Skip to main content
Nucleic Acids Research logoLink to Nucleic Acids Research
. 1986 May 27;14(10):4113–4125. doi: 10.1093/nar/14.10.4113

Structural features of the murine dihydrofolate reductase transcription termination region: identification of a conserved DNA sequence element.

E G Frayne, R E Kellems
PMCID: PMC339849  PMID: 3714472

Abstract

Structural features of the transcription termination region for the mouse dihydrofolate reductase gene have been determined and compared with those of several other known termination regions for protein coding genes. A common feature identified among these termination regions was the presence of a 20 bp consensus DNA sequence element (ATCAGAATATAGGAAAGTAGCAAT). The results imply that the 20 bp consensus DNA sequence element is important for signaling RNA polymerase II transcription termination at least in the several vertebrate species investigated. Furthermore, the results suggest that for the dhfr gene and possibly for other genes in mice as well, the potential termination consensus sequence can exist as part of a long interspersed repetitive DNA element.

Full text

PDF
4113

Images in this article

Selected References

These references are in PubMed. This may not be the complete list of references from this article.

  1. Acheson N. H. Kinetics and efficiency of polyadenylation of late polyomavirus nuclear RNA: generation of oligomeric polyadenylated RNAs and their processing into mRNA. Mol Cell Biol. 1984 Apr;4(4):722–729. doi: 10.1128/mcb.4.4.722-729.1984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Adeniyi-Jones S., Romeo P. H., Zasloff M. Generation of long read-through transcripts in vivo and in vitro by deletion of 3' termination and processing sequences in the human tRNAimet gene. Nucleic Acids Res. 1984 Jan 25;12(2):1101–1115. doi: 10.1093/nar/12.2.1101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bakken A., Morgan G., Sollner-Webb B., Roan J., Busby S., Reeder R. H. Mapping of transcription initiation and termination signals on Xenopus laevis ribosomal DNA. Proc Natl Acad Sci U S A. 1982 Jan;79(1):56–60. doi: 10.1073/pnas.79.1.56. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Birchmeier C., Schümperli D., Sconzo G., Birnstiel M. L. 3' editing of mRNAs: sequence requirements and involvement of a 60-nucleotide RNA in maturation of histone mRNA precursors. Proc Natl Acad Sci U S A. 1984 Feb;81(4):1057–1061. doi: 10.1073/pnas.81.4.1057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Birnstiel M. L., Busslinger M., Strub K. Transcription termination and 3' processing: the end is in site! Cell. 1985 Jun;41(2):349–359. doi: 10.1016/s0092-8674(85)80007-6. [DOI] [PubMed] [Google Scholar]
  6. Bogenhagen D. F., Brown D. D. Nucleotide sequences in Xenopus 5S DNA required for transcription termination. Cell. 1981 Apr;24(1):261–270. doi: 10.1016/0092-8674(81)90522-5. [DOI] [PubMed] [Google Scholar]
  7. Brown S. D., Piechaczyk M. Insertion sequences and tandem repetitions as sources of variation in a dispersed repeat family. J Mol Biol. 1983 Apr 5;165(2):249–256. doi: 10.1016/s0022-2836(83)80256-3. [DOI] [PubMed] [Google Scholar]
  8. Citron B., Falck-Pedersen E., Salditt-Georgieff M., Darnell J. E., Jr Transcription termination occurs within a 1000 base pair region downstream from the poly(A) site of the mouse beta-globin (major) gene. Nucleic Acids Res. 1984 Nov 26;12(22):8723–8731. doi: 10.1093/nar/12.22.8723. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Cozzarelli N. R., Gerrard S. P., Schlissel M., Brown D. D., Bogenhagen D. F. Purified RNA polymerase III accurately and efficiently terminates transcription of 5S RNA genes. Cell. 1983 Oct;34(3):829–835. doi: 10.1016/0092-8674(83)90540-8. [DOI] [PubMed] [Google Scholar]
  10. Crouse G. F., Leys E. J., McEwan R. N., Frayne E. G., Kellems R. E. Analysis of the mouse dhfr promoter region: existence of a divergently transcribed gene. Mol Cell Biol. 1985 Aug;5(8):1847–1858. doi: 10.1128/mcb.5.8.1847-1858.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Crouse G. F., Simonsen C. C., McEwan R. N., Schimke R. T. Structure of amplified normal and variant dihydrofolate reductase genes in mouse sarcoma S180 cells. J Biol Chem. 1982 Jul 10;257(13):7887–7897. [PubMed] [Google Scholar]
  12. Dubnick M., Chou J., Petes T. D., Farber R. A. Relationships among DNA sequences of the 1.3 kb EcoRI family of mouse DNA. J Mol Evol. 1983;19(2):115–121. doi: 10.1007/BF02300749. [DOI] [PubMed] [Google Scholar]
  13. Falck-Pedersen E., Logan J., Shenk T., Darnell J. E., Jr Transcription termination within the E1A gene of adenovirus induced by insertion of the mouse beta-major globin terminator element. Cell. 1985 Apr;40(4):897–905. doi: 10.1016/0092-8674(85)90349-6. [DOI] [PubMed] [Google Scholar]
  14. Farnham P. J., Abrams J. M., Schimke R. T. Opposite-strand RNAs from the 5' flanking region of the mouse dihydrofolate reductase gene. Proc Natl Acad Sci U S A. 1985 Jun;82(12):3978–3982. doi: 10.1073/pnas.82.12.3978. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Frayne E. G., Leys E. J., Crouse G. F., Hook A. G., Kellems R. E. Transcription of the mouse dihydrofolate reductase gene proceeds unabated through seven polyadenylation sites and terminates near a region of repeated DNA. Mol Cell Biol. 1984 Dec;4(12):2921–2924. doi: 10.1128/mcb.4.12.2921-2924.1984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Gebhard W., Zachau H. G. Organization of the R family and other interspersed repetitive DNA sequences in the mouse genome. J Mol Biol. 1983 Oct 25;170(2):255–270. doi: 10.1016/s0022-2836(83)80147-8. [DOI] [PubMed] [Google Scholar]
  17. Hagenbüchle O., Wellauer P. K., Cribbs D. L., Schibler U. Termination of transcription in the mouse alpha-amylase gene Amy-2a occurs at multiple sites downstream of the polyadenylation site. Cell. 1984 Oct;38(3):737–744. doi: 10.1016/0092-8674(84)90269-1. [DOI] [PubMed] [Google Scholar]
  18. Henikoff S., Cohen E. H. Sequences responsible for transcription termination on a gene segment in Saccharomyces cerevisiae. Mol Cell Biol. 1984 Aug;4(8):1515–1520. doi: 10.1128/mcb.4.8.1515-1520.1984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Henikoff S., Kelly J. D., Cohen E. H. Transcription terminates in yeast distal to a control sequence. Cell. 1983 Jun;33(2):607–614. doi: 10.1016/0092-8674(83)90441-5. [DOI] [PubMed] [Google Scholar]
  20. Holmes W. M., Platt T., Rosenberg M. Termination of transcription in E. coli. Cell. 1983 Apr;32(4):1029–1032. doi: 10.1016/0092-8674(83)90287-8. [DOI] [PubMed] [Google Scholar]
  21. Krieg P. A., Melton D. A. Formation of the 3' end of histone mRNA by post-transcriptional processing. Nature. 1984 Mar 8;308(5955):203–206. doi: 10.1038/308203a0. [DOI] [PubMed] [Google Scholar]
  22. LeMeur M. A., Galliot B., Gerlinger P. Termination of the ovalbumin gene transcription. EMBO J. 1984 Dec 1;3(12):2779–2786. doi: 10.1002/j.1460-2075.1984.tb02209.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Mather E. L., Nelson K. J., Haimovich J., Perry R. P. Mode of regulation of immunoglobulin mu- and delta-chain expression varies during B-lymphocyte maturation. Cell. 1984 Feb;36(2):329–338. doi: 10.1016/0092-8674(84)90226-5. [DOI] [PubMed] [Google Scholar]
  24. Moore C. L., Sharp P. A. Accurate cleavage and polyadenylation of exogenous RNA substrate. Cell. 1985 Jul;41(3):845–855. doi: 10.1016/s0092-8674(85)80065-9. [DOI] [PubMed] [Google Scholar]
  25. Neumaier P. S., Zachau H. G. Nucleotide sequence of a region downstream of the mouse CK immunoglobulin gene. Nucleic Acids Res. 1983 Jun 11;11(11):3631–3636. doi: 10.1093/nar/11.11.3631. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Nevins J. R., Darnell J. E., Jr Steps in the processing of Ad2 mRNA: poly(A)+ nuclear sequences are conserved and poly(A) addition precedes splicing. Cell. 1978 Dec;15(4):1477–1493. doi: 10.1016/0092-8674(78)90071-5. [DOI] [PubMed] [Google Scholar]
  27. Queen C., Korn L. J. A comprehensive sequence analysis program for the IBM personal computer. Nucleic Acids Res. 1984 Jan 11;12(1 Pt 2):581–599. doi: 10.1093/nar/12.1part2.581. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Rohrbaugh M. L., Johnson J. E., 3rd, James M. D., Hardison R. C. Transcription unit of the rabbit beta 1 globin gene. Mol Cell Biol. 1985 Jan;5(1):147–160. doi: 10.1128/mcb.5.1.147-160.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Sanger F., Nicklen S., Coulson A. R. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci U S A. 1977 Dec;74(12):5463–5467. doi: 10.1073/pnas.74.12.5463. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Shinozaki K., Sugiura M. Sequence of the intercistronic region between the ribulose-1, 5-bisphosphate carboxylase/oxygenase large subunit and coupling factor beta subunit gene. Nucleic Acids Res. 1982 Aug 25;10(16):4923–4934. doi: 10.1093/nar/10.16.4923. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Singer M. F., Thayer R. E., Grimaldi G., Lerman M. I., Fanning T. G. Homology between the KpnI primate and BamH1 (M1F-1) rodent families of long interspersed repeated sequences. Nucleic Acids Res. 1983 Aug 25;11(16):5739–5745. doi: 10.1093/nar/11.16.5739. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Sutton A., Broach J. R. Signals for transcription initiation and termination in the Saccharomyces cerevisiae plasmid 2 micron circle. Mol Cell Biol. 1985 Oct;5(10):2770–2780. doi: 10.1128/mcb.5.10.2770-2780.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Venkatesan S., Baroudy B. M., Moss B. Distinctive nucleotide sequences adjacent to multiple initiation and termination sites of an early vaccinia virus gene. Cell. 1981 Sep;25(3):805–813. doi: 10.1016/0092-8674(81)90188-4. [DOI] [PubMed] [Google Scholar]
  34. Zaret K. S., Sherman F. DNA sequence required for efficient transcription termination in yeast. Cell. 1982 Mar;28(3):563–573. doi: 10.1016/0092-8674(82)90211-2. [DOI] [PubMed] [Google Scholar]
  35. von Hippel P. H., Bear D. G., Morgan W. D., McSwiggen J. A. Protein-nucleic acid interactions in transcription: a molecular analysis. Annu Rev Biochem. 1984;53:389–446. doi: 10.1146/annurev.bi.53.070184.002133. [DOI] [PubMed] [Google Scholar]

Articles from Nucleic Acids Research are provided here courtesy of Oxford University Press

RESOURCES