N′″). Notably, the GFP-positive cells in these clusters did not themselves express en, indicating that they are indeed cells that have migrated out of the dppGal4 domain.
This invasive behaviour of Nact and Mef2 coexpressing cells was further explored using a larval metastasis assay established by Pagliarini and Xu (2003), in which gene expression is driven in eye discs by eyFlp; clusters of cells (which may be as small as single cells) marked with GFP are then monitored for migration into the larval body. Consistent with the dppGal4 results, Nact alone did not induce any migration of GFP-labelled cells while Mef2 expression did result in a few migrating cells (average no. of clusters=4). These primarily appeared to be single cells rather than larger clusters. This Mef2 phenotype was significantly enhanced when Nact was coexpressed, such that both the size and number of ectopic GFP-positive cell clusters was markedly increased (average no. of clusters=6) (Supplementary Figure S3).
Live imaging of GFP-labelled somatic clones coexpressing Nact and Mef2 also revealed that individual GFP-positive cells could be seen migrating away from the main cluster of cells within a 45-min timeframe (Supplementary Movie S1). In contrast, the cells in clones expressing only Nact remained as a static cluster (Supplementary Movie S2). Clones expressing Mef2 alone do not show any movement, although they do send out transient processes (Supplementary Movie S3). We note that Mef2 clones are smaller than Nact+Mef2 clones because the synergy between Nact and Mef2 results in increased proliferation and hence a larger clone; therefore, we cannot exclude the possibility that the lack of migrating cells seen in Mef2 clones could be due to decreased cell numbers, a notion that is supported by the fact that we do indeed see a few migrating Mef2 cells in the dppGal4 and larval metastasis assays.
Notch–Mef2 synergy affects epithelial integrity
A noteworthy aspect of clones coexpressing Nact and Mef2 is that they display a distinctive morphology. These clones are rounded, sometimes even forming hollow ball-shaped structures, and often appear to be protruding from the flat epithelial cell layer of the disc (Figure 3C and C′), consistent with the notion that Nact and Mef2 coexpression causes disruption of epithelial integrity, leading to metastatic cellular behaviour. We were thus prompted to examine key molecules previously linked with loss of epithelial integrity (Rodahl et al, 2009), such as actin and β-integrin.
Clones expressing Nact alone showed no detectable change in either actin or β-integrin expression (Figure 3A–A′ and D–D′). Mef2 expression caused an upregulation of actin and β-integrin levels, which was clearly further enhanced by coexpressing Nact (Figure 3B–B′). Discs large (Dlg), which normally localizes to basolateral junctions, is also upregulated and mislocalized throughout Nact+Mef2 clones, including at the apical surface (Supplementary Figure S2E and E′), raising the possibility of a loss of normal apicobasal polarity. Notably, the highest levels of actin and β-integrin were observed at the clone borders raising the possibility that these cells may have altered cell adhesion properties, which could promote formation of cellular ensembles that can thus escape the epithelial integrity of the surrounding wild-type cells.
Mef2 is linked to the JNK signalling pathway
It has been previously demonstrated that the JNK signal activation due to mutations in scribbled, a Drosophila tumour suppressor gene, causes an upregulation of MMP1, resulting in invasive cellular behaviour (Uhlirova and Bohmann, 2006). Furthermore, upregulation of JNK signalling has been linked to the control of both epithelial integrity and proliferation. We were thus led to examine whether the mechanism underlying the invasive, hyperproliferative behaviour of Nact and Mef2 cells is related to JNK signalling.
To monitor JNK signal activation, we used the transgenic reporter, puckered-lacZ (puc-LacZ) (Martín-Blanco et al, 1998). Puckered is a transcriptional target as well as a feedback inhibitor of JNK. Activating Nact alone in the D/V boundary cells using vgGal4 caused a slight upregulation of puc-LacZ (Figure 4B). In contrast, Mef2 alone led to a clear upregulation of puc-LacZ, which was significantly amplified upon coexpression of Nact (Figure 4C and D; Supplementary Figure S2C). Clonal analysis also showed the same result (Supplementary Figure S4).
Blocking the JNK pathway rescues both invasiveness and overgrowth
If JNK signalling is the crucial event downstream of the Nact and Mef2 synergy, then one might expect that blocking JNK signals should rescue the synergistic phenotype. We thus blocked the JNK pathway using a dominant-negative allele of the Drosophila JNK gene Basket, BasketDN (BskDN) (Adachi-Yamada et al, 1999). Strikingly, expression of BskDN, along with Nact and Mef2, suppressed the overproliferation phenotype, MMP1 upregulation, and puc-LacZ expression in wing discs (Figure 4F–M). BasketDN alone does not have any appreciable effect on disc size or MMP1 expression (data not shown). It therefore appears that the Nact and Mef2 synergistic phenotype is dependent upon activation of the JNK pathway.
Notch and Mef2 synergy controls the expression of a JNK pathway-activating ligand
Given that the Nact and Mef2 synergistic effects depend on JNK signals, we sought a deeper mechanistic insight into this relationship.
The only known ligand that activates the JNK pathway in Drosophila is eiger (egr), a member of the TNF superfamily (Igaki et al, 2002a, 2002b; Moreno et al, 2002). Overexpression of Egr along with Nact in wing discs resulted in a large disc phenotype very similar to that seen by coexpressing Nact and Mef2. MMP1 was also synergistically upregulated in these discs (Supplementary Figure S5), suggesting that the regulation of the JNK pathway could be at the level of the ligand. To investigate this, we performed immunofluorescence for Egr in clones overexpressing Nact and/or Mef2. Wing discs with control LacZ-expressing clones show only endogenous Egr expression in the notum region of the disc, consistent with previously published data (Figure 5A–A″; Igaki et al, 2002a, 2002b). Clones overexpressing Nact or Mef2 alone in the wing disc did not show any notable ectopic expression of Egr; however, every clone coexpressing Nact and Mef2 displayed upregulated levels of Egr (Figure 5B–D″).
To examine the role of Egr induction downstream of Nact and Mef2, we asked whether dowregulating Egr could rescue the synergistic phenotypes. Loss of both copies of egr (using the loss-of-function allele egr1) in a Nact and Mef2 overexpression background resulted in a suppression of the synergistic Nact/Mef2 overgrowth phenotype as assessed by the size of the wing disc (Figure 5H and I). There was a visually obvious decrease (in all larvae tested; n>40) in the levels of both MMP1 (Figure 5I) and puc-LacZ (data not shown), indicating that the Nact and Mef2 synergy depends on the presence of egr. In addition, the ectopic levels of MMP1 associated with Mef2 expression were also suppressed (Figure 5F and G). We thus conclude that egr is essential for the synergistic overgrowth phenotype induced by Nact and Mef2.
Examination of the DNA sequences upstream of the initiation site of egr shows binding sites for Mef2 and the transcriptional effector of Notch, Su(H) (Suppressor of Hairless). We were thus prompted to explore the possibility that the effect we observe on eiger may be mechanistically explained by a direct Notch–Mef2 synergy at the transcriptional level. A 200-bp fragment (−668 to −467) containing the putative binding sites from the eiger promoter region was examined for Mef2 and N/Su(H) binding using EMSA (electromobility shift assay). We observed a shift of the 200-bp band upon addition of protein lysate from both wild-type wing discs, which contains endogenous Notch and Mef2, and lysate from wing discs overexpressing Nact and Mef2, while the equivalent fragment in which the Mef2 and Su(H) binding sites are mutated is not shifted by the same extracts (Figure 5J). To corroborate the identity of proteins associated with the observed shift, small 30-mer oligos containing the Su(H) binding site or the Mef2 sites were subjected to supershift assays using Nact and Mef2 antibodies. These oligos show clear supershifts upon addition of their respective antibodies (Figure 5K–M; Supplementary Figure S6), consistent with the notion that the shift we observe on the 200-bp fragment is due to direct binding of N/Su(H) and Mef2.
To show that the binding sites are functionally significant, we cloned the same 200 bp eiger promoter element used in EMSA upstream of a luciferase reporter gene. Transient transfection of Nact and Mef2 together into S2R+ cells causes a 2.0-fold increase in reporter activity when compared with Nact or Mef2 alone (Supplementary Figure S6). We therefore conclude that the binding of Su(H) and Mef2 to the eiger promoter synergistically upregulates eiger expression, but we do note that testing only the 200-bp fragment may not reflect accurately the in-vivo situation.
Inhibition of the JNK pathway by Diap1 rescues the Nact+ Mef2 synergy
JNK signalling regulates various physiological processes by controlling not only proliferation but also apoptosis (Ryoo et al, 2004). Overexpression of Nact alone in the wing disc does not cause appreciable cell death as assessed by staining for cleaved caspase-3 but does, as expected, result in the upregulation of Wg, a known downstream target of Notch activity (Figure 6B–B″). Mef2 alone stimulates significant caspase-3 cleavage and a slight upregulation of Wg (Figure 6C–C″). Overexpression of Nact and Mef2 together is associated with a strong synergistic increase in Wg expression, but in this case we observe only a modest, apparently non-synergistic, induction of cleaved caspase-3 (Figure 6D–D″).
It has been previously shown that the Egr overexpression phenotype in the eye can be rescued by Drosophila inhibitor of apoptosis protein 1 (DIAP1) but not by the caspase inhibitor P-35 (Igaki et al, 2002a). Coexpression of DIAP1 together with Nact and Mef2 suppressed the overgrowth phenotype as assessed by both disc size and disc morphology and strongly reduced the domain of Wg expression to a level near that seen when Nact is expressed alone (Figure 6E–E″). Analogous P-35 expression could rescue neither disc size nor Wg activation associated with the Nact and Mef2 synergy (Figure 6F–F″). DIAP1 has been reported to suppress caspase-independent cell death (Igaki et al, 2002b), which may account for our observation that we do not observe synergistic effects on cleaved caspase-3. Taken together, our results support a model in which Nact and Mef2 activate JNK signalling to cause hyperproliferation and invasiveness in an egr-dependent manner (Figure 7).
Correlation between Notch and Mef2 in human breast tumours
The hyperproliferation and metastasis phenotype associated with the Nact and Mef2 synergy seen in Drosophila prompted us to examine the possible relevance of these findings in human breast cancer, especially in view of the fact that dysregulation of Notch receptors has been implicated in breast cancer (Pannuti et al, 2010). We thus investigated the link between the four Notch (NOTCH1–4) receptors and the four human MEF2 (MEF2A–D) genes using publicly available gene expression data derived from 484 breast cancer patients (Wang et al, 2005; Desmedt et al, 2007). Since ER+ and ER− are different disease entities, we therefore analysed correlations between NOTCH and MEF2 within each disease entity separately. For ER+ (N=343) we found significant (P<0.0001) correlations between NOTCH2 and MEF2A, r=0.23; NOTCH3 and MEF2D, r=0.23; NOTCH3 and MEF2A, r=0.22; NOTCH1 and MEF2B, r=0.22; NOTCH1 and MEF2A, r=0.21; NOTCH4 and MEF2A, r=0.31. Within ER− patients (N=141), significant (P<0.0001) correlations were found between NOTCH2 and MEF2A, r=0.32; NOTCH3 and MEF2D, r=0.21; NOTCH3 and MEF2C, r=0.22; NOTCH3 and MEF2A, r=0.22; NOTCH1 and MEF2A, r=0.23; NOTCH4 and MEF2A, r=0.27. These results suggest a moderate association between the NOTCH and MEF2 genes in breast cancers.
We focused on ER− disease, where expression of NOTCH1 has been shown to be highest (Haughian et al, 2012). Within ER− disease, we identified a striking difference between tumours that did and did not recur. NOTCH1, the orthologue of Drosophila Notch, shows a statistically significant (P<0.0001) positive correlation with all four MEF2 paralogues in tumours that recurred (r=0.41 with MEF2A, 0.39 with MEF2B, 0.29 with MEF2C and 0.27 with MEF2D, respectively). In tumours that did not recur, NOTCH1 shows a significant negative correlation with MEF2C (−0.23) and no correlation at all with the other three paralogues. This suggests that coexpression of NOTCH1 and one or more MEF2 paralogues may identify ER− tumours that are likely to relapse. We then performed Kaplan–Meier survival analysis within the subset of ER− tumours that did relapse (Supplementary Figure S7). Within this subset, NOTCH1 significantly associates with poor survival, while MEF2 paralogues by themselves do not (Supplementary Figure S7). This is consistent with the hypothesis that one or more MEF2 paralogues act as NOTCH1 cofactors in ER− tumours.
Breast metastatic lesions are seldom resected surgically. Therefore, an analysis of protein expression comparable to the gene expression analysis we performed would be very difficult. However, we generated a tissue microarray that includes 48 metastatic lesions of several types of epithelial malignancies and stained it with Notch1 and pan-MEF2 antibodies. Several types of metastatic cancers, including breast cancer that had metastasized to the lymph node, showed coexpression of Notch1 and Mef2 (Supplementary Figure S8). Again, we identified a statistically significant correlation (r=0.43 across 48 samples; P<0.0028) between expression of Notch1 and MEF2.
In conclusion, while our studies of breast cancer samples are currently only correlative and cannot prove the functional relevance of Notch–MEF2 synergy in human tumours, they parallel the Drosophila data, supporting the notion that Notch–MEF2 interactions may be significant for human mammary oncogenesis.
Discussion
We undertook a genetic modifier screen in Drosophila and identified a number of genetic modifiers of Notch signals that affect proliferation. Further examination of one of these modifiers, Mef2, established that its synergy with Notch signals directly triggers expression of the Drosophila JNK pathway ligand eiger, consequently activating JNK signalling that profoundly influences proliferation and metastatic behaviour. It might perhaps be worth noting that metastatic behaviour in Drosophila may not be completely equivalent to mammalian metastasis, notwithstanding the fact that they share molecular signatures, for example, MMP activation.
Cancer is characterized by the deregulation of the balance between differentiation, proliferation and apoptosis; thus, it is not surprising that the Notch signalling pathway, which plays a central role in all these developmental events, is increasingly implicated in oncogenic events. The rationale of our study is based on the fact that synergy between Notch and other genes is key in understanding how Notch signals contribute to oncogenesis. It remains a remarkable fact that while activating mutations in the Notch receptor have been associated with >50% of T-ALLs, a search for mutations in other cancers, despite a few suggestive reports (Ranganathan et al, 2011), remains essentially unfruitful. Yet, correlative studies have linked Notch activity with a broad spectrum of human cancers (Lee et al, 2007; Chadwick et al, 2009) and our own work in mice (Kiaris et al, 2004; Fre et al, 2009) suggests that while Notch activation promotes proliferation, it is the synergy between Notch and other factors that eventually leads to cancer. Similar synergies have been identified before (Moberg et al, 2005; Ferres-Marco et al, 2006, Vallejo et al, 2011) but the extraordinary complexity of the gene circuitry that modulates the Notch pathway (Hurlbut et al, 2009) suggests that more such relationships will be uncovered as exemplified by our discovery of Mef2 as a Notch synergistic partner affecting proliferation.
The transcription factor Mef2 plays an essential role in myogenic differentiation, but several studies have also shown a broad pleiotropic role of Mef2 (Naya and Olson, 1999; Potthoff and Olson, 2007). Mef2 can integrate signals from several signalling cascades through chromatin remodelling factors and other transcriptional regulators to control differentiation events. Our study extends the functionality of Mef2 by uncovering the profound effect it can have on proliferation and metastatic cell migration in synergy with Notch signals.
We are not the first to link Mef2 with Notch. They have been linked before in the context of myogenesis both in Drosophila and in vertebrates. A ChIP-on-chip analysis of Mef2 target regions identified several Notch pathway components as potential Mef2 targets during Drosophila myogenesis (Sandmann et al, 2006). In human myoblasts, Mef2C was suggested to bind directly to the intracellular domain of Notch via the ankyrin repeat region, suppressing Mef2C-induced myogenic differentiation (Wilson-Rawls et al, 1999). Mef2 has also been reported to interact with the Notch coactivator MAML1 and suppress differentiation (Shen et al, 2006).
While upregulation of Mef2 alone does not show overt proliferation effects, our analyses demonstrate that in vivo it can activate MMP1. Even though we ectopically expressed Mef2 in the whole wing pouch, MMP1 expression was confined around the D/V boundary, where endogenous Notch signals are active. This effect of Mef2 overexpression depends on Notch signals, a notion corroborated by the fact that inhibiting Notch activity by RNAi reverses the effects of Mef2 on MMP1.
The polarity gene scribble cooperates with Ras signalling to upregulate the JNK pathway, promoting invasiveness and hyperplasticity (Brumby and Richardson, 2003). However, the synergy seen in our study appears to be scribble independent. The fact that both the scribbled/Ras and the Notch/Mef2 metastatic pathways converge at the level of JNK signal activation suggests that JNK is a crucial regulator of oncogenic behaviour, which is controlled by inputs from multiple signals. Even though there is little evidence that twist activates JNK signalling, it is a crucial regulator of epithelial-to-mesenchymal transition and metastasis (Yang et al, 2006) and has also been independently linked to both Mef2 and Notch in myogenesis (Anant et al, 1998; Cripps et al, 1998). However, we note that the Notch–Mef2 synergy seems to be independent of twist, as Twist cannot replace Mef2 in the synergistic relationship (Supplementary Figure S9).
Numerous reports link JNK signalling to normal developmental events requiring cell movement and to metastatic phenomena both in Drosophila (Brumby and Richardson, 2003; Pastor-Pareja et al, 2004) and in vertebrates (Xia and Karin, 2004). JNK signals seem to be crucial for controlling gene activities involved in epithelial integrity and our observations from Drosophila suggest that the Nact and Mef2 synergy may be important in JNK-linked carcinogenesis. A role for Notch in controlling JNK signals has been reported previously (Zecchini et al, 1999; Kim et al, 2005). While the studies we carried out using breast cancer samples can only be correlative now, our observations suggest that metastatic breast tumours harbour higher levels of Notch and Mef2 paralogue pairs, consistent with our observations in Drosophila.
Although the majority of studies on Mef2 are focused on muscle development/differentiation, some intriguing links between Mef2C and leukaemias are noteworthy. MEF2C and Sox4 synergize to cause myeloid leukaemia in mice (Du et al, 2005). Analysis of T-ALL patient samples revealed increased levels of Mef2C; however, Mef2C alone could not cause cellular transformation of NIH3T3 cells, but it could do so in the presence of RAS or myc (Homminga et al, 2011). Given the role of Notch in T-ALL it will be important to examine how activated Notch mutations, often the causative oncogenic mutation, correlate with Mef2 family members. The functional differences between the different Mef2 homologues in humans are not well understood and the specific role each may play in the Notch synergy remains to be elucidated.
Our analysis clearly indicates that, in Drosophila, the underlying molecular mechanism of the Notch/Mef2 synergy relies on the direct upregulation of expression of the prototypical TNF ligand egr through the binding of Mef2 and Su(H), the effector of Notch signals, to regulatory sequences on the egr promoter. In Drosophila, egr is the only JNK ligand while in humans, the superfamily is large and includes the cytokines TNFα (TNF), TRAIL and RANKL which have been associated with tumour progression in numerous human cancers including breast (Balkwill and Mantovani (2001)). RANKL plays a key role in bone metastasis of breast cancer, and is the target of a therapeutically effective monoclonal antibody (Gonzalez-Suarez, 2011). In breast cancer cells, TNFα, which can signal through several pathways, including JNK and NF-κB, affects proliferation and promotes invasion and metastasis (Rubio et al, 2006).
In human breast cancer, clinical relapse after initial treatment is almost always accompanied by metastatic spread and it is almost invariably lethal. ER− tumours tend to respond well to first-line chemotherapy, but a significant subset of these tumours recur. Recurrent ER− tumours are typically resistant to chemotherapy and radiation, and are highly lethal. Our data suggest that ER− tumours that recur but not ER− tumours that do not recur show significant positive correlation between NOTCH1 and all four MEF2 paralogues. Further, our data show that even within the recurrent subset, NOTCH1 expression predicts poor survival but MEF2 expression does not. While these observations do not establish causality, they are consistent with the hypothesis that NOTCH1/MEF2 coexpression identifies a set of breast cancers that are more likely to relapse, and that MEF2 genes act as NOTCH cofactors rather than independently of NOTCH.
In conclusion, our study in Drosophila uncovers a new functional role for Mef2, which in synergy with Notch affects proliferation and metastasis. Mechanistically, this synergy relies on the direct upregulation of the JNK pathway ligand eiger. The correlation analysis and tumour staining of human cancer samples suggests that our observations in Drosophila may well be valid in humans, defining Notch–Mef2 synergy as a critical oncogenic parameter, one that may be associated with metastatic behaviour, emphasizing the value of model systems in gaining insight into human pathobiology.
Materials and methods
Fly stocks
Fly culture and crosses were carried out at 25°C. white1118 was used as wild type. UASNact/TubPGAL80 Cyo; E1Gal4 (eyGal4) virgins were crossed to males from the Exexilis collection (Thibault et al, 2004) for the modifier screen. Exelixis Mef2 lines were d06622 and d03191. Other stocks used were UASNact, UASMef2, UASGFP, UASbsk DN, UASeiger, UASp35, UASDiap1, eiger1, and pucE69. We also used E1Gal4 (gift of G Rubin), vgGal4, MS1096Gal4, hsp70-Flp, Actin5cGal4>y+>Gal4, and dppGal4. Genetic clones were generated using using hsflp; Actin5C>y+>Gal4;UASLacZ (10′, 37°C heat-shock 48–72 h AEL) for overexpression of various genes.
Immunohistochemistry and microscopy
EdU (5-ethynyl-2′-deoxyuridine) assays were performed to directly measure active DNA synthesis in third-instar imaginal discs using the Click-iT EdU Alexa Fluor 555 kit (Invitrogen). Imaginal discs were dissected from third-instar larvae and incubated in 0.1 mg/ml EdU in Schneider’s media for 20 min at room temperature. Immediately after EdU incorporation, discs were fixed in 4% formaldehyde in PBS for 20 min. EdU detection was performed according to the kit directions. Antibody staining was performed after EdU detection was completed.
For antibody stainings, third-instar larvae were dissected in PBS and fixed with 4% formaldehyde in PBS for 20 min, then permeabilized and stained in PBSTx (1 × PBS, 5 mg/ml BSA, 0.1% Triton X-100). The following primary antibodies were used: mouse anti-elav (9F8A9, 1:50; Developmental Studies Hybridoma Bank, DSHB), mouse anti-wg (4D4, 1:400; DSHB), mouse anti-MMP1 (3A6B4, 1:100; DSHB), mouse anti-β-integrin (CF.6G11, 1:100; DSHB), mouse anti-engrailed (4D9, 1:10; DSHB), rabbit anti-β-Gal (1:1,500; Cappel), Alexa Fluor 488® phalloidin (1:100; Molecular probes), rabbit anti-eiger (1:300 gift from M Miura), and rabbit anti-cleaved caspase-3 (1:300; Cell Signaling Technology).
Secondary antibodies conjugated to Alexa-488, Alexa-594, or Alexa-568 (Molecular Probes) were used at a dilution of 1:1000. Samples were analysed either by widefield fluorescence microscopy or by confocal microscopy (Nikon TE2000 w/C1 Point Scanning Confocal) and images were minimally processed using Adobe Photoshop.
Electromobility shift assays
We performed electrophoretic mobility shift assays (EMSAs) to determine whether or not Su(H) and Mef2 can bind to the eiger promoter. EMSAs were performed using the DIG Gel Shift Kit, 2nd generation (Roche applied Science). A 200-bp oligo containing the (−668 to −467) promoter region upstream from the eiger gene containing putative Notch and Mef2-binding sites was used for EMSA along with protein extracts from wild-type wing discs or wing discs coexpressing Nact and Mef2 (5 μg each). Mutated versions of the putative Notch and Mef2-binding sites in this 200 base pair sequence were synthesized by Genescript and used as negative controls. The Notch and Mef2-binding sites in the 200-bp region were mutated from GTGAGAA to ACACAGG and CTAAAAATA to AGGGGGGGC, respectively. Supershift assays were performed using 5 μg protein extracts made from either wild-type wing discs or wing discs coexpressing Nact and Mef2 and 30-mer oligos encompassing either the Su(H) binding site (GTTTAAAGTGAGAAAAGAAACCGGTAAATC) or one of the Mef2-binding sites (CCATCGGGCAAATTACTAAAAATACATAAG). Supershifts were performed using antibodies against Nact (9C6, 1:20, DSHB) and Mef2 (1:20; gift from Nguyen).
Gene expression studies on human breast tumour samples
Notch signalling has been associated with breast cancer; however, the relationship between MEF2 genes and breast cancer has not been reported. In this study we used two publicly available gene expression data sets obtained from the GEO database accession # GSE2034 and GSE7390. The two data sets included a total of 484 breast cancer patients. In all, 343 patients were ER+ while 141 were ER−. In all, 158 patients relapsed whereas 326 patients did not relapse. The goal of this analysis was to explore the potential relationship between the four NOTCH genes and the four MEF2 genes. Gene expression data were generated using the Affymetrix platform using Human Gene Chip U133A. Details of sample collection and characteristics including preparation have been described in detail by the data originators (Wang et al, 2005; Desmedt et al, 2007).
For gene expression data analysis, we partitioned the data into two subsets, ER+ and ER−, treating them as separate disease entities. On each subset of data, we analysed the correlations between the NOTCH ligands and the MEF2 genes. Within each disease entity, we further stratified the patients into breast cancer patients who did not relapse and those who relapsed and performed correlation analysis between NOTCH ligands and MEF2 genes on each subset of data separately. Estimate of correlations and Kaplan–Meier survival analysis were performed using SAS Statistical package version 9.1 (SAS Cary, NC, USA). We corrected for multiple hypothesis testing using the false discovery rate (FDR) (Benjamini and Hochberg, 1995) when comparing expression profiles of the genes between disease entities and between disease states (relapse versus no relapse) within disease entities. We also performed resampling using permutation tests to accurately estimate the P-values. However, because of the small number of genes involved, and because the goal was to assess the strength or similarity/dissimilarity in expression between genes, we did not control for multiple testing in the correlation analysis.
Supplementary Material
Acknowledgments
We are grateful to Dr H Nguyen, the Bloomington Stock Center and the DSHB for fly stocks and antibodies. We thank Kristin White for suggestions. We thank the Nikon Imaging Center and the Immune Disease Institute (Eric Marino) at HMS for microscopy help. We thank Dr He Zhu for performing, optimizing, and analysing (along with LM) the human tumour IHC array. DMH was supported by the American Cancer Society New England Division-Virginia Cochary Award for Excellence in Breast Cancer Research Postdoctoral Fellowship (PF-10-230-01-DDC). This research was partly funded by NIH Grant CA 098402 to SA-T.
Author contributions: SKP, DMH, and SA-T designed the fly experiments; SKP and DMH performed the fly experiments; and CH and LM contributed to the mammalian gene expression studies performed in human breast cancer samples.
Footnotes
The authors declare that they have no conflict of interest.
References
- Adachi-Yamada T, Fujimura-Kamada K, Nishida Y, Matsumoto K (1999) Distortion of proximodistal information causes JNK-dependent apoptosis in Drosophila wing. Nature 400: 166–169 [DOI] [PubMed] [Google Scholar]
- Anant S, Roy S, VijayRaghavan K (1998) Twist and Notch negatively regulate adult muscle differentiation in Drosophila. Development 125: 1361–1369 [DOI] [PubMed] [Google Scholar]
- Artavanis-Tsakonas S, Muskavitch MA (2010) Notch: the past, the present, and the future. Curr Top Dev Biol 92: 1–29 [DOI] [PubMed] [Google Scholar]
- Artavanis-Tsakonas S, Rand MD, Lake RJ (1999) Notch signaling: cell fate control and signal integration in development. Science 284: 770–776 [DOI] [PubMed] [Google Scholar]
- Aster JC, Pear WS (2001) Notch signaling in leukemia. Curr Opin Hematol 8: 237–244 [DOI] [PubMed] [Google Scholar]
- Balkwill F, Mantovani A (2001) Inflammation and cancer: back to Virchow? Lancet 357: 9255539–545 [DOI] [PubMed] [Google Scholar]
- Baonza A, Garcia-Bellido A (2000) Notch signaling directly controls cell proliferation in the Drosophila wing disc. Proc Natl Acad Sci USA 97: 2609–2614 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Benjamini Y, Hochberg Y (1995) Controlling the false discovery rate: a practical and powerful approach to multiple testing. J Royal Stat Society. Series B Methodol 57: 289–300 [Google Scholar]
- Berry LW, Westlund B, Schedl T (1997) Germ-line tumor formation caused by activation of glp-1, a Caenorhabditis elegans member of the Notch family of receptors. Development 124: 925–936 [DOI] [PubMed] [Google Scholar]
- Borggrefe T, Oswald F (2009) The Notch signaling pathway: transcriptional regulation at Notch target genes. Cell Mol Life Sci 66: 1631–1646 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bour BA, O’Brien MA, Lockwood WL, Goldstein ES, Bodmer R, Taghert PH, Abmayr SM, Nguyen HT (1995) Drosophila MEF2, a transcription factor that is essential for myogenesis. Genes Dev 9: 730–741 [DOI] [PubMed] [Google Scholar]
- Bray SJ (2006) Notch signalling: a simple pathway becomes complex. Nat Rev Mol Cell Biol 7: 678–689 [DOI] [PubMed] [Google Scholar]
- Brumby AM, Richardson HE (2003) scribble mutants cooperate with oncogenic Ras or Notch to cause neoplastic overgrowth in Drosophila. EMBO J 22: 5769–5779 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chadwick N, Zeef L, Portillo V, Fennessy C, Warrander F, Hoyle S, Buckle AM (2009) Identification of novel Notch target genes in T cell leukaemia. Mol Cancer 8: 35. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Couso JP, Bishop SA, Martínez Arias A (1994) The wingless signalling pathway and the patterning of the wing margin in Drosophila. Development 120: 621–636 [DOI] [PubMed] [Google Scholar]
- Cripps RM, Black BL, Zhao B, Lien CL, Schulz RA, Olson EN (1998) The myogenic regulatory gene Mef2 is a direct target for transcriptional activation by Twist during Drosophila myogenesis. Genes Dev 12: 422–434 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Desmedt C, Piette F, Loi S, Wang Y, Lallemand F, Haibe-Kains B, Viale G, Delorenzi M, Zhang Y, d’Assignies MS, Bergh J, Lidereau R, Ellis P, Harris AL, Klijn JG, Foekens JA, Cardoso F, Piccart MJ, Buyse M, Sotiriou C TRANSBIG Consortium. (2007) Strong time dependence of the 76-gene prognostic signature for node-negative breast cancer patients in the TRANSBIG Multicenter independent validation series. Clin Cancer Res 13: 3207–3217 [DOI] [PubMed] [Google Scholar]
- Du Y, Spence SE, Jenkins NA, Copeland NG (2005) Cooperating cancer-gene identification through oncogenic-retrovirus-induced insertional mutagenesis. Blood 106: 2498–2505 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ellisen LW, Bird J, West DC, Soreng AL, Reynolds TC, Smith SD, Sklar J (1991) TAN-1, the human homolog of the Drosophila notch gene, is broken by chromosomal translocations in T lymphoblastic neoplasms. Cell 66: 649–661 [DOI] [PubMed] [Google Scholar]
- Ferres-Marco D, Gutierrez-Garcia I, Vallejo DM, Bolivar J, Gutierrez-Avino FJ, Dominguez M (2006) Epigenetic silencers and Notch collaborate to promote malignant tumours by Rb silencing. Nature 439: 430–436 [DOI] [PubMed] [Google Scholar]
- Fre S, Huyghe M, Mourikis P, Robine S, Louvard D, Artavanis-Tsakonas S (2005) Notch signals control the fate of immature progenitor cells in the intestine. Nature 435: 964–968 [DOI] [PubMed] [Google Scholar]
- Fre S, Pallavi SK, Huyghe M, Lae M, Janssen KP, Robine S, Artavanis-Tsakonas S, Louvard D (2009) Notch and Wnt signals cooperatively control cell proliferation and tumorigenesis in the intestine. Proc Natl Acad Sci USA 106: 6309–6314 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Go MJ, Eastman DS, Artavanis-Tsakonas S (1998) Cell proliferation control by Notch signaling in Drosophila development. Development 125: 2031–2040 [DOI] [PubMed] [Google Scholar]
- Gonzalez-Suarez E (2011) RANKL inhibition: a promising novel strategy for breast cancer treatment. Clin Transl Oncol 13: 222–228 [DOI] [PubMed] [Google Scholar]
- Gossett LA, Kelvin DJ, Sternberg EA, Olson EN (1989) A new myocyte-specific enhancer-binding factor that recognizes a conserved element associated with multiple muscle-specific genes. Mol Cell Biol 9: 5022–5033 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gridley T (2003) Notch signaling and inherited disease syndromes. Hum Mol Genet 12: Spec No 1R9–R13 [DOI] [PubMed] [Google Scholar]
- Haughian JM, Pinto MP, Harrell JC, Bliesner BS, Joensuu KM, Dye WW, Sartorius CA, Tan AC, Heikkilä P, Perou CM, Horwitz KB (2012) Maintenance of hormone responsiveness in luminal breast cancers by suppression of Notch. Proc Natl Acad Sci USA 109: 2742–2747 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Homminga I, Pieters R, Langerak AW, de Rooi JJ, Stubbs A, Verstegen M, Vuerhard M, Buijs-Gladdines J, Kooi C, Klous P, van Vlierberghe P, Ferrando AA, Cayuela JM, Verhaaf B, Beverloo HB, Horstmann M, de Haas V, Wiekmeijer AS, Pike-Overzet K, Staal FJ et al. (2011) Integrated transcript and genome analyses reveal NKX2-1 and MEF2C as potential oncogenes in T cell acute lymphoblastic leukemia. Cancer Cell 19: 484–497 [DOI] [PubMed] [Google Scholar]
- Hurlbut GD, Kankel MW, Artavanis-Tsakonas S (2009) Nodal points and complexity of Notch-Ras signal integration. Proc Natl Acad Sci USA 106: 2218–2223 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Igaki T, Kanda H, Yamamoto-Goto Y, Kanuka H, Kuranaga E, Aigaki T, Miura M (2002a) Eiger, a TNF superfamily ligand that triggers the Drosophila JNK pathway. EMBO J 21: 3009–3018 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Igaki T, Yamamoto-Goto Y, Tokushige N, Kanda H, Miura M (2002b) Down-regulation of DIAP1 triggers a novel Drosophila cell death pathway mediated by Dark and DRONC. J Biol Chem 277: 23103–23106 [DOI] [PubMed] [Google Scholar]
- Kankel MW, Hurlbut GD, Upadhyay G, Yajnik V, Yedvobnick B, Artavanis-Tsakonas S (2007) Investigating the genetic circuitry of mastermind in Drosophila, a notch signal effector. Genetics 177: 2493–2505 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kiaris H, Politi K, Grimm LM, Szabolcs M, Fisher P, Efstratiadis A, Artavanis-Tsakonas S (2004) Modulation of notch signaling elicits signature tumors and inhibits hras1-induced oncogenesis in the mouse mammary epithelium. Am J Pathol 165: 695–705 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kim JW, Kim MJ, Kim KJ, Yun HJ, Chae JS, Hwang SG, Chang TS, Park HS, Lee KW, Han PL, Cho SG, Kim TW, Choi EJ (2005) Notch interferes with the scaffold function of JNK-interacting protein 1 to inhibit the JNK signaling pathway. Proc Natl Acad Sci USA 102: 14308–14313 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Klinakis A, Szabolcs M, Politi K, Kiaris H, Artavanis-Tsakonas S, Efstratiadis A (2006) Myc is a Notch1 transcriptional target and a requisite for Notch1-induced mammary tumorigenesis in mice. Proc Natl Acad Sci USA 103: 9262–9267 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kopan R, Ilagan MX (2009) The canonical Notch signaling pathway: unfolding the activation mechanism. Cell 137: 216–233 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Krejcí A, Bray S (2007) Notch activation stimulates transient and selective binding of Su(H)/CSL to target enhancers. Genes Dev 21: 1322–1327 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lee SH, Jeong EG, Yoo NJ (2007) Mutational analysis of NOTCH1, 2, 3 and 4 genes in common solid cancers and acute leukemias. APMIS 115: 1357–1363 [DOI] [PubMed] [Google Scholar]
- Lilly B, Zhao B, Ranganayakulu G, Paterson BM, Schulz RA, Olson EN (1995) Requirement of MADS domain transcription factor D-MEF2 for muscle formation in Drosophila. Science 267: 688–693 [DOI] [PubMed] [Google Scholar]
- Martin-Blanco E, Gampel A, Ring J, Virdee K, Kirov N, Tolkovsky AM, Martinez-Arias A (1998) puckered encodes a phosphatase that mediates a feedback loop regulating JNK activity during dorsal closure in Drosophila. Genes Dev 12: 557–570 [DOI] [PMC free article] [PubMed] [Google Scholar]
- McDonnell S, Navre M, Coffey RJ Jr., Matrisian LM (1991) Expression and localization of the matrix metalloproteinase pump-1 (MMP-7) in human gastric and colon carcinomas. Mol Carcinog 4: 527–533 [DOI] [PubMed] [Google Scholar]
- Moberg KH, Schelble S, Burdick SK, Hariharan IK (2005) Mutations in erupted, the Drosophila ortholog of mammalian tumor susceptibility gene 101, elicit non-cell-autonomous overgrowth. Dev Cell 9: 699–710 [DOI] [PubMed] [Google Scholar]
- Mohr OL (1919) Character Changes Caused by Mutation of an Entire Region of a Chromosome in Drosophila. Genetics 4: 275–282 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Moreno E, Yan M, Basler K (2002) Evolution of TNF signaling mechanisms: JNK-dependent apoptosis triggered by Eiger, the Drosophila homolog of the TNF superfamily. Curr Biol 12: 1263–1268 [DOI] [PubMed] [Google Scholar]
- Naya FJ, Olson E (1999) MEF2: a transcriptional target for signaling pathways controlling skeletal muscle growth and differentiation. Curr Opin Cell Biol 11: 683–688 [DOI] [PubMed] [Google Scholar]
- Neumann CJ, Cohen SM (1998) Boundary formation in Drosophila wing: Notch activity attenuated by the POU protein Nubbin. Science 281: 409–413 [DOI] [PubMed] [Google Scholar]
- Nguyen T, Wang J, Schulz RA (2002) Mutations within the conserved MADS box of the D-MEF2 muscle differentiation factor result in a loss of DNA binding ability and lethality in Drosophila. Differentiation 70: 438–446 [DOI] [PubMed] [Google Scholar]
- Page-McCaw A, Serano J, Sante JM, Rubin GM (2003) Drosophila matrix metalloproteinases are required for tissue remodeling, but not embryonic development. Dev Cell 4: 95–106 [DOI] [PubMed] [Google Scholar]
- Pagliarini RA, Xu T (2003) A genetic screen in Drosophila for metastatic behavior. Science 302: 1227–1231 [DOI] [PubMed] [Google Scholar]
- Palomero T, Sulis ML, Cortina M, Real PJ, Barnes K, Ciofani M, Caparros E, Buteau J, Brown K, Perkins SL, Bhagat G, Agarwal AM, Basso G, Castillo M, Nagase S, Cordon-Cardo C, Parsons R, Zuniga-Pflucker JC, Dominguez M, Ferrando AA (2007) Mutational loss of PTEN induces resistance to NOTCH1 inhibition in T-cell leukemia. Nat Med 13: 1203–1210 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pannuti A, Foreman K, Rizzo P, Osipo C, Golde T, Osborne B, Miele L (2010) Targeting Notch to target cancer stem cells. Clin Cancer Res 16: 3141–3152 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pastor-Pareja JC, Grawe F, Martin-Blanco E, Garcia-Bellido A (2004) Invasive cell behavior during Drosophila imaginal disc eversion is mediated by the JNK signaling cascade. Dev Cell 7: 387–399 [DOI] [PubMed] [Google Scholar]
- Potthoff MJ, Olson EN (2007) MEF2: a central regulator of diverse developmental programs. Development 134: 4131–4140 [DOI] [PubMed] [Google Scholar]
- Radtke F, Raj K (2003) The role of Notch in tumorigenesis: oncogene or tumour suppressor? Nat Rev Cancer 3: 756–767 [DOI] [PubMed] [Google Scholar]
- Raftery LA, Sanicola M, Blackman RK, Gelbart WM (1991) The relationship of decapentaplegic and engrailed expression in Drosophila imaginal disks: do these genes mark the anterior-posterior compartment boundary? Development 113: 27–33 [DOI] [PubMed] [Google Scholar]
- Ranganathan P, Weaver KL, Capobianco AJ (2011) Notch signalling in solid tumours: a little bit of everything but not all the time. Nat Rev Cancer 11: 338–351 [DOI] [PubMed] [Google Scholar]
- Ranganayakulu G, Zhao B, Dokidis A, Molkentin JD, Olson EN, Schulz RA (1995) A series of mutations in the D-MEF2 transcription factor reveal multiple functions in larval and adult myogenesis in Drosophila. Dev Biol 171: 169–181 [DOI] [PubMed] [Google Scholar]
- Rodahl LM, Haglund K, Sem-Jacobsen C, Wendler F, Vincent JP, Lindmo K, Rusten TE, Stenmark H (2009) Disruption of Vps4 and JNK function in Drosophila causes tumour growth. PLoS One 4: e4354. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rubio MF, Werbajh S, Cafferata EG, Quaglino A, Colo GP, Nojek IM, Kordon EC, Nahmod VE, Costas MA (2006) TNF-alpha enhances estrogen-induced cell proliferation of estrogen-dependent breast tumor cells through a complex containing nuclear factor-kappa B. Oncogene 25: 1367–1377 [DOI] [PubMed] [Google Scholar]
- Ryoo HD, Gorenc T, Steller H (2004) Apoptotic cells can induce compensatory cell proliferation through the JNK and the Wingless signaling pathways. Dev Cell 7: 491–501 [DOI] [PubMed] [Google Scholar]
- Sandmann T, Jensen LJ, Jakobsen JS, Karzynski MM, Eichenlaub MP, Bork P, Furlong EE (2006) A temporal map of transcription factor activity: mef2 directly regulates target genes at all stages of muscle development. Dev Cell 10: 797–807 [DOI] [PubMed] [Google Scholar]
- Sanicola M, Sekelsky J, Elson S, Gelbart WM (1995) Drawing a stripe in Drosophila imaginal disks: negative regulation of decapentaplegic and patched expression by engrailed. Genetics 139: 745–756 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shen H, McElhinny AS, Cao Y, Gao P, Liu J, Bronson R, Griffin JD, Wu L (2006) The Notch coactivator, MAML1, functions as a novel coactivator for MEF2C-mediated transcription and is required for normal myogenesis. Genes Dev 20: 675–688 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Thibault ST, Singer MA, Miyazaki WY, Milash B, Dompe NA, Singh CM, Buchholz R, Demsky M, Fawcett R, Francis-Lang HL, Ryner L, Cheung LM, Chong A, Erickson C, Fisher WW, Greer K, Hartouni SR, Howie E, Jakkula L, Joo D et al. (2004) A complementary transposon tool kit for Drosophila melanogaster using P and piggyBac. Nat Genet 36: 283–287 [DOI] [PubMed] [Google Scholar]
- Treisman JE, Rubin GM (1995) wingless inhibits morphogenetic furrow movement in the Drosophila eye disc. Development 121: 3519–3527 [DOI] [PubMed] [Google Scholar]
- Uhlirova M, Bohmann D (2006) JNK- and Fos-regulated Mmp1 expression cooperates with Ras to induce invasive tumors in Drosophila. EMBO J 25: 5294–5304 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Vallejo DM, Caparros E, Dominguez M (2011) Targeting Notch signalling by the conserved miR-8/200 microRNA family in development and cancer cells. EMBO J 30: 756–769 [DOI] [PMC free article] [PubMed] [Google Scholar]
- van Es JH, van Gijn ME, Riccio O, van den Born M, Vooijs M, Begthel H, Cozijnsen M, Robine S, Winton DJ, Radtke F, Clevers H (2005) Notch/gamma-secretase inhibition turns proliferative cells in intestinal crypts and adenomas into goblet cells. Nature 435: 959–963 [DOI] [PubMed] [Google Scholar]
- Wang FQ, Fisher J, Fishman DA (2010) MMP-1-PAR1 axis mediates LPA-induced epithelial ovarian cancer (EOC) invasion. Gynecol Oncol 120: 247–255 [DOI] [PubMed] [Google Scholar]
- Wang Y, Klijn JG, Zhang Y, Sieuwerts AM, Look MP, Yang F, Talantov D, Timmermans M, Meijer-van Gelder ME, Yu J, Jatkoe T, Berns EM, Atkins D, Foekens JA (2005) Gene-expression profiles to predict distant metastasis of lymph-node-negative primary breast cancer. Lancet 365: 671–679 [DOI] [PubMed] [Google Scholar]
- Weng AP, Ferrando AA, Lee W, Morris JP 4th, Silverman LB, Sanchez-Irizarry C, Blacklow SC, Look AT, Aster JC (2004) Activating mutations of NOTCH1 in human T cell acute lymphoblastic leukemia. Science 306: 269–271 [DOI] [PubMed] [Google Scholar]
- Wilson-Rawls J, Molkentin JD, Black BL, Olson EN (1999) Activated notch inhibits myogenic activity of the MADS-Box transcription factor myocyte enhancer factor 2C. Mol Cell Biol 19: 2853–2862 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xia Y, Karin M (2004) The control of cell motility and epithelial morphogenesis by Jun kinases. Trends Cell Biol 14: 94–101 [DOI] [PubMed] [Google Scholar]
- Yang J, Mani SA, Weinberg RA (2006) Exploring a new twist on tumour metastasis. Cancer Res 66: 4549–4552 [DOI] [PubMed] [Google Scholar]
- Zecchini V, Brennan K, Martinez-Arias A (1999) An activity of Notch regulates JNK signalling and affects dorsal closure in Drosophila. Curr Biol 9: 460–469 [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.