Skip to main content
Development (Cambridge, England) logoLink to Development (Cambridge, England)
. 2012 Aug 15;139(16):2891–2896. doi: 10.1242/dev.083162

Drosophila Patj plays a supporting role in apical-basal polarity but is essential for viability

Wenke Zhou 1, Yang Hong 1,*
PMCID: PMC3403101  PMID: 22791898

Abstract

Patj has been characterized as one of the so-called polarity proteins that play essential and conserved roles in regulating cell polarity in many different cell types. Studies of Drosophila and mammalian cells suggest that Patj is required for the apical polarity protein complex Crumbs-Stardust (Pals1 or Mpp5 in mammalian cells) to establish apical-basal polarity. However, owing to the lack of suitable genetic mutants, the exact in vivo function of Patj in regulating apical-basal polarity and development remains to be elucidated. Here, we generated molecularly defined null mutants of Drosophila Patj (dPatj). Our data show conclusively that dPatj only plays supporting and non-essential roles in regulating apical-basal polarity, although such a supporting role may become crucial in cells such as photoreceptors that undergo complex cellular morphogenesis. In addition, our results confirm that dPatj possesses an as yet unidentified function that is essential for pupal development.

Keywords: Drosophila Patj, Polarity proteins, Apical-basal polarity, Embryonic epithelium, Follicular epithelium, Photoreceptor

INTRODUCTION

Polarity proteins play evolutionarily conserved roles in regulating apical-basal polarity in epithelial cells (Wang and Margolis, 2007). Pals1-associated tight junction protein (Patj) is a multi-PDZ domain protein that binds the apical polarity protein complexes Crumbs (Crb)-Stardust (Sdt; Pals1) (Roh et al., 2002; Roh et al., 2003) and Par-6–aPKC (Nam and Choi, 2003; Wang et al., 2004). In Drosophila, the homolog of Patj was first identified as the product of discs lost (dlt) (Bhat et al., 1999), but Pielage et al. later showed that dlt actually encodes a protein involved in cell cycle control and the original dlt was renamed Drosophila Patj (dPatj) (Pielage et al., 2003). RNAi knockdown results suggested that dPatj is an essential gene that is required for initiating and establishing apical-basal polarity, primarily through its regulation of Crb (Bhat et al., 1999). However, Pielage et al. generated a synthetic dPatj mutant by rescuing all of the deleted genes with the exception of dPatj in a small deficiency and found it to be viable, disputing essential roles for dPatj in polarity and development (Pielage et al., 2003). Such conflicting results were partially reconciled when it was shown that this synthetic dPatj mutant is in fact a hypomorphic allele (dPatjsynhypo) that expresses a truncated dPatj protein from one of the rescuing DNA fragments (Nam and Choi, 2006). They constructed a new synthetic null mutant, dPatjsynnull, that was free of dPatj coding sequences and found that it was early larval lethal. Unfortunately, polarity defects could not be assessed in dPatjsynnull embryos due to difficulties in removing dPatj maternal contributions (Nam and Choi, 2006).

Thus, owing to the lack of suitable genetic mutants, it remains to be determined whether Patj is indeed essential for apical-basal polarity and general development. Here, we generated multiple molecularly and genetically defined null mutants of dPatj to address this key issue.

MATERIALS AND METHODS

Drosophila stocks

y1 w67c23; P{GSV2}GS50262/TM3, Sb1 Ser1 (stock #204965) was obtained from the Kyoto Drosophila Genetic Resource Center. Stocks obtained from the Bloomington Drosophila Stock Center: w1118; Df(3L)BSC123/TM6B, Tb1 (BL#9143); w*; FRT-2A (BL#1997); w*; Dr1/TMS, P{ry[+t7.2]=Δ2-3}99B (BL#1610); hsFLP1 y1 w1118; Dr1/TM3, Sb1 (BL#26902); w1118; Ubi-GFP.nls3L1 Ubi-GFP.nls3L2 FRT-2A (BL#5825); y1 vas-ϕC31ZH-2A w*; attP-9AVK00020 (BL#24867); w*; ovoD1-18 FRT-2A/st1 βTub85DD ss1 es/TM3, Sb1 (BL#2139); ovo-FLP, w* (BL#8727); yd2 w1118 ey-FLP (BL#5580); and w1118; DrMio/TM3, P{GAL4-twi.G}2.3, P{UAS-2xEGFP}AH2.3, Sb1 Ser1 (BL#6663; hereafter referred to as w; Dr/TM3 twi>GFP). The knockout null allele crbGX24w[–] (crbko) was described previously (Huang et al., 2009).

Generation and characterization of dPatj deletion and rescue alleles

P{GSV2}GS50262 excision mutagenesis was performed according to the standard method (Hummel and Klämbt, 2008). dPatjΔ7, dPatjΔ13 and dPatjΔ14 were isolated from a total of 253 excision candidates screened by Df(3L)BSC123 complementation. PCR verifications and sequencing were performed using primers (5′-3′) CGAGACGCGGCCGCGGCAGACACCTTATTGTTTTTCC and CGAGACGCTAGCCTAGTTCCGCCAGTCGGGAA. dPatj-L and dPatj-S DNA fragments were PCR amplified from genomic DNA using: dPatj-S Forward, CGAGACGCGGCCGCGGCAGACACCTTATTGTTTTTCC; dPatj-L Forward, CGAGACGCGGCCGCATTCCGGGTGATATTATTTTCATTG; and dPatj-S (or -L) Reverse, CGAGACACGCGTACTCATTGACCGTACGGAAGGTA.

GFP was inserted before the dPatj stop codon in dPatj-S to produce dPatj::GFP-S. dPatj-L and dPatj::GFP-S were integrated into attP-9AVK00020 [VK20 at the cytologic location 99F8 (Venken et al., 2006)] via ϕC31-mediated DNA integration (Groth et al., 2004; Bischof et al., 2007) to generate dPatj-L and dPatj::GFP-S, which were then recombined with dPatjΔ7.

Generation of somatic and germline clones of dPatj

dPatjΔ7 germline clone embryos were collected from crosses of ovo-FLP; dPatjΔ7 FRT-2A/ovoD FRT-2A × dPatjΔ7 [or dPatjΔ13 or Df(3L)BS123 or dPatjΔ7 VK20-dPatj-L]/TM3, twi>GFP (Xu and Rubin, 1993; Chou and Perrimon, 1996). To generate follicular clones, young females of hs-FLP/+; dPatjΔ7 FRT-2A/ubi-GFP FRT-2A were heat shocked for 1 hour at 38°C and then aged for 2-4 days prior to ovary dissection. To generate larval imaginal disc clones, embryos from the hs-FLP; ubi-GFP FRT-2A × dPatjΔ7 FRT-2A/TM3, twi>GFPr crosses were collected for 24 hours, heat shocked for 1 hour at 38°C 1 day later, and maintained at 25°C until the third instar larvae emerged. To generate dPatj photoreceptor clones, white pupae (less than 2-3 hours into pupation) were collected from the ey-FLP; dPatjΔ7 FRT-2A/TM3 twi>GFP × ubi-GFP FRT-2A cross and aged at 18°C until the desired pupal stages (Hong et al., 2003). Pupae were genotyped by the absence of twi>GFP.

Immunostaining and confocal imaging

Immunostaining of embryos, larval imaginal discs and adult ovaries (Tanentzapf et al., 2000; Hong et al., 2001; Huang et al., 2009) and pupal retina dissection and immunostaining (Hong et al., 2003) were performed as previously described. Primary antibodies were: mouse anti-dPatj (full-length) and rabbit anti-dPatj-N (the first 517 amino acids) (Huang et al., 2009) 1:500; rabbit anti-GFP (Huang et al., 2009) 1:1500; guinea pig anti-Baz (Huang et al., 2009) 1:500; rabbit and rat anti-Par-6 (Huang et al., 2009) 1:500; rabbit anti-Sdt (Hong et al., 2001) 1:100-200; mouse anti-Crb (Cq4; DSHB) 1:10-100; mouse anti-Arm (N2 7A1; DSHB) 1:50-100; rat anti-DE-Cad (DCAD2; DSHB) 1:100; mouse anti-Dlg (4F3; DSHB) 1:50; and rabbit anti-aPKC (Santa Cruz) 1:1000. Secondary antibodies: Cy2-, Cy3- or Cy5-conjugated goat anti-rabbit IgG, anti-rat IgG, anti-mouse IgG and anti-guinea pig IgG (Jackson ImmunoResearch), all at 1:400. Images were taken on an Olympus FV1000 confocal microscope (Center for Biologic Imaging, University of Pittsburgh Medical School) and processed in Adobe Photoshop for compositions.

RESULTS AND DISCUSSION

Drosophila Patj is essential for viability

P{GSV2}GS50262 is a viable P-element insertion located 303 bp upstream of the first ATG of the dPatj coding sequence (Fig. 1A). By mobilizing GS50262 with transposase (Hummel and Klämbt, 2008), we recovered several imprecise excision mutants that failed to complement Df(3L)BSC123, which is a 11,312 bp deficiency encompassing the dPatj locus (Cook et al., 2012) (Fig. 1A-C and supplementary material Table S1). dPatjΔ7, dPatjΔ13 and dPatjΔ14 contained deletions that all began at the GS50262 insertion site and removed the 5′UTR plus the conserved L27 motif required for the binding of Sdt or Pals1 (Roh et al., 2002; Li et al., 2004; Feng et al., 2005) (Fig. 1A-C). The 2,509 bp deletion in dPatjΔ7 further removed the first three PDZ domains that are required for interaction with Crb (Bhat et al., 1999) and Par-6 (Nam and Choi, 2003), whereas deletions in dPatjΔ13 and dPatjΔ14 also removed the first two and the first PDZ domain, respectively (Fig. 1B). Antibodies against the N-terminal and full-length dPatj proteins (Huang et al., 2009) revealed maternal contributions of dPatj in dPatjΔ7 zygotic mutant embryos (Fig. 2A). However, in dPatjΔ7 germline clone (dPatjΔ7GLC) mutant embryos, which removed dPatj maternal contributions, dPatj staining was absent, confirming that dPatjΔ7 is a genetic null mutant (Fig. 2B-F).

Fig. 1.

Fig. 1.

Characterization of dPatj null mutants generated by imprecise P-element excision. (A) The Drosophila Patj (dPatj) locus. GS50262 (blue triangle) is inserted at 1,798,845 bp of the third chromosome (http://flybase.org/reports/FBti0109626.html). The Df(3L)BSC123 deletion is indicated (red bar). (B) Deletions in dPatjΔ7, dPatjΔ13 and dPajΔ14 (red bars), the region covered by the PCR in C (black bar), and the genomic fragments used in VK20-dPatj-L and VK20-dPatj::GFP-S (blue bars) are shown. dPatj-L starts in the middle of the CG12020 coding sequence, whereas dPatj::GFP-S starts immediately after the CG12020 stop codon; both end in the 3′UTR of JTBR. In dPatj::GFP-S, GFP is inserted in frame before the dPatj stop codon. (C) PCR verification of dPatjΔ7, dPatjΔ13 and dPajΔ14 mutants. PCR products are indicated for the wild-type (w1118) chromosome (3.32 kb, blue arrowhead) versus the dPatjΔ7, dPatjΔ13 and dPajΔ14 mutant chromosomes (red arrowheads). MW, DNA ladder.

Fig. 2.

Fig. 2.

dPatj is not required for initiating or establishing apical-basal polarity during embryogenesis. (A) Reduced but detectable dPatj expression (green) in the dPatjΔ7 zygotic mutant embryo. DE-Cad (red) marks adherens junctions. (B) Maternal contribution of dPatj (green) was completely removed in dPatjΔ7GLC stage 5 embryos, but cellularization remained normal, as shown by Dlg (red), which marks the invaginating basolateral membrane. Nuclei are stained with DAPI (blue). The signal in the green channel was boosted in the dPatjΔ7GLC sample to emphasize the absence of dPatj staining. (C-H) In older dPatjΔ7GLC embryos at stage 10-11, Crb expression appears to be mildly reduced (C), but both Sdt and Crb show normal subcellular localization patterns (C,D). The expression and subcellular localization of the basolateral polarity protein Dlg (E) and the apical polarity proteins DE-Cad (F), Par-6 (G), aPKC and Baz (H) were also normal in these embryos. With the exception of B, embryos are presented in tangential view and images are maximum z-projections of ∼5-10 μm depth. Scale bars: 10 μm.

Transheterozygotes among dPatjΔ7, dPatjΔ13, dPatjΔ14 and Df(3L)BSC123 suggested that the zygotic mutants of dPatj were pupal lethal, but dPatjΔ7, dPatjΔ13 and dPatjΔ14 appeared to carry additional background mutations that caused prepupal lethality (supplementary material Table S1). To confirm that the loss of dPatj specifically caused pupal lethality, we developed two independent genomic rescue lines, VK20-dPatj-L and VK20-dPatj::GFP-S, that each only contained dPatj as the single intact gene (Fig. 1B). dPatjΔ7 VK20-dPatj-L or dPatjΔ7 VK20-dPatj::GFP-S recombinants fully rescued dPatjΔ7, dPatjΔ13 and Df(3L)BSC123 (supplementary material Table S1). dPatjΔ7 VK20-dPatj-L also fully rescued the lethality of dPatjΔ7GLC embryos (supplementary material Table S1), indicating that the zygotic expression of dPatj is sufficient for development. It is likely that the early larval lethality observed in the dPatjsynnull mutants (Nam and Choi, 2006) was due to additional background mutations or incomplete rescue. The expression pattern of GFP-tagged dPatj from VK20-dPatj::GFP-S was indistinguishable from the dPatj immunostaining pattern (data not shown).

dPatj is not required for establishing apical-basal polarity during embryogenesis

During Drosophila embryogenesis, cellularization is the earliest event in the formation of the polarized embryonic epithelia, and one striking feature of dPatj is its dynamic association with the leading edge of the invaginating membrane in cellularizing cells (Fig. 2B) (Bhat et al., 1999). It was reported that dPatj RNAi knockdown impairs cellularization and results in shortened epithelial cells (Bhat et al., 1999), suggesting that dPatj is required in membrane invagination and the initiation of apical-basal polarity. Surprisingly, in stage 5 dPatjΔ7GLC embryos (n>10), we found no discernible defects in cellularizing cells in the absence of dPatj (Fig. 2B). Because dPatjΔ7GLC embryos completed their development through the embryonic and larval stages (supplementary material Table S1), even if the loss of dPatj caused cellularization defects that were too subtle to be observed by immunostaining, such defects were not detrimental to normal development. Our data confirm that dPatj is dispensable for cellularization and initiating apical-basal polarity.

After cellularization, establishing apical-basal polarity in polarizing embryonic epithelia requires the Crb-Sdt complex (Tepass and Knust, 1993; Bachmann et al., 2001; Hong et al., 2001). Again, RNAi knockdown of dPatj severely disrupted the apical localization of Crb and apical-basal polarization (Bhat et al., 1999). Similarly, in polarizing MDCK cells, RNAi knockdown of Patj caused the loss of Pals1 from tight junctions and delayed tight junction formation (Straight et al., 2004; Shin et al., 2005). These data support an essential role of dPatj in establishing apical-basal polarity. Nonetheless, we found that in stage 10 and 11 dPatjΔ7GLC embryos, both Crb and Sdt showed normal subcellular localization (Fig. 2C,D). Crb expression was slightly reduced in dPatjΔ7GLC embryos, but the overall pattern was clearly undisturbed (Fig. 2C). We further examined the subcellular localization of several representative polarity proteins in dPatjΔ7GLC embryos, including: DE-Cadherin (DE-Cad; Shotgun – FlyBase), which marks the adherens junction; Bazooka (Baz, or Par-3), which is required for the early stage of apical-basal polarization; Par-6 and atypical PKC (aPKC), which form an evolutionarily conserved apical complex that regulates multiple polarity proteins through aPKC-mediated phosphorylation (Suzuki et al., 2001; Betschinger et al., 2003; Plant et al., 2003; Sotillos et al., 2004; Krahn et al., 2010; Morais-de-Sá et al., 2010); and Discs large (Dlg, or Dlg1), which is required for specifying the basolateral membrane domain and junctions (e.g. septate junctions). As shown in Fig. 2E-H, in dPatjΔ7GLC embryos none of these polarity proteins showed any discernible changes in their expression level or subcellular localization. We conclude that Drosophila Patj is not essential for initiating and establishing apical-basal polarity.

dPatj supports Crb expression and subcellular localization in polarized epithelial cells

The reduction of Crb expression in the absence of dPatj has also been reported previously in polarized epithelial cells, such as the follicular cells of ovaries (Tanentzapf et al., 2000). Because such studies also used a deficiency-based dPatjMY10 allele with multiple gene deletions (Bhat et al., 1999), we generated dPatjΔ7 clones in larval imaginal discs and adult follicular cells to investigate their phenotypes in polarized epithelial cells (Fig. 3A-E). The dPatjΔ7 mutant clones in the imaginal epithelia showed mild reductions in the expression of Crb but not Baz (Fig. 3A), whereas clones in the follicular cells showed much stronger reductions in Crb expression (Fig. 3B). Therefore, dPatj appears to be specifically required to maintain high levels of Crb expression in polarized epithelial cells. Consistent with the observations of Tanentzapf et al. (Tanentzapf et al., 2000), reduced Crb expression in dPatj mutant cells did not disrupt their apical-basal polarity: other polarity markers, such as Baz, DE-Cad, Par-6 and aPKC, all appeared to be unaffected (Fig. 3A-E).

Fig. 3.

Fig. 3.

dPatj supports Crb expression in polarized epithelial cells and apical-basal polarity in early pupal photoreceptors. (A) dPatjΔ7 clone (outlined) in a larval imaginal disc shows subtle reduction in Crb expression but normal expression of Baz. (B-E) dPatjΔ7 clones in follicular epithelia show more marked loss of Crb (B) but no obvious disruption of DE-Cad (C), Par-6 (D) or aPKC (E). (F) Illustration of a transverse view of an early pupal ommatidium. Before 40% pupal development (pd), the apical membranes of all photoreceptors are converged at the center of the ommatidium and show enriched localization of Crb, Sdt, dPatj, Par-6 and aPKC (red). Adherens junctions that form between photoreceptors show ring-like patterns that are marked by DE-Cad, Arm and Baz (green). (G-I) In dPatjΔ7 mutant photoreceptors, Arm (G) and Baz (H) show mild disruptions (examples indicated by arrows), whereas Crb and Par-6 exhibit more severe mislocalization (I, arrowheads). All samples are from 37% pd pupae. In all panels, dPatjΔ7clones are marked by the loss of GFP (blue). Scale bars: 10 μm.

dPatj is required for apical-basal polarity in early pupal photoreceptors

For cells that must undergo dramatic remodeling of their apical-basal polarity, the supporting role of dPatj in maintaining the expression and subcellular localization of Crb might become crucial. In Drosophila, the highly polarized subcellular structures in the photoreceptor soma are generated through a complex morphogenetic process requiring many polarity proteins, including Baz, Crb, Sdt, Par-6 and aPKC (Izaddoost et al., 2002; Pellikka et al., 2002; Hong et al., 2003). It has been reported previously that in dPatjsynnull photoreceptors, the apparent loss of dPatj causes the disruption of apical-basal polarity in the soma (Nam and Choi, 2003; Nam and Choi, 2006). To conclusively show that such phenotypes are indeed specific to dPatj, we generated dPatjΔ7 mutant photoreceptor clones and examined their apical-basal polarity in early pupal retina at ∼37% pupal development (pd) (Fig. 3F-I). The dPatjΔ7 photoreceptors showed no dPatj expression (Fig. 3G) but did exhibit frequent mislocalization of major apical polarity proteins. Armadillo (Arm; Drosophila β-Catenin homolog) and Baz, which marks adherens junctions, were often disrupted in the dPatjΔ7 photoreceptors (Fig. 3G,H), in addition to the basolateral mislocalization of Par-6 and Crb (Fig. 3I). Therefore, although it is dispensable in normal epithelia, dPatj might be crucial to maintain apical-basal polarity under more complex and stringent developmental contexts.

dPatj is required for pupal development

We did not observe any obvious morphological abnormalities, such as the loss of imaginal discs, in dPatjΔ7/Df(3L)BSC123 (hereafter dPatjΔ7/Df) larvae (data not shown). However, within several hours of pupal formation, the dPatjΔ7/Df pupae exhibited deformities in shape, with a flattened anterior end and rounded posterior (Fig. 4A). At 16% pd, the head region was underdeveloped, although the imaginal discs appeared to have successfully everted (Fig. 4B), suggesting that even without dPatj the imaginal disc cells could still modulate their cell junctions to accomplish disc eversion (Pastor-Pareja et al., 2004). Older dPatjΔ7/Df pupae failed to develop head and thoracic regions and growth of the everted imaginal discs stalled (Fig. 4C). The pupal defects and lethality were completely rescued in VK20-dPatj-L or dPatjΔ7 VK20-dPatj::GFP-S (Fig. 4D and supplementary material Table S1). The mild reduction in Crb expression observed in the dPatj mutants was unlikely to be responsible for the pupal lethality because the additional removal of one copy of crb in dPatjΔ7/Df(3L)BSC123 crbko or dPatjΔ7 crbko/dPatjΔ13 did not enhance pupal lethality (supplementary material Table S1). The viability of dPatjsynhypo (Pielage et al., 2003; Nam and Choi, 2006) suggests that the N-terminal 260 amino acids of dPatj might be sufficient for pupal development, but at present the specific function of dPatj in pupal development remains to be identified.

Fig. 4.

Fig. 4.

dPatj is essential for pupal development. (A) Deformed dPatjΔ7/Df(3L)BSC123 (dPatjΔ7/Df) pupa at the beginning of pupation. (B,C) dPatjΔ7/Df and wild-type pupae at 16% pd and 72% pd, respectively. (D) Pupal development in dPatjΔ7 VK20-dPatj-L/Df(3L)BSC123 is completely rescued. WT are (A-C) dPatjΔ7 [or Df(3L)BSC123]/TM3 Sb twi>GFP and (D) dPatjΔ7 VK20-dPatj-L/TM6 Tb. In B-D, pupal cases were removed prior to imaging. Scale bars: 300 μm.

In summary, our molecularly defined dPatj null alleles conclusively show that dPatj is not essential for establishing or maintaining apical-basal polarity. The mild reduction in Crb expression in the absence of dPatj suggests that dPatj plays a supporting role in maintaining the Crb-Sdt complex in polarized epithelial cells. Such a scenario exhibits similarities with the situation for p120catenin (Adherens junction protein p120 – FlyBase) mutants: despite RNAi results suggesting that p120catenin is essential for cell adhesion, genetic mutants revealed that it only plays a supporting and non-essential role in cell adhesion in Drosophila (Myster et al., 2003). It remains possible, however, that mammalian Patj might have evolved increasingly important roles in apical-basal polarity, which might explain the differences between our dPatj null mutant phenotypes and those of mammalian cells with RNAi knocked-down Patj levels (Straight et al., 2004; Wang et al., 2004; Shin et al., 2005).

Supplementary Material

Supplementary Material

Acknowledgments

We thank the Bloomington Drosophila Stock Center and Kyoto Drosophila Genetic Resources Center for fly stocks; the Developmental Studies Hybridoma Bank (DSHB) for antibodies; and the University of Pittsburgh Medical School Center for Biologic Imaging for providing access to confocal microscopes.

Footnotes

Funding

This work was supported by National Institutes of Health (NIH) grants [R21RR024869 from the National Center for Research Resources (NCRR), R01GM086423 from the National Institute of General Medical Sciences (NIGMS)] to Y.H. Deposited in PMC for release after 12 months.

Competing interests statement

The authors declare no competing financial interests.

Supplementary material

Supplementary material available online at http://dev.biologists.org/lookup/suppl/doi:10.1242/dev.083162/-/DC1

References

  1. Bachmann A., Schneider M., Theilenberg E., Grawe F., Knust E. (2001). Drosophila Stardust is a partner of Crumbs in the control of epithelial cell polarity. Nature 414, 638–643 [DOI] [PubMed] [Google Scholar]
  2. Betschinger J., Mechtler K., Knoblich J. A. (2003). The Par complex directs asymmetric cell division by phosphorylating the cytoskeletal protein Lgl. Nature 422, 326–330 [DOI] [PubMed] [Google Scholar]
  3. Bhat M. A., Izaddoost S., Lu Y., Cho K. O., Choi K. W., Bellen H. J. (1999). Discs Lost, a novel multi-PDZ domain protein, establishes and maintains epithelial polarity. Cell 96, 833–845 [DOI] [PubMed] [Google Scholar]
  4. Bischof J., Maeda R. K., Hediger M., Karch F., Basler K. (2007). An optimized transgenesis system for Drosophila using germ-line-specific phiC31 integrases. Proc. Natl. Acad. Sci. USA 104, 3312–3317 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chou T. B., Perrimon N. (1996). The autosomal FLP-DFS technique for generating germline mosaics in Drosophila melanogaster. Genetics 144, 1673–1679 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Cook R. K., Christensen S., Deal J., Coburn R., Deal M., Gresens J., Kaufman T., Cook K. (2012). The generation of chromosomal deletions to provide extensive coverage and subdivision of the Drosophila melanogaster genome. Genome Biol. 13, R21 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Feng W., Long J. F., Zhang M. (2005). A unified assembly mode revealed by the structures of tetrameric L27 domain complexes formed by mLin-2/mLin-7 and Patj/Pals1 scaffold proteins. Proc. Natl. Acad. Sci. USA 102, 6861–6866 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Groth A. C., Fish M., Nusse R., Calos M. P. (2004). Construction of transgenic Drosophila by using the site-specific integrase from phage phiC31. Genetics 166, 1775–1782 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Hong Y., Stronach B., Perrimon N., Jan L. Y., Jan Y. N. (2001). Drosophila Stardust interacts with Crumbs to control polarity of epithelia but not neuroblasts. Nature 414, 634–638 [DOI] [PubMed] [Google Scholar]
  10. Hong Y., Ackerman L., Jan L. Y., Jan Y. N. (2003). Distinct roles of Bazooka and Stardust in the specification of Drosophila photoreceptor membrane architecture. Proc. Natl. Acad. Sci. USA 100, 12712–12717 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Huang J., Zhou W., Dong W., Watson A. M., Hong Y. (2009). Directed, efficient, and versatile modifications of the Drosophila genome by genomic engineering. Proc. Natl. Acad. Sci. USA 106, 8284–8289 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Hummel T., Klämbt C. (2008). P-element mutagenesis. Methods Mol. Biol. 420, 97–117 [DOI] [PubMed] [Google Scholar]
  13. Izaddoost S., Nam S. C., Bhat M. A., Bellen H. J., Choi K. W. (2002). Drosophila Crumbs is a positional cue in photoreceptor adherens junctions and rhabdomeres. Nature 416, 178–183 [DOI] [PubMed] [Google Scholar]
  14. Krahn M. P., Bückers J., Kastrup L., Wodarz A. (2010). Formation of a Bazooka-Stardust complex is essential for plasma membrane polarity in epithelia. J. Cell Biol. 190, 751–760 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Li Y., Karnak D., Demeler B., Margolis B., Lavie A. (2004). Structural basis for L27 domain-mediated assembly of signaling and cell polarity complexes. EMBO J. 23, 2723–2733 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Morais-de-Sá E., Mirouse V., St Johnston D. (2010). aPKC phosphorylation of Bazooka defines the apical/lateral border in Drosophila epithelial cells. Cell 141, 509–523 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Myster S. H., Cavallo R., Anderson C. T., Fox D. T., Peifer M. (2003). Drosophila p120catenin plays a supporting role in cell adhesion but is not an essential adherens junction component. J. Cell Biol. 160, 433–449 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Nam S. C., Choi K. W. (2003). Interaction of Par-6 and Crumbs complexes is essential for photoreceptor morphogenesis in Drosophila. Development 130, 4363–4372 [DOI] [PubMed] [Google Scholar]
  19. Nam S. C., Choi K. W. (2006). Domain-specific early and late function of Dpatj in Drosophila photoreceptor cells. Dev. Dyn. 235, 1501–1507 [DOI] [PubMed] [Google Scholar]
  20. Pastor-Pareja J. C., Grawe F., Martín-Blanco E., García-Bellido A. (2004). Invasive cell behavior during Drosophila imaginal disc eversion is mediated by the JNK signaling cascade. Dev. Cell 7, 387–399 [DOI] [PubMed] [Google Scholar]
  21. Pellikka M., Tanentzapf G., Pinto M., Smith C., McGlade C. J., Ready D. F., Tepass U. (2002). Crumbs, the Drosophila homologue of human CRB1/RP12, is essential for photoreceptor morphogenesis. Nature 416, 143–149 [DOI] [PubMed] [Google Scholar]
  22. Pielage J., Stork T., Bunse I., Klämbt C. (2003). The Drosophila cell survival gene discs lost encodes a cytoplasmic Codanin-1-like protein, not a homolog of tight junction PDZ protein Patj. Dev. Cell 5, 841–851 [DOI] [PubMed] [Google Scholar]
  23. Plant P. J., Fawcett J. P., Lin D. C., Holdorf A. D., Binns K., Kulkarni S., Pawson T. (2003). A polarity complex of mPar-6 and atypical PKC binds, phosphorylates and regulates mammalian Lgl. Nat. Cell Biol. 5, 301–308 [DOI] [PubMed] [Google Scholar]
  24. Roh M. H., Makarova O., Liu C. J., Shin K., Lee S., Laurinec S., Goyal M., Wiggins R., Margolis B. (2002). The Maguk protein, Pals1, functions as an adapter, linking mammalian homologues of Crumbs and Discs Lost. J. Cell Biol. 157, 161–172 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Roh M. H., Fan S., Liu C.-J., Margolis B. (2003). The Crumbs3-Pals1 complex participates in the establishment of polarity in mammalian epithelial cells. J. Cell Sci. 116, 2895–2906 [DOI] [PubMed] [Google Scholar]
  26. Shin K., Straight S., Margolis B. (2005). PATJ regulates tight junction formation and polarity in mammalian epithelial cells. J. Cell Biol. 168, 705–711 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Sotillos S., Díaz-Meco M. T., Caminero E., Moscat J., Campuzano S. (2004). DaPKC-dependent phosphorylation of Crumbs is required for epithelial cell polarity in Drosophila. J. Cell Biol. 166, 549–557 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Straight S. W., Shin K., Fogg V. C., Fan S., Liu C. J., Roh M., Margolis B. (2004). Loss of PALS1 expression leads to tight junction and polarity defects. Mol. Biol. Cell 15, 1981–1990 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Suzuki A., Yamanaka T., Hirose T., Manabe N., Mizuno K., Shimizu M., Akimoto K., Izumi Y., Ohnishi T., Ohno S. (2001). Atypical protein kinase C is involved in the evolutionarily conserved par protein complex and plays a critical role in establishing epithelia-specific junctional structures. J. Cell Biol. 152, 1183–1196 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Tanentzapf G., Smith C., McGlade J., Tepass U. (2000). Apical, lateral, and basal polarization cues contribute to the development of the follicular epithelium during Drosophila oogenesis. J. Cell Biol. 151, 891–904 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Tepass U., Knust E. (1993). Crumbs and stardust act in a genetic pathway that controls the organization of epithelia in Drosophila melanogaster. Dev. Biol. 159, 311–326 [DOI] [PubMed] [Google Scholar]
  32. Venken K. J. T., He Y., Hoskins R. A., Bellen H. J. (2006). P[acman]: a BAC transgenic platform for targeted insertion of large DNA fragments in D. melanogaster. Science 314, 1747–1751 [DOI] [PubMed] [Google Scholar]
  33. Wang Q., Margolis B. (2007). Apical junctional complexes and cell polarity. Kidney Int. 72, 1448–1458 [DOI] [PubMed] [Google Scholar]
  34. Wang Q., Hurd T. W., Margolis B. (2004). Tight junction protein Par6 interacts with an evolutionarily conserved region in the amino terminus of PALS1/stardust. J. Biol. Chem. 279, 30715–30721 [DOI] [PubMed] [Google Scholar]
  35. Xu T., Rubin G. M. (1993). Analysis of genetic mosaics in developing and adult Drosophila tissues. Development 117, 1223–1237 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material

Articles from Development (Cambridge, England) are provided here courtesy of Company of Biologists

RESOURCES