Abstract
Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by multiple functional alterations affecting immune cells, such as B cells, T cells, dendritic cells (DCs) and monocytes. During SLE, the immunogenicity of monocytes and DCs is significantly up-regulated, promoting the activation of self-reactive T cells. Accordingly, it is important to understand the contribution of these cells to the pathogenesis of SLE and the mechanisms responsible for their altered functionality during disease. One of the key enzymes that control monocyte and DC function is haem oxygenase-1 (HO-1), which catalyses the degradation of the haem group into biliverdin, carbon monoxide and free iron. These products possess immunosuppressive and anti-inflammatory capacities. The main goal of this work was to determine HO-1 expression in monocytes and DCs from patients with SLE and healthy controls. Hence, peripheral blood mononuclear cells were obtained from 43 patients with SLE and 30 healthy controls. CD14+ monocytes and CD4+ T cells were sorted by FACS and HO-1 expression was measured by RT-PCR. In addition, HO-1 protein expression was determined by FACS. HO-1 levels in monocytes were significantly reduced in patients with SLE compared with healthy controls. These results were confirmed by flow cytometry. No differences were observed in other cell types, such as DCs or CD4+ T cells, although decreased MHC-II levels were observed in DCs from patients with SLE. In conclusion, we found a significant decrease in HO-1 expression, specifically in monocytes from patients with SLE, suggesting that an imbalance of monocyte function could be partly the result of a decrease in HO-1 expression.
Keywords: haem oxygenase-1, monocyte, systemic lupus erythematosus
Introduction
Systemic lupus erythematosus (SLE) is a chronic autoimmune disease of unknown aetiology, characterized by, among other findings, the presence of autoantibodies against double-stranded DNA, nucleosomes, ribonucleoproteins and other nuclear components, as well as by the presence of circulating DNA and nucleosomes in peripheral blood.1–3 Multi-organ compromise may arise as a consequence of the deposition of immune complexes in blood vessels, which leads to macrophage and complement activation, inflammation and tissue damage.4–7 Abnormalities in almost every component of the immune system have been described in patients with SLE and in mouse models of SLE, including the presence of activated autoreactive CD4+ T cells that drive the subsequent activation of self-reactive B cells, leading to the production of autoantibodies.8–10 In addition, peripheral blood monocytes derived from patients with SLE display an abnormal phenotype, characterized by deregulated expression of HLA-DR and CD14, which could lead to defects in antigen presentation by monocyte-derived antigen-presenting cells, such as dendritic cells (DCs) or macrophages.11,12 These alterations are likely to contribute to autoreactive T-cell priming during the onset of SLE.12–15 Accordingly, expression of co-stimulatory molecules that are essential for T-cell activation, such as CD86, is significantly increased in monocytes and DCs from patients with SLE, compared with healthy individuals.16 We have previously shown that monocyte-derived DCs from patients with SLE display higher expression ratios of activating over inhibitory Fcγ receptors (FcγRs), promoting the presentation of autoantigens derived from immune complexes to previously activated self-reactive T cells and perpetuating T-cell activation.17 Hence, an unbalanced expression of activator/inhibitory molecules in monocytes and DCs could contribute to maintaining SLE pathogenesis.17,18
Haem oxygenases (HO) are microsomal enzymes that catalyse the degradation of the haem group into biliverdin, free iron and carbon monoxide (CO).19 Biliverdin is rapidly reduced to bilirubin by the enzyme biliverdin reductase and free iron is removed by ferritin, which produces a depletion in the intracellular free iron.20 Until now, three HO isoforms have been described and designated HO-1, HO-2 and HO-3.21–24 HO-1 is the only inducible stress-responsive isoform of which the expression is induced by a variety of stimuli including haem, heavy metals, inflammatory cytokines and nitric oxide, acting as a cytoprotective protein.20,25 Biliverdin and its metabolite, bilirubin, are known for their antioxidant and immunosuppressive capacity.26,27 In addition, CO has been shown to down-modulate immune responses in a variety of physiological and pathophysiological processes and it is thought to mediate most of the immunomodulatory effects of HO-1.28,29 In humans, HO-1 has been shown to be expressed in several immune cells, including DCs and monocytes.30,31 In these cells, HO-1 expression has been related to inmunosuppressive and anti-apoptotic functions.30,31 Moreover, there is an increase in HO-1 expression in monocytes during acute inflammatory diseases, which could serve as a potent anti-inflammatory stimulus to control excessive cell or tissue injury.32 Hence, HO-1 expression in monocytes and DCs could contribute to down-modulating immune inflammation. Therefore, it is possible that a decrease in HO-1 expression could exacerbate immune responses, enhancing susceptibility to developing autoimmune diseases, such as SLE.24
Here, we have evaluated HO-1 expression in monocytes, CD4+ T cells and DCs from patients with SLE and healthy donors. Our data show that HO-1 expression is significantly reduced in monocytes from patients with SLE, compared with healthy donors. No significant differences in HO-1 expression were observed in DCs or CD4+ T cells from patients, compared with healthy controls. Despite reduced expression of HO-1 in patients with SLE, the expression level did not significantly correlate with disease activity. These data suggest that HO-1 deregulation may be involved during the initial steps of SLE development contributing to a general mechanism for tolerance breaking, rather than participating in the progression of disease. Taken together, these observations underscore a potential role of HO-1 in monocyte function and SLE onset.
Material and methods
Antibodies and reagents
Fluorescein isothiocyanate-conjugated anti-human/mouse HO-1 monoclonal antibody (clone 13248) was purchased from Abcam (Cambridge, UK). Phycoerythrin (PE) -conjugated anti-CD11c (clone B-ly6), anti-CD14 (clone M5E2), IgG-γ1 isotype control, allophycocyanin (APC) -conjugated anti-CD4 (clone RPA-T4), peridinin chlorophyll protein complex (PerCP) -conjugated anti-CD69 (clone L78), PE-conjugated anti-interleukin-2 (IL-2) (clone MQ1-17H12), FITC-conjugated CD25 (clone M-A251), anti-mouse CD11c-APC (clone HL3), anti-mouse CD11b-PE (clone M1/70) and anti-mouse CD4-FITC (clone H129.19) were all purchased from Becton Dickinson (San Jose, CA). Recombinant human IL-4 and human granulocyte–macrophage colony-stimulating factor (GM-CSF) were purchased from Prospec-Tany Technogene Ltd (Rehovot, Israel). Staphylococcal enterotoxin A (SEA) was purchased from Sigma (St Louis, MO).
Patients
To assess HO-1 levels in monocytes, 43 non-selected patients with SLE who fulfilled the American College of Rheumatology criteria for SLE33 were recruited at Hospital Clínico de la Pontificia Universidad Católica de Chile. Exclusion criteria were pregnancy, patients undergoing dialysis or who were severely ill, such as those in the intensive-care unit or who were haemodynamically unstable, patients with infections and patients with drug-induced leucopenia or anaemia. Patient characteristics, including immunosuppressive medications and prednisone dose, are summarized in Table 1. Healthy donors (n = 31) matched by age and sex were included as controls. In both groups, 90% were women and the average ages were 36·1 ± 12·2 and 32·1 ± 9·1 years in the patients with SLE and healthy controls, respectively. In addition, 16 patients with rheumatoid arthritis and five kidney-transplanted patients, undergoing similar immunosuppressive treatment to the patients with SLE, were included as controls (average ages 59·6 ± 10·41 and 45·4 ± 10·6 years, respectively). Further details regarding patient characteristics and specific medications including prednisone dose are shown in Tables 2 and 3 for patients with rheumatoid arthritis and transplanted patients, respectively. For additional experiments, including T-cell activation after SEA stimulation, an additional 31 patients with SLE with similar characteristics and treatments were evaluated. Each patient signed an informed consent form before enrolling in the study, in accordance with the regulations of the Ethics Committee from the School of Medicine of the Pontificia Universidad Católica, and the study was performed in accordance with the Declaration of Helsinki as emended in Edinburgh (2000). The SLE activity was assessed using the Systemic Lupus Erythematosus Activity Index (SLEDAI) 2K.
Table 1.
Clinical data from patients with systemic lupus erythematosus (SLE) included in the study
| Patient | Gender | Age (years) | SLEDAI 2K | Treatment | Arthritis | Immune | CNS | Kidney | Haematological | Serositis | Mucocutaneous* | Antinuclear antibodies |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| SLE1 | F | 21 | 4 | HCQ, PDN | − | + | − | − | + | − | + | + |
| SLE2 | F | 21 | 14 | AZT | + | + | − | − | − | + | + | |
| SLE3 | F | 19 | 4 | HCQ, PDN | − | + | − | − | + | + | + | + |
| SLE4 | F | 47 | 16 | HCQ, PDN | + | + | − | − | − | − | + | + |
| SLE5 | F | 20 | 14 | PDN | + | + | − | − | − | − | + | + |
| SLE6 | F | 51 | 2 | – | + | − | − | + | − | − | + | + |
| SLE7 | F | 31 | 2 | AZT, HCQ | − | + | − | + | − | − | + | + |
| SLE8 | F | 22 | 4 | PDN, HCQ | + | + | − | − | − | + | + | + |
| SLE9 | F | 36 | 0 | HCQ | + | + | − | + | − | − | + | + |
| SLE10 | F | 32 | 4 | PDN | + | + | − | + | + | − | − | + |
| SLE11 | F | 42 | 2 | MMF, HCQ, PDN | − | + | + | − | + | − | + | + |
| SLE12 | F | 29 | 6 | PDN, HCQ | + | + | − | − | − | − | + | + |
| SLE13 | F | 40 | 1 | HCQ, PDN, MMF | + | + | + | + | + | − | + | + |
| SLE14 | F | 44 | 0 | HCQ, PDN | − | + | − | − | − | − | + | + |
| SLE15 | F | 45 | 4 | – | + | + | − | − | − | − | + | + |
| SLE16 | F | 51 | 4 | HCQ, PDN | + | + | − | − | + | − | + | + |
| SLE17 | F | 25 | 4 | PDN, AZT, HCQ | - | + | − | + | − | − | + | + |
| SLE18 | F | 21 | 10 | HCQ, PDN | + | + | − | + | − | − | + | + |
| SLE19 | F | 42 | 4 | HCQ, PDN | + | + | − | − | − | − | + | + |
| SLE20 | F | 37 | 8 | HCQ, PDN | + | + | − | − | − | − | + | + |
| SLE21 | F | 33 | 5 | HCQ, PDN | + | + | − | − | − | − | + | + |
| SLE22 | F | 41 | 0 | PDN | − | + | − | + | + | + | + | + |
| SLE23 | F | 41 | 2 | PDN, AZT, HCQ | − | + | − | − | + | − | + | + |
| SLE24 | F | 58 | 2 | PDN, AZT, HCQ | + | + | − | − | − | + | + | + |
| SLE25 | M | 23 | 12 | PDN, HCQ, CYT | − | + | − | + | + | − | + | + |
| SLE26 | F | 27 | 8 | AZT, PDN, HCQ | + | + | − | + | − | − | + | + |
| SLE27 | F | 19 | 4 | AZT, PDN, HCQ | + | + | + | − | − | − | − | + |
| SLE28 | F | 30 | 12 | MMF, PDN | + | + | + | + | − | − | + | − |
| SLE29 | F | 40 | 4 | PDN | + | + | − | + | − | − | − | + |
| SLE30 | F | 25 | 4 | AZT, PDN, HCQ | − | + | − | − | − | − | + | + |
| SLE31 | F | 29 | 19 | PDN, HCQ | + | + | − | − | − | − | + | − |
| SLE32 | F | 32 | 18 | PDN, HCQ | + | + | − | − | + | − | − | + |
| SLE33 | F | 45 | 2 | PDN, HCQ, MMF | + | + | + | − | + | − | − | + |
| SLE34 | F | 27 | 4 | PDN, HCQ | + | + | − | − | − | − | + | + |
| SLE35 | F | 50 | 4 | PDN, HCQ | + | + | − | − | + | − | + | − |
| SLE36 | F | 45 | 0 | HCQ | + | − | − | − | − | − | + | + |
| SLE37 | M | 19 | 8 | PDN, HCQ | + | + | − | − | − | + | − | + |
| SLE38 | F | 36 | 2 | PDN, CQ | + | + | − | − | + | − | + | + |
| SLE39 | F | 32 | 4 | PDN, HCQ | + | + | − | − | − | − | + | + |
| SLE40 | F | 34 | 4 | PDN, CYT | − | + | − | + | − | − | + | + |
| SLE41 | F | 39 | 4 | PDN, HCQ | + | + | − | − | − | + | + | + |
| SLE42 | F | 48 | 2 | PDN, AZT | − | + | − | − | + | − | + | + |
| SLE43 | F | 62 | 12 | PDN, HCQ | − | + | − | + | − | − | + | + |
Forty-three non-selected patients with SLE that fulfilled the American College of Rheumatology criteria for SLE were included in this study. Exclusion criteria were pregnancy, patients undergoing dialysis or who were severely ill, such as those in the intensive care unit or who were haemodynamically unstable, patients with infections and patients with drug-induced leucopoenia or anaemia.
AZT, azathioprine; MMF, mycophenolate mofetil; PDN, prednisone; HCQ, hydroxychloroquine; CQ, chloroquine; CYT, cyclophosphamide.
Mean prednisone dose = 10·97 mg/day (range 5–40 mg/day).
Mucocutaneous manifestations include photosensibility, malar rash, oral and nasal ulcers and discoid rash.
Table 2.
Clinical data from patients with rheumatoid arthritis included in the study
| Patient | Gender | Age | Medications |
|---|---|---|---|
| AR1 | F | 65 | PDN; MTX; LFN; AZF |
| AR2 | F | 57 | PDN; MTX |
| AR3 | F | 45 | PDN; MTX |
| AR4 | F | 73 | PDN; MTX |
| AR5 | F | 56 | PDN; MTX; HCQ |
| AR6 | F | 60 | PDN; MTX |
| AR7 | F | 54 | PDN |
| AR8 | F | 77 | PDN |
| AR9 | F | 50 | PDN; LFN |
| AR10 | F | 48 | PDN; LFN |
| AR11 | F | 63 | PDN; MTX |
| AR12 | F | 54 | PDN; MTX |
| AR13 | M | 46 | PDN; MTX |
| AR14 | F | 60 | PDN; MTX; LFN |
| AR15 | F | 34 | PDN; HCQ |
| AR16 | F | 68 | PDN; MTX; LFN |
Sixteen non-selected patients with rheumatoid arthritis that fulfilled the American College of Rheumatology criteria for rheumatoid arthritis were included in this study.
PDN, prednisone; MTX, methotrexate; LFN, leflunomide; HCQ, hydroxychloroquine.
Prednisone mean dose: 8·2 mg/day (range 5–30 mg/day).
Table 3.
Clinical data from kidney-transplanted patients included in the study
| Transplanted patient | Sex | Age | Medications |
|---|---|---|---|
| TP1 | F | 41 | PDN; CCP |
| TP2 | M | 63 | PDN; CCP; MMF |
| TP3 | F | 35 | PDN; CCP |
| TP4 | M | 44 | PDN; CCP; EV |
| TP5 | F | 44 | PDN; MMF; TC |
Five kidney-transplanted patients undergoing similar immunosuppressive treatment to the patients with systemic lupus erythematosus, were included.
PDN, Prednisone; CCP, Cyclosporine; MMF, Mycophenolate Mofetil; TC, Tacrolimus; EV, Everolimus.
Prednisone mean dose: 8·75 mg/day (range 5–15 mg/day).
Generation of monocyte-derived DCs
Peripheral blood mononuclear cells (PBMCs) were separated from whole blood using the standard Ficoll centrifugation method. Monocytes were obtained using the adherence method.34 Briefly, PBMCs (3 × 106 cells/ml) were incubated in serum-free X-VIVO-15 medium (Bio-Whittaker, Walkersville, MD) supplemented with 1% autologous serum and 50 μg/ml gentamycin (Calbiochem, San Diego, CA) (DC-medium) for 2 hr at 37°. Adherent cells were washed four times with pre-warmed serum-free X-VIVO-15 medium (Bio-Whittaker) and were then cultured in DC-medium at 37°. Monocytes were differentiated to DCs over 5 days by the addition of 1000 U/ml IL-4 and 1000 U/ml GM-CSF on days 0, 2 and 4. Maturation of the DCs was triggered by the addition of lipopolysaccharide (LPS; 5 μg/ml) for an additional 48 hr. The DC immune-phenotypes were confirmed by flow cytometry using specific monoclonal antibodies against surface markers.
Immunostaining
Cells were washed with PBS, re-suspended at 2 × 106 cells/ml (50 μl/tube) and incubated with FITC-conjugated, PE-conjugated and APC-conjugated antibodies for 30 min at 4°. The isotype-matched antibodies conjugated with FITC, PE and APC were used as controls. For HO-1 intracellular staining, cells were stained with FITC-conjugated anti-HO-1 in permeabilization buffer (PBS/BSA 3%/saponin 0·5%) overnight. Cells were washed with PBS, fixed with 1% formaldehyde in PBS and analysed using a FACSCalibur flow cytometer (BD Biosciences, San Jose, CA). A mouse IgG2b FITC-conjugated antibody was used as an isotype control for unspecific intracellular staining (BD Biosciences). Splenic CD11c+ DCs, CD11b+ macrophages/monocytes and CD4+ T cells from C57BL/6J FcγRIIb−/− and C57BL/6 mice at 1 year old were stained either with anti-mouse CD11c-APC, anti-CD11b-PE or anti-mouse CD4-APC antibodies. After surface staining, cells were fixed (PBS/formaldehyde 1%) and incubated with FITC-conjugated anti-HO-1 antibody in permeabilization buffer overnight. Cells were then washed and fixed in PBS/formaldehyde 1%. The expression of surface markers and HO-1 was determined by FACS.
Isolation of CD4+ T cells and CD14+ monocytes
The PBMCs obtained after Ficoll separation were stained with PE-conjugated and APC-conjugated monoclonal antibodies against CD14 and CD4, respectively, for 30 min at 4°. Staining for both CD14 and CD4 allowed clear separation of populations and minimized cross-contamination. After incubation with antibody conjugates for 20 min on ice, cells were washed twice in PBS/1% BSA and sorted using a FACSAria II (Becton Dickinson). Purity of CD4+ and CD14+ cells was always higher than 95% after sorting.
Real-time RT-PCR
RNA from CD4+ and CD14+ sorted population and PBMCs stimulated for 24 hr with 1 μg/ml LPS, 3 μg/ml methyl prednisolone and Cobalt-Protoporphyrin 1 μm, were extracted using Trizol (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. Reverse transcription PCR and cDNA synthesis were performed using random primers (ImProm-II; Promega, Madison, WI). Real-time PCR reactions were carried out using a Strategene Mx300P thermal cycler. Briefly, cDNAs amplified out of total RNA from CD4+ and CD14+ cells, were tested for amplification of HO-1 using the following primers (5′–3′): forward AGGCAGAGGGTGATAGAAGAGG, and reverse TGGGAGCGGGTGTTGAGT. The PCR amplification of glyceraldehyde 3-phosphate dehydrogenase (GADPH) or hypoxanthine phosphoribosyltransferase (HPRT) was used as an internal control. To corroborate amplification specificity, PCR products were subjected to a melting curve program. Abundance of HO-1 mRNA was determined from standard curves (correlation coefficient ≥ 0·98). Results were expressed as the ratio of the HO-1 amount relative to the amount of GADPH or HPRT for each sample, determined in duplicate experiments.
Superantigen stimulation assays
The PBMCs were seeded at 106 cells per well and incubated with SEA for 36 hr. In some experiments, PBMCs were incubated with SEA (50 nm) and stained with APC-conjugated anti-CD4, PerCP-conjugated anti-CD69, PE-conjugated anti-IL-2 (permeabilized) and FITC-conjugated anti-CD25. The PBMCs were also incubated with different SEA concentrations (0·16 pm to 1 μm) for 36 hr and stained with APC-conjugated anti-CD4 and PerCP-conjugated anti-CD69.
Data analysis
Data and statistical analyses were performed using prism 4 software (Graph Pad Software, Inc., San Diego, CA). For statistical analyses, Student’s t-test was used. P-values below 0·05 were considered statistically significant. Correlation analyses were performed using the Pearson correlation test with a confidence interval of 95%. Flow cytometry data were analysed using WinMDI 2.9 (http://facs.scripps.edu/software.html).
Results
Monocytes from patients with SLE display altered HO-1 expression
Because HO-1 contributes to enhancing the tolerogenic properties of immune cells,35 expression of this enzyme was evaluated by flow cytometry in CD14+ monocytes, CD11c+ cells and CD4+ T cells in PBMCs from 14 patients with SLE (patients 1–14, Table 1), and 12 healthy donors. As shown in Fig. 1, HO-1 expression was significantly down-regulated in CD14+ monocytes but not in CD11c+ or CD4+ T cells from patients with SLE when compared with healthy donors (Fig. 1a–c; P < 0·03, unpaired t-test). Interestingly, when HO-1 levels were analysed in DCs differentiated from circulating monocytes using human recombinant GM-CSF and IL-4, no significant differences in HO-1 expression between SLE patients and healthy controls were observed (see Supplementary material, Fig. S1). Moreover, LPS treatment of monocyte-derived DCs from patients with SLE had no significant effect on HO-1 expression (data not shown). To further evaluate HO-1 expression in patients with SLE, we assessed HO-1 surface levels in CD14+, CD11c+ and CD4+ cells from patients with SLE. HO-1 surface expression was very low in all these cell types, which is consistent with the notion that HO-1 is mainly located in the intracellular space (see Supplementary material, Fig. S2).
Figure 1.
Reduced haem oxygenase 1 (HO-1) expression in monocytes from patients with systemic lupus erythematosus (SLE). Peripheral blood mononuclear cells (PBMCs) from patients with SLE and from healthy controls were labelled with anti-CD4, anti-CD11c and anti-CD14 monoclonal antibodies, permeabilized and stained with an anti-HO-1 monoclonal antibody or isotype control. Cells were analysed by flow cytometry and representative histograms for the expression of HO-1 on monocytes (CD14+) (a), dendritic cells (CD11c+) (b) and lymphocytes (CD4+) (c) are shown. Solid histograms indicate healthy controls; black-line histograms indicate patients with SLE. Graphs show the relative geometric mean intensity (Geo mean) for HO-1 expression measured by FACS on cells derived from 14 patients with SLE and 12 healthy controls for monocytes (CD14+) (d), dendritic cells (CD11c+) (e) and lymphocytes (CD4+) (f). Data shown are means ± standard error of the mean (SEM). *P < 0·05, **P < 0·01 by Student’s t-test.
To better characterize the phenotype of CD14+ monocytes and CD11c+ cells from patients with SLE, the surface expression of MHC class II and CD86 in these cells was evaluated. No significant differences for the expression of these molecules were observed for CD14+ when compared with healthy controls. On the contrary, CD11c+ cells from patients with SLE showed lower expression of MHC class II than healthy individuals (see Supplementary material, Fig. S3).
In addition, to evaluate the immunogenic capacity of monocytes, T-cell activation assays were performed on PBMC cultures in response to stimulation with SEA (50 nm). No significant differences in T-cell activation parameters, such as IL-2 production, expression of CD25 or CD69, were observed between patients with SLE and healthy controls (Fig. 2a–d). Similar data were obtained when dose–response curves were performed (Fig. 2e).
Figure 2.
Stimulation of T cells from peripheral blood mononuclear cells (PBMCs) after staphylococcal enterotoxin A (SEA) stimulation. The PBMCs from six patients with systemic lupus erythematosus (SLE) and five healthy controls were stimulated with SEA 50 nm. After 36 h, cells were stained with anti-CD4, permeabilized and stained with anti-interleukin-2 (IL-2) monoclonal antibody. Cells were also stained with anti-CD25 and anti-CD69 and analysed using flow cytometry. Graphs show the percentage of IL-2+ (a), CD25+ (b) and CD69+ (c) cells from CD4+ cells measured by FACS. Representative density plots for the expression of IL-2, CD25 and CD69 (d) are shown. Dose response curve of SEA (0·16 pm to 1 μm) measured by CD69+ CD4+ cells (e) from patients with SLE and healthy controls showing non-significant differences. *P < 0·05, **P < 0·01, ***P < 0·001 by unpaired Student’s t-test.
Further, HO-1 expression was also analysed on immune cells from 16 patients with rheumatoid arthritis (see Supplementary material, Fig. S4). Patient information, including medications and demographics, is shown in Table 2. Interestingly, HO-1 levels in monocytes and CD11c+ cells from patients with rheumatoid arthritis were decreased compared with healthy controls, indicating that our findings could be extrapolated to other chronic autoimmune conditions.
HO-1 mRNA transcripts are diminished in monocytes derived from SLE patients
To specifically evaluate the levels of HO-1 mRNA transcripts in purified monocytes and T cells, CD4+ and CD14+ cells were separated by cell sorting from PBMCs obtained from 29 additional patients with SLE and 22 more healthy controls. HO-1 mRNA levels were determined by semi-quantitative real-time RT-PCR. We focused on CD4+ T cells rather than total CD3+ T cells because CD4+ T cells are the main T-cell subset expressing HO-1.36 A significant decrease in HO-1 mRNA levels was observed in monocytes from patients with SLE (P = 0·0075, unpaired t-test) compared with healthy donors matched by sex and age (Fig. 3). In contrast, no significant differences between patients with SLE and healthy donors were seen when mRNA from CD4+ T cells was analysed (P = 0·95) (Fig. 3). To evaluate whether the immunosuppressive treatment of patients with SLE was altering the HO-1 levels in immune cells, we performed an additional experiment including five kidney-transplanted patients treated with immunosuppressive drugs. Our results showed similar levels of HO-1 transcripts in monocytes and CD4+ T cells from patients who had received kidney transplants and healthy controls (see Supplementary material, Fig. S5). These data are consistent with the notion that the decrease in HO-1 levels observed in patients with SLE was not the result of the immunosuppressive treatment, and was rather a specific phenomenon associated to SLE. In conclusion, HO-1 mRNA levels were diminished in monocytes but not T helper cells from patients with SLE.
Figure 3.
Haem oxygenase 1 (HO-1) mRNA levels are diminished in monocytes from patients with systemic lupus erythematosus (SLE). Peripheral blood mononuclear cells (PBMCs) obtained from blood samples of patients with SLE and healthy controls were labelled with anti-CD4 and anti-CD14 monoclonal antibodies and sorted as described in Materials and methods. The mRNA was purified from the isolated cell populations and HO-1 levels were evaluated by real-time PCR. HO-1 transcripts on CD14+ (a) or CD4+ (b) cells from 29 patients with SLE and 22 healthy controls were analysed. Glyceraldehyde 3-phosphate dehydrogenase (GADPH) was used as a housekeeper normalizing control. PBMCs obtained from blood samples of patients with SLE and healthy controls were stimulated with 1 μg/ml lipopolysaccharide (LPS), 3 μg/ml metal prednisolone, 1 μm de Cobalt Protoporphyrin (CoPP). RNA was extracted with Trizol. (c) HO-1 mRNA levels were analysed by real-time PCR. Hypoxanthine phosphoribosyltransferase (HPRT) was used as a housekeeper normalizing control. *P < 0·05, **P < 0·01, ***P < 0·001 by unpaired Student’s t-test.
To better address the contribution of HO-1 expression to SLE onset and pathogenesis, we measured HO-1 levels in DCs, macrophages/monocytes and CD4+ T cells from C57BL/6 FcγRIIb knockout mice, which spontaneously develop a lupus-like autoimmune syndrome by 4–6 months of age.37 We observed that DCs, macrophages/monocytes and T cells from 1-year-old FcγRIIb knockout mice displayed significantly lower HO-1 expression levels than did age-matched C57BL/6 control mice (P < 0·05 unpaired t-test, see Supplementary material, Fig. S6). These data suggest that HO-1 down-regulation could be involved in the onset of SLE in FcγRIIb knockout mice.
Furthermore, as mentioned in the Materials and methods section, patients with SLE and those who had received transplants were taking equivalent doses of prednisone throughout the study. A possible direct effect of medication in HO-1 expression was evaluated in vitro by treating PBMCs with methyl prednisolone for 24 hr. As shown in Fig. 3, no significant differences in HO-1 mRNA levels were caused by steroid treatment. As seen in monocyte-derived DCs, LPS stimulation of PBMCs derived from healthy controls and from patients with SLE had no significant effect on HO-1 expression. Cobalt Protoporphyrin was included as an HO-1 mRNA inducer.
Altered HO-1 expression in monocytes does not correlate with SLE activity
To better understand the role of the HO-1 in SLE pathogenesis, we evaluated whether the reduced levels of HO-1 expression were associated with disease activity. To address this question, we determined the correlation between the levels of mRNA HO-1 transcripts and the SLE disease activity index (SLEDAI-2K), in our lupus cohort. As shown in Fig. 4, HO-1 transcript levels do not correlate with the SLEDAI-2K score, (r = −0·24, P = 0·12, Pearson’s correlation test). We also evaluated whether there was a correlation between HO-1 levels and key parameters of the disease, such as anti-DNA antibody levels, anti-Ro antibody levels and complement levels. However, no significant correlation was observed between HO-1 transcript levels and any of the parameters measured (data not shown). In addition, when HO-1 protein levels and SLEDAI-2K were plotted, no significant correlation was observed (data not shown). In addition, the dose of prednisone was also included among the parameters evaluated and no significant correlation was found (data not shown).
Figure 4.
Haem oxygenase-1 (HO-1) expression in monocytes from patients with systemic lupus erythematosus (SLE) does not correlate with SLE Disease Activity Index (SLEDAI). For each of the 29 patients evaluated by real-time PCR, the SLEDAI was plotted relative to the HO-1 transcript amount measured for CD14+ cells. Statistical analyses shown are Pearson’s tests (r = −0·24).
Discussion
The anti-inflammatory role of HO-1 has been widely reported in several disease processes.38–40 The relevance of HO-1 as an immunomodulator has been suggested by studies showing that HO-1 knockout mice display an exacerbated immune response and high levels of pro-inflammatory T helper type 1 cytokines.41,42 In addition, HO-1 has been involved in the modulation of the function of several cell types of the immune system, such as DCs, T cells and monocytes.30,32,43 However, to our knowledge, the role of HO-1 during SLE pathogenesis has not been previously evaluated. Therefore, here we have measured the levels of HO-1 in different subsets of immune cells obtained from peripheral blood of patients with SLE, to define HO-1 as a relevant molecule in the aetiology of the disease, as well as a potential therapeutic target for treating this autoimmune disease.
Our results show that HO-1 transcripts and protein levels are significantly reduced in monocytes from patients with SLE, compared with healthy controls. These differences are specific for this particular cell population, because no significant differences were found in DCs or T cells. Our results suggest an unbalanced monocyte function linked to reduced HO-1 activity in SLE. These findings could not only impair the tolerogenic capacity of monocytes, but also enhance their immunogenicity. As a result of these alterations, monocytes with low HO-1 expression could contribute to the autoimmune deregulation associated with SLE. Although monocytes from SLE patients did not show an increase in antigen-presenting activity in SEA assays, it is possible that the previously described defective T-cell function for these patients could account for this result. Moreover, the results obtained in DCs from FcγRIIb knockout mice strongly suggest that HO-1 down-regulation could be a key step in the promotion of autoimmunity.
Several studies have shown that monocytes obtained from patients with SLE can display altered functionality.12,44 Low levels of surface HLA-DR11 and CD80 expression45 have been observed in monocytes from patients with SLE, which could affect differentiation flexibility, antigen processing or cytokine production, and so affect T-cell activation. Interestingly, HO-1 expression can modulate monocyte function by regulating the production of pro-inflammatory cytokines.32 Accordingly, during acute inflammatory states there is an increase in HO-1 expression on monocytes, leading to an anti-inflammatory response.32 It is likely that a reduction in HO-1 expression in monocytes from patients with SLE compared with healthy controls could trigger an aberrant function in this population, contributing to the inflammation occurring in this disease. Consistent with this notion is the observation that monocytes from patients with SLE are less responsive to the immunosuppressive effect of IL-10 in the presence of immune complexes.44 As the mechanisms involved in the IL-10 response by monocytes depend on HO-1 activity,46 our results could in part explain why monocytes from patients with SLE are resistant to IL-10. Further research is necessary to conclusively address this question.
In spite of the differences in HO-1 expression found in monocytes, we could not find differences in HO-1 levels from monocytes-derived DCs of patients with SLE compared with healthy controls. Because DCs were generated after 5 days of differentiation with GM-CSF and IL-4, it is possible that during this time, normal HO-1 levels could be re-established on these cells. One possible explanation for the reduced expression of HO-1 found in patients with SLE could be the presence of high circulating levels of type 1 interferon (IFN) and IFN-γ in the blood of patients with SLE.47,48 There is evidence suggesting that HO-1 expression could be repressed by IFN-γ.49 Although no evidence suggests a similar effect of IFN-α on HO-1 expression, we could speculate that after 5 days of culture in media without these cytokines, HO-1 expression could be restored in DCs from patients with SLE. Further experiments would be needed to test this possibility.
Monocytes from patients with SLE have been shown to be impaired at clearing apoptotic cells.50 Reduced clearance of apoptotic cells might represent an important source of autoantigens with the potential of promoting the autoimmune process associated with SLE.51 In addition, a defective clearance of immune complexes could lead to their deposition in different organs triggering tissue damage.52 Remarkably, it has been demonstrated that increased HO-1 expression in circulating inflammatory cells enhances their phagocytic capacity.53 We can therefore speculate that the defect in the clearance of apoptotic cells by monocytes from patients with SLE could be in part explained by the reduced levels of HO-1, which could contribute to the initiation and maintenance of an immune response against autoantigens.
Several studies support the notion that HO-1 expression can be controlled at a transcriptional level.54 For example, the number of GT repeats, (GT)n, upstream from the transcription site was demonstrated to influence HO-1 expression, showing that longer (GT)n repeats are related with lower HO-1 transcriptional activity.55,56 Associations between the presence of shorter (GT)n repeats and less susceptibility to different autoimmune diseases have been reported.57,58 Consistent with this notion is the observation that patients with rheumatoid arthritis display higher ratios between longer (GT)n and shorter (GT)n repeats than do healthy patients and hence fewer HO-1 transcripts and less protein expression.59 Therefore, although we have only observed decreased HO-1 expression in monocytes from patients with SLE, it is possible that HO-1 microsatellite polymorphisms, such as (GT)n, could play a role in the expression of this enzyme. Further research is required to evaluate this hypothesis.
Although our results show a decrease in HO-1 levels on monocytes from patients with SLE, we could not detect a correlation between HO-1 levels and the SLEDAI in these patients. However, we observed that all of the six patients with the highest SLEDAI displayed low levels of HO-1 in their monocytes (Fig. 4). It is possible that the lack of correlation between disease activity and HO-1 levels could be the result of the small number of patients included and that most of them did not have a very active disease. Nevertheless, the fact that HO-1 expression remains low independent of the activity of the disease does not exclude this molecule as an interesting new therapeutic target for treating patients with SLE. Indeed, the chemical induction of HO-1 in MRL/MpJ-Faslpr (MRL/lpr) mice, an animal model of SLE, decreases the symptoms of disease in part by a reduction of nitric oxide synthase expression in the kidney and spleen and by a reduction in IFN-γ serum levels,60 supporting a potential use of HO-1 as a therapeutic target in patients with SLE.
Acknowledgments
We would like to thank Dr Aquiles Jara and Sandra Vilches for providing blood samples from kidney-transplanted patients and to Ana Karina Jimenez for kindly coordinating the clinical visits and laboratory work of patients with SLE and healthy subjects. We also thank the generous collaboration of all the patients with SLE who participated in this study.
This work was supported by grants from FONDECYT 1085281, 1070352, 1110518, 3070018, ECOS-CONICYT C07S01, Biomedical Research Consortium and Millennium Institute on Immunology and Immunotherapy P04/030-F, IMBIO programme, l’Agence de la Biomédecine, Ministère de la Recherche, Fondation CENTAURE, Fondation Progreffe. AAH is a CONICYT fellow and AMK is a Chaire De La Région Pays De La Loire De Chercheur Étranger D’excellence.
Abbreviations
- APC
allophycocyanin
- DCs
dendritic cells
- FcγR
Fcγ receptor
- GM-CSF
granulocyte–macrophage colony-stimulating factor
- HO-1
haem oxygenase-1
- IFN
interferon
- IL-4
interleukin-4
- LPS
lipopolysaccharide
- PBMC
peripheral blood mononuclear cells
- PE
phycoerythrin
- PerCP
peridinin chlorophyll protein complex
- SEA
staphylococcal enterotoxin A
- SLE
systemic lupus erythematosus
Disclosures
A patent application for the use of CO and HO-1 modulation to treat SLE has been submitted.
Supporting information
Additional Supporting Information may be found in the online version of this article:
Figure S1. Normal levels of haem oxygenase 1 (HO-1) on monocyte-derived dendritic cells (DCs) from patients with systemic lupus erythematosus (SLE). Monocyte-derived DCs from SLE patients and healthy controls were obtained and HO-1 expression was analysed by FACS (a) and real-time PCR (b).
Figure S2. Surface haem oxygenase 1 (HO-1) expression in monocytes, lymphocytes and dendritic cells (DCs) from patients with systemic lupus erythematosus.
Figure S3. Expression of MHCII and CD86 in monocytes from patients with systemic lupus erythematosus.
Figure S4. Reduced haem oxygenase 1 (HO-1) expression in monocytes and dendritic cells from patients with rheumatoid arthritis.
Figure S5. Haem oxygenase 1 (HO-1) mRNA levels in patients who received kidney transplants.
Figure S6. Altered haem oxygenase 1 (HO-1) expression in monocytes, dendritic cells and T cells from FcγRIIb knockout mice.
Please note: Wiley-Blackwell is not responsible for the content or functionality of any supporting materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.
References
- 1.von Muhlen CA, Tan EM. Autoantibodies in the diagnosis of systemic rheumatic diseases. Semin Arthritis Rheum. 1995;24:323–58. doi: 10.1016/s0049-0172(95)80004-2. [DOI] [PubMed] [Google Scholar]
- 2.Feist E, Dorner T, Kuckelkorn U, Schmidtke G, Micheel B, Hiepe F, Burmester GR, Kloetzel PM. Proteasome alpha-type subunit C9 is a primary target of autoantibodies in sera of patients with myositis and systemic lupus erythematosus. J Exp Med. 1996;184:1313–8. doi: 10.1084/jem.184.4.1313. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Rumore PM, Steinman CR. Endogenous circulating DNA in systemic lupus erythematosus. Occurrence as multimeric complexes bound to histone. J Clin Invest. 1990;86:69–74. doi: 10.1172/JCI114716. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Brown EE, Edberg JC, Kimberly RP. Fc receptor genes and the systemic lupus erythematosus diathesis. Autoimmunity. 2007;40:567–81. doi: 10.1080/08916930701763710. [DOI] [PubMed] [Google Scholar]
- 5.Anolik JH. B cell biology and dysfunction in SLE. Bull NYU Hosp Jt Dis. 2007;65:182–6. [PubMed] [Google Scholar]
- 6.Cohen PL. T- and B-cell abnormalities in systemic lupus. J Invest Dermatol. 1993;100:69S–72S. doi: 10.1111/1523-1747.ep12355631. [DOI] [PubMed] [Google Scholar]
- 7.Driver CB, Ishimori M, Weisman MH. The B cell in systemic lupus erythaematosus: a rational target for more effective therapy. Ann Rheum Dis. 2008;67:1374–81. doi: 10.1136/ard.2007.076745. [DOI] [PubMed] [Google Scholar]
- 8.Chen YF, Morel L. Genetics of T cell defects in lupus. Cell Mol Immunol. 2005;2:403–9. [PubMed] [Google Scholar]
- 9.Roark CL, Kotzin BL. Characterization of CD4+ T cell autoreactivity to self-MHC in New Zealand hybrid mice. Clin Immunol. 2001;98:95–103. doi: 10.1006/clim.2000.4950. [DOI] [PubMed] [Google Scholar]
- 10.Takeno M, Nagafuchi H, Kaneko S, et al. Autoreactive T cell clones from patients with systemic lupus erythematosus support polyclonal autoantibody production. J Immunol. 1997;158:3529–38. [PubMed] [Google Scholar]
- 11.Shirakawa F, Yamashita U, Suzuki H. Reduced function of HLA-DR-positive monocytes in patients with systemic lupus erythematosus (SLE) J Clin Immunol. 1985;5:396–403. doi: 10.1007/BF00915337. [DOI] [PubMed] [Google Scholar]
- 12.Steinbach F, Henke F, Krause B, Thiele B, Burmester GR, Hiepe F. Monocytes from systemic lupus erythematous patients are severely altered in phenotype and lineage flexibility. Ann Rheum Dis. 2000;59:283–8. doi: 10.1136/ard.59.4.283. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Iruretagoyena MI, Wiesendanger M, Kalergis AM. The dendritic cell–T cell synapse as a determinant of autoimmune pathogenesis. Curr Pharm Des. 2006;12:131–47. doi: 10.2174/138161206775193145. [DOI] [PubMed] [Google Scholar]
- 14.Kalergis AM, Iruretagoyena MI, Barrientos MJ, et al. Modulation of nuclear factor-kappaB activity can influence the susceptibility to systemic lupus erythematosus. Immunology. 2009;1(Suppl):e306–14. doi: 10.1111/j.1365-2567.2008.02964.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Scheinecker C, Zwolfer B, Koller M, Manner G, Smolen JS. Alterations of dendritic cells in systemic lupus erythematosus: phenotypic and functional deficiencies. Arthritis Rheum. 2001;44:856–65. doi: 10.1002/1529-0131(200104)44:4<856::AID-ANR142>3.0.CO;2-A. [DOI] [PubMed] [Google Scholar]
- 16.Gerl V, Lischka A, Panne D, et al. Blood dendritic cells in systemic lupus erythematosus exhibit altered activation state and chemokine receptor function. Ann Rheum Dis. 2010;69:1370–7. doi: 10.1136/ard.2009.111021. [DOI] [PubMed] [Google Scholar]
- 17.Carreno LJ, Pacheco R, Gutierrez MA, Jacobelli S, Kalergis AM. Disease activity in systemic lupus erythematosus is associated with an altered expression of low-affinity Fc gamma receptors and costimulatory molecules on dendritic cells. Immunology. 2009;128:334–41. doi: 10.1111/j.1365-2567.2009.03138.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Carreno LJ, Riedel CA, Kalergis AM. Induction of tolerogenic dendritic cells by NF-kappaB blockade and Fcgamma receptor modulation. Methods Mol Biol. 2010;677:339–53. doi: 10.1007/978-1-60761-869-0_22. [DOI] [PubMed] [Google Scholar]
- 19.Abraham NG, Kappas A. Pharmacological and clinical aspects of heme oxygenase. Pharmacol Rev. 2008;60:79–127. doi: 10.1124/pr.107.07104. [DOI] [PubMed] [Google Scholar]
- 20.Ryter SW, Alam J, Choi AM. Heme oxygenase-1/carbon monoxide: from basic science to therapeutic applications. Physiol Rev. 2006;86:583–650. doi: 10.1152/physrev.00011.2005. [DOI] [PubMed] [Google Scholar]
- 21.Maines MD, Trakshel GM, Kutty RK. Characterization of two constitutive forms of rat liver microsomal heme oxygenase. Only one molecular species of the enzyme is inducible. J Biol Chem. 1986;261:411–9. [PubMed] [Google Scholar]
- 22.Cruse I, Maines MD. Evidence suggesting that the two forms of heme oxygenase are products of different genes. J Biol Chem. 1988;263:3348–53. [PubMed] [Google Scholar]
- 23.McCoubrey WK, Jr, Huang TJ, Maines MD. Isolation and characterization of a cDNA from the rat brain that encodes hemoprotein heme oxygenase-3. Eur J Biochem. 1997;247:725–32. doi: 10.1111/j.1432-1033.1997.00725.x. [DOI] [PubMed] [Google Scholar]
- 24.Blancou P, Tardif V, Simon T, Remy S, Carreno L, Kalergis A, Anegon I. Immunoregulatory properties of heme oxygenase-1. Methods Mol Biol. 2010;677:247–68. doi: 10.1007/978-1-60761-869-0_18. [DOI] [PubMed] [Google Scholar]
- 25.Otterbein LE, Choi AM. Heme oxygenase: colors of defense against cellular stress. Am J Physiol Lung Cell Mol Physiol. 2000;279:L1029–37. doi: 10.1152/ajplung.2000.279.6.L1029. [DOI] [PubMed] [Google Scholar]
- 26.Stocker R, Yamamoto Y, McDonagh AF, Glazer AN, Ames BN. Bilirubin is an antioxidant of possible physiological importance. Science. 1987;235:1043–6. doi: 10.1126/science.3029864. [DOI] [PubMed] [Google Scholar]
- 27.Yamashita K, McDaid J, Ollinger R, et al. Biliverdin, a natural product of heme catabolism, induces tolerance to cardiac allografts. Faseb J. 2004;18:765–7. doi: 10.1096/fj.03-0839fje. [DOI] [PubMed] [Google Scholar]
- 28.Remy S, Blancou P, Tesson L, et al. Carbon monoxide inhibits TLR-induced dendritic cell immunogenicity. J Immunol. 2009;182:1877–84. doi: 10.4049/jimmunol.0802436. [DOI] [PubMed] [Google Scholar]
- 29.Bilban M, Haschemi A, Wegiel B, Chin BY, Wagner O, Otterbein LE. Heme oxygenase and carbon monoxide initiate homeostatic signaling. J Mol Med. 2008;86:267–79. doi: 10.1007/s00109-007-0276-0. [DOI] [PubMed] [Google Scholar]
- 30.Chauveau C, Remy S, Royer PJ, et al. Heme oxygenase-1 expression inhibits dendritic cell maturation and proinflammatory function but conserves IL-10 expression. Blood. 2005;106:1694–702. doi: 10.1182/blood-2005-02-0494. [DOI] [PubMed] [Google Scholar]
- 31.Lang D, Reuter S, Buzescu T, August C, Heidenreich S. Heme-induced heme oxygenase-1 (HO-1) in human monocytes inhibits apoptosis despite caspase-3 up-regulation. Int Immunol. 2005;17:155–65. doi: 10.1093/intimm/dxh196. [DOI] [PubMed] [Google Scholar]
- 32.Yachie A, Toma T, Mizuno K, Okamoto H, Shimura S, Ohta K, Kasahara Y, Koizumi S. Heme oxygenase-1 production by peripheral blood monocytes during acute inflammatory illnesses of children. Exp Biol Med (Maywood) 2003;228:550–6. doi: 10.1177/15353702-0322805-26. [DOI] [PubMed] [Google Scholar]
- 33.Smith EL, Shmerling RH. The American College of Rheumatology criteria for the classification of systemic lupus erythematosus: strengths, weaknesses, and opportunities for improvement. Lupus. 1999;8:586–95. doi: 10.1191/096120399680411317. [DOI] [PubMed] [Google Scholar]
- 34.Mendoza-Naranjo A, Saez PJ, Johansson CC, et al. Functional gap junctions facilitate melanoma antigen transfer and cross-presentation between human dendritic cells. J Immunol. 2007;178:6949–57. doi: 10.4049/jimmunol.178.11.6949. [DOI] [PubMed] [Google Scholar]
- 35.Blancou P, Anegon I. Editorial: Heme oxygenase-1 and dendritic cells: what else? J Leukoc Biol. 2010;87:185–7. doi: 10.1189/jlb.0909636. [DOI] [PubMed] [Google Scholar]
- 36.Pae HO, Oh GS, Choi BM, Chae SC, Chung HT. Differential expressions of heme oxygenase-1 gene in CD25− and CD25+ subsets of human CD4+ T cells. Biochem Biophys Res Commun. 2003;306:701–5. doi: 10.1016/s0006-291x(03)01037-4. [DOI] [PubMed] [Google Scholar]
- 37.Bolland S, Ravetch JV. Spontaneous autoimmune disease in Fc(gamma)RIIB-deficient mice results from strain-specific epistasis. Immunity. 2000;13:277–85. doi: 10.1016/s1074-7613(00)00027-3. [DOI] [PubMed] [Google Scholar]
- 38.Li M, Peterson S, Husney D, Inaba M, Guo K, Kappas A, Ikehara S, Abraham NG. Long-lasting expression of HO-1 delays progression of type I diabetes in NOD mice. Cell Cycle. 2007;6:567–71. doi: 10.4161/cc.6.5.3917. [DOI] [PubMed] [Google Scholar]
- 39.Pamplona A, Ferreira A, Balla J, et al. Heme oxygenase-1 and carbon monoxide suppress the pathogenesis of experimental cerebral malaria. Nat Med. 2007;13:703–10. doi: 10.1038/nm1586. [DOI] [PubMed] [Google Scholar]
- 40.Lee IT, Luo SF, Lee CW, et al. Overexpression of HO-1 protects against TNF-alpha-mediated airway inflammation by down-regulation of TNFR1-dependent oxidative stress. Am J Pathol. 2009;175:519–32. doi: 10.2353/ajpath.2009.090016. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Poss KD, Tonegawa S. Heme oxygenase 1 is required for mammalian iron reutilization. Proc Natl Acad Sci U S A. 1997;94:10919–24. doi: 10.1073/pnas.94.20.10919. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Kapturczak MH, Wasserfall C, Brusko T, Campbell-Thompson M, Ellis TM, Atkinson MA, Agarwal A. Heme oxygenase-1 modulates early inflammatory responses: evidence from the heme oxygenase-1-deficient mouse. Am J Pathol. 2004;165:1045–53. doi: 10.1016/S0002-9440(10)63365-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Burt TD, Seu L, Mold JE, Kappas A, McCune JM. Naive human T cells are activated and proliferate in response to the heme oxygenase-1 inhibitor tin mesoporphyrin. J Immunol. 2010;185:5279–88. doi: 10.4049/jimmunol.0903127. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Yuan W, DiMartino SJ, Redecha PB, Ivashkiv LB, Salmon JE. Systemic lupus erythematosus monocytes are less responsive to interleukin-10 in the presence of immune complexes. Arthritis Rheum. 2011;63:212–8. doi: 10.1002/art.30083. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Tsokos GC, Kovacs B, Sfikakis PP, Theocharis S, Vogelgesang S, Via CS. Defective antigen-presenting cell function in patients with systemic lupus erythematosus. Arthritis Rheum. 1996;39:600–9. doi: 10.1002/art.1780390409. [DOI] [PubMed] [Google Scholar]
- 46.Koch N, Jung M, Sabat R, Kratzschmar J, Docke WD, Asadullah K, Volk HD, Grutz G. IL-10 protects monocytes and macrophages from complement-mediated lysis. J Leukoc Biol. 2009;86:155–66. doi: 10.1189/jlb.0708443. [DOI] [PubMed] [Google Scholar]
- 47.Kim T, Kanayama Y, Negoro N, Okamura M, Takeda T, Inoue T. Serum levels of interferons in patients with systemic lupus erythematosus. Clin Exp Immunol. 1987;70:562–9. [PMC free article] [PubMed] [Google Scholar]
- 48.Theofilopoulos AN, Koundouris S, Kono DH, Lawson BR. The role of IFN-gamma in systemic lupus erythematosus: a challenge to the Th1/Th2 paradigm in autoimmunity. Arthritis Res. 2001;3:136–41. doi: 10.1186/ar290. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Udono-Fujimori R, Takahashi K, Takeda K, Furuyama K, Kaneko K, Takahashi S, Tamai M, Shibahara S. Expression of heme oxygenase-1 is repressed by interferon-gamma and induced by hypoxia in human retinal pigment epithelial cells. Eur J Biochem. 2004;271:3076–84. doi: 10.1111/j.1432-1033.2004.04241.x. [DOI] [PubMed] [Google Scholar]
- 50.Gaipl US, Munoz LE, Grossmayer G, et al. Clearance deficiency and systemic lupus erythematosus (SLE) J Autoimmun. 2007;3:114–21. doi: 10.1016/j.jaut.2007.02.005. [DOI] [PubMed] [Google Scholar]
- 51.Munoz LE, Gaipl US, Franz S, Sheriff A, Voll RE, Kalden JR, Herrmann M. SLE – a disease of clearance deficiency? Rheumatology (Oxford) 2005;44:1101–7. doi: 10.1093/rheumatology/keh693. [DOI] [PubMed] [Google Scholar]
- 52.McCluskey RT. Evidence for an immune complex disorder in systemic lupus erythematosus (SLE) Am J Kidney Dis. 1982;1(Suppl. 1):119–25. [PubMed] [Google Scholar]
- 53.Chung SW, Liu X, Macias AA, Baron RM, Perrella MA. Heme oxygenase-1-derived carbon monoxide enhances the host defense response to microbial sepsis in mice. J Clin Invest. 2008;118:239–47. doi: 10.1172/JCI32730. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Lavrovsky Y, Schwartzman ML, Levere RD, Kappas A, Abraham NG. Identification of binding sites for transcription factors NF-kappa B and AP-2 in the promoter region of the human heme oxygenase 1 gene. Proc Natl Acad Sci U S A. 1994;91:5987–91. doi: 10.1073/pnas.91.13.5987. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Yamada N, Yamaya M, Okinaga S, Nakayama K, Sekizawa K, Shibahara S, Sasaki H. Microsatellite polymorphism in the heme oxygenase-1 gene promoter is associated with susceptibility to emphysema. Am J Hum Genet. 2000;66:187–95. doi: 10.1086/302729. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Chen YH, Lin SJ, Lin MW, et al. Microsatellite polymorphism in promoter of heme oxygenase-1 gene is associated with susceptibility to coronary artery disease in type 2 diabetic patients. Hum Genet. 2002;111:1–8. doi: 10.1007/s00439-002-0769-4. [DOI] [PubMed] [Google Scholar]
- 57.Wu MM, Chiou HY, Lee TC, et al. GT-repeat polymorphism in the heme oxygenase-1 gene promoter and the risk of carotid atherosclerosis related to arsenic exposure. J Biomed Sci. 2010;17:70. doi: 10.1186/1423-0127-17-70. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Song F, Li X, Zhang M, Yao P, Yang N, Sun X, Hu FB, Liu L. Association between heme oxygenase-1 gene promoter polymorphisms and type 2 diabetes in a Chinese population. Am J Epidemiol. 2009;170:747–56. doi: 10.1093/aje/kwp196. [DOI] [PubMed] [Google Scholar]
- 59.Rueda B, Oliver J, Robledo G, et al. HO-1 promoter polymorphism associated with rheumatoid arthritis. Arthritis Rheum. 2007;56:3953–8. doi: 10.1002/art.23048. [DOI] [PubMed] [Google Scholar]
- 60.Takeda Y, Takeno M, Iwasaki M, et al. Chemical induction of HO-1 suppresses lupus nephritis by reducing local iNOS expression and synthesis of anti-dsDNA antibody. Clin Exp Immunol. 2004;138:237–44. doi: 10.1111/j.1365-2249.2004.02594.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.